SEARCH

SEARCH BY CITATION

Keywords:

  • Hirschmanniella oryzae ;
  • hormones;
  • innate immunity;
  • Oryza sativa (rice);
  • root rot nematode

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. References
  • Studies involving plant–nematode interactions provide an opportunity to unravel plant defense signaling in root tissues. In this study, we have characterized the roles of salicylate (SA), jasmonate (JA), ethylene (ET) and abscisic acid (ABA) in plant defense against the migratory nematode Hirschmanniella oryzae in the monocot model plant rice (Oryza sativa).
  • Experiments with exogenous hormone applications, biosynthesis inhibition and mutant/transgenic lines were executed to test the effect on H. oryzae parasitism in rice roots.
  • Our results demonstrate that an intact ET, JA and SA biosynthesis pathway is a prerequisite for defense against H. oryzae. By contrast, exogenous ABA treatment drastically compromised the rice defense towards this nematode. Gene expression analyses using quantitative reverse transcription polymerase chain reaction (qRT-PCR) demonstrate that the disease-inducing effect of ABA is likely to be the result of an antagonistic interaction between this hormone and the SA/JA/ET-dependent basal defense system.
  • Collectively, in rice defense against H. oryzae, at least three pathways, namely SA, JA and ET, are important, while ABA plays a negative role in defense. Our results suggest that the balance of ABA and SA/JA/ET signaling is an important determinant for the outcome of the rice–H. oryzae interaction.

Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. References

Model systems can provide an excellent base for understanding a wide range of biological processes (Nakagami et al., 2010). Rice (Oryza sativa) has proved to be an excellent monocot model plant and the most readily transformable economically important cereal crop (Zhang et al., 1988; Hiei et al., 1994). Annual yield losses as a result of plant-parasitic nematodes on this crop range from 10 to 25% worldwide (Bridge et al., 2005) and the global agricultural losses have been estimated to be c. $157 billion yr−1 (Abad et al., 2008). One of the most damaging plant-parasitic nematodes in all major rice-growing areas is the rice root rot nematode (RRN) Hirschmanniella oryzae (Karakas, 2004). Hirschmanniella spp. infest 58% of the world's rice fields, causing 25% yield losses (Hollis & Keoboonrueng, 1984; Bridge et al., 2005). H. oryzae is a unique nematode in the sense that the nematode is perfectly adapted to constant flooding conditions (Bridge et al., 2005), making them the most serious and damaging nematodes in flooded/irrigated rice regimes. Having a high potential for damage at relatively low population densities, they cover a broad range of hosts in monocotyledonous and dicotyledonous plants (Karakas, 2004). As a migratory endoparasite, it causes necrosis of penetrated epidermal cells, and damages and destroys cortical cells, resulting in cavities in the cortex and necrotic regions. Above-ground symptoms on plants are growth retardation, decreased plant height, delayed tillering, and weight reduction of dry matter. The juveniles and adults enter behind the root tip at some distance from the tip and move freely in the air channels between the radial lamellae of the parenchyma. They may be found anywhere between the root base and the tip. A few days after entry, the female starts laying eggs which hatch in 4–5 d inside the roots. The nematode population increases by sexual reproduction and under suitable conditions the life cycle is completed in about 1 month. The nematode can have two or more generations per growing season. They can survive without food for several weeks and can overwinter in dead roots as eggs, juveniles or adults.

Studies involving plant–nematode interactions provide an opportunity to unravel plant defense signaling in root tissues especially with regard to plant hormones. Plants generally respond to pathogen infection using a sophisticated battery of defense mechanisms, in which the plant hormones salicylate (SA), jasmonate (JA) and ethylene (ET) play central signaling roles (Robert-Seilaniantz et al., 2007; Lopez et al., 2008; Grant & Jones, 2009). Each of these hormones generates and transmits distinct defense signals that are most likely enhancing resistance to a class of invaders. Some defense response genes require intact JA, ET, and SA signaling pathways after pathogen challenge (Campbell et al., 2003). On the other hand, their signaling pathways influence each other through a complex network of synergistic and antagonistic interactions (Koornneef & Pieterse, 2008), allowing the plant to tailor its defense reaction efficiently, depending on the type of attacker.

The complex signaling network involved in the plant's defense against bacterial, viral, and fungal pathogens has been extensively reviewed for dicotyledonous plants (Glazebrook, 2005; Lopez et al., 2008; Bari & Jones, 2009) and, although there are exceptions, it is generally accepted that an SA-dependent defense is active against pathogens with a biotrophic lifestyle, whereas JA/ET-dependent defenses are active against necrotrophic pathogens (Glazebrook, 2005) and herbivorous insects (Kessler & Baldwin, 2002; Rojo et al., 2003; Howe & Jander, 2008). In fact, the nature of the specific plant defense response is largely influenced by the biotrophic or necrotrophic lifestyle of the pathogen. Additional factors, such as the infection stage, age and type of plant tissue, are also important. These different factors interactively determine the nature of the specific defense response (De Vos et al., 2005). Recently, our research has shown that ET-induced systemic defense in rice involves a strong activation of JA biosynthesis and signaling genes, indicating that the JA pathway, which is modulated by ET, is the key defense pathway involved in rice root innate immunity against Meloidogyne graminicola, the sedentary biotrophic root knot nematode (RKN). The SA pathway, on the other hand, has a minor positive effect on root immunity against the RKN (Nahar et al., 2011).

Besides its signaling roles in diverse processes of plant growth and development, as well as in plant responses to various abiotic stresses (Yamaguchi-Shinozaki & Shinozaki, 2006), the plant hormone abscisic acid (ABA) has also emerged as a key signaling molecule in plant–pathogen interactions (Mauch-Mani & Mauch, 2005; Asselbergh et al., 2008), although its role is less direct than that of other defense regulatory plant hormones. ABA plays a complex role in the plant's defense response while it promotes resistance in some plant–pathogen interactions, whereas it increases susceptibility in others (Asselbergh et al., 2008; Ton et al., 2009). With only a few exceptions, exogenous application of ABA enhances the susceptibility of various dicotyledonous plant species to bacterial and fungal pathogens (Ward et al., 1989; Audenaert et al., 2002; Mohr & Cahill, 2003, 2007; Thaler & Bostock, 2004; Achuo et al., 2006; Asselbergh et al., 2007; de Torres-Zabala et al., 2007; Fan et al., 2009), by counteracting other hormone-dependent basal defenses. For example, according to de Torres-Zabala et al. (2009) bacterial pathogen-modulated ABA signaling antagonized SA-mediated plant basal defenses in Arabidopsis, suggesting an important role of ABA in the pathogenicity. It has also been suggested that in Arabidopsis exogenous application of ABA suppresses the JA/ET-activated transcription of defense genes (Lorenzo et al., 2004; Adie et al., 2007). Moreover, in support of these findings Anderson et al. (2004) also revealed that the ABA signaling pathway interacts with the JA signaling pathway, which, in itself, partially overlaps with the ET signaling pathway in regulating defense gene expression and resistance in Arabidopsis to biotrophic fungal pathogens. By contrast, a positive role for ABA in defense against insects and fungal pathogens has been suggested in Arabidopsis (Ton & Mauch-Mani, 2004; Bodenhausen & Reymond, 2007).

The role of ABA against fungal pathogens also appears ambivalent in the monocot model plant rice. ABA is a susceptibility factor for biotrophic blast (M. grisea) and interacts antagonistically with the SA pathway in the rice–M. grisea interaction (Koga et al., 2004; Jiang et al., 2010). By contrast, ABA induces rice defense against the necrotrophic brown spot pathogen Cochliobolus miyabeanus involving mitogen-activated protein (MAP) kinase-mediated repression of ET signaling (De Vleesschauwer et al., 2010). To date, the role of ABA and its interaction with other hormones have mostly been investigated for defense against leaf pathogens; only very little research has been conducted on root pathogens, such as nematodes. Karimi et al. (1995) compared the reproduction of Meloidogyne incognita on potato roots of ABA-treated plants with the reproduction on control plants. The number of egg masses was 70% lower in ABA-treated plants than in control plants, indicating that exogenous ABA would have a negative effect on plant susceptibility. It has been suggested by Volkmar (1991) that ABA may be involved in growth inhibition of Heterodera avenae-infected roots but appear to play no direct role in determining tolerance.

Unlike the role of hormonal pathways in the infection process between plants and sedentary nematodes, about which there is some knowledge (Glazer et al., 1985; Wubben et al., 2001, 2008; Mazarei et al., 2002, 2007; Nandi et al., 2003; Branch et al., 2004; Chinnasri et al., 2006; Bhattarai et al., 2008; Tucker et al., 2010; Nahar et al., 2011), almost nothing is known about the interaction between plants and migratory nematodes. In this report, we present an in-depth characterization of the roles of SA, JA, ET and ABA in systemic-induced defense in rice to the migratory root rot nematode (RRN) H. oryzae. We show that exogenous benzo(1,2,3) thiadiazole-7-carbothioc acid S-methyl ester (BTH), a salicylate analog, methyl jasmonate (MeJA) or 2-chloroethyl phosphonic acid (Ethephon, Eth) application on the shoots is actively inducing systemic defense against this migratory nematode in rice roots. Studies with mutants, transgenics and hormone biosynthesis inhibitors demonstrate that these three hormone pathways are a prerequisite for systemically induced defense and that the ET and JA pathways work independently of each other in root defense against H. oryzae. On the other hand, we also show that foliar ABA treatment suppresses rice basal immunity against this migratory nematode and show the antagonistic interaction between ABA and the SA/JA/ET pathways.

Materials and Methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. References

Plant material and growth conditions

Rice (Oryza sativa L.) lines used in this work included two japonica cv Nipponbare and cv Nihonmasari. The seeds of cv Nipponbare were provided by the US Department of Agriculture (GSOR-100) and corresponding SA-deficient NahG lines (Yang et al., 2004) and RNAi OsMPK5 transgenic (Xiong & Yang, 2003) were kindly provided by Yinong Yang (Pennsylvania State University); the hebiba mutant and its corresponding wildtype cv Nihonmasari were kindly provided by P. Nick (Karlsruhe University). Seeds were germinated on wet filter paper placed in the Petri dish for 4 d at 30°C before transplantation in the specially made polyvinyl-chloride (PVC) tubes containing a well prepared mixture of fine sand and synthetic absorbent polymer (SAP) substrate, as a growth medium (Reversat et al., 1999). Each PVC tube contained one plant. The plants were further kept in the plant room at 26°C, with a 12 : 12 h light regime (150 μmol m−2 s−1) and at a relative humidity of 70–75%. The plants were then maintained by supplying Hoagland solution as a source of nutrients at the rate of 10 ml twice a wk, and distilled water once a wk per plant in an alternating manner.

Infection experiments

Hirschmanniella oryzae originally isolated in Mayanmar was provided by Papa Win (a PhD student, Catholic University, Leuven, Belgium). The infected roots of rice were cut into 2 cm pieces and nematodes were extracted using a modified Bearmann extraction method (Hooper et al., 2005).The nematode suspension was collected 48 h later and concentrated by centrifugation at 450 g for 10 min at room temperature. Nematode counts were done under light microscopy to estimate the number of nematodes in the suspension. Eighteen-day-old rice plants were inoculated with a mixed population of H. oryzae at the rate of 200 per plant or mock-inoculated with water by inserting a 1 ml pipette tip just adjacent to the plant root system, and the suspension was then released. The degree of infection of the plants was evaluated at 21 d after inoculation (dai) by counting the number of nematodes per plant after staining with acid fuchsin. To visualize the nematodes, roots were boiled for 3 min in 0.8% acetic acid and 0.013% acid fuchsin. They were washed with running tap water and then destained in 5 : 100 ml acidified glycerol.

Chemical treatment

Ethephon, ABA and MeJA were purchased from Sigma-Aldrich (Sigma-Aldrich NV/SA Bornem, Belgium), and BTH was a kind gift from Syngenta Crop Protection (Brussels, Belgium). For the pharmacological experiments, ammonium diethyldithiocarbamic acid (DIECA) and fluridone, inhibiting JA and ABA biosynthesis, respectively, were purchased from Sigma. l-2-Aminooxy-3-phenylpropinoic acid (PAL), the inhibitor of the SA pathway, was a kind gift from Dr De Vleesschauwer, Ghent University. All hormone and inhibitor solutions were dissolved in separate vaporizers in a few drops of ethanol before diluting in water, with the exception of Eth and BTH, which were prepared in water containing 0.02% (v/v) Tween 20. The chemicals and the concentrations used were as follows: MeJA (100 μM), BTH (250 μM), Eth (500 μM), ABA (50 μM), DIECA (100 μM), and PAL (100 μM). For the chemical treatment of plants, intact 17-d-old seedlings were sprayed on to the leaves with vaporizers until runoff with a fine mist of either compound at the indicated concentrations. Distilled water containing 0.02% (v/v) Tween 20 was used as a control treatment. All experiments were repeated with similar results. In infection experiments, the chemicals were sprayed 24 h before nematode inoculation.

Data collection and statistical analyses

All statistical analyses were performed in IBM SPSS 19.0 (IBM SPSS, Inc., Chicago, IL, USA). Normality of the data was checked by applying the Kolmogorov–Smirnov test of normality (= 0.05). Homoscedasticity of the data was checked by applying the Levene test (= 0.05). The assumptions of normality and homoscedasticity of the data were found to be fulfilled in all cases. The collected data were then analyzed using ANOVA. The means of the control and treated groups were compared by Duncan's multiple mean comparison test.

RNA extraction, cDNA synthesis, and quantitative reverse transcription polymerase chain reaction (qRT-PCR)

The susceptible rice japonica cv Nipponbare was used in this experiment. Total root RNA was extracted using TRIzol (Invitrogen) following the manufacturer's instructions. The RNA concentration and purity were measured using the NanoVue spectrophotometer (GE Healthcare, Belgium). To remove contaminating DNA, the extract was treated with DNaseI. Three micrograms of RNA were treated with 1 μl of DNaseI (1 unit μl−1; Fermentas GmbH, Germany), 1 ml of RiboLock RNase Inhibitor (40 units μl−1; Fermentas), and 1.8 μl of DNaseI buffer (10×; Fermentas) in a total volume of 18 μl. The mixture was incubated at 37°C for 30 min, after which 2 μl of 25 mM EDTA was added and incubated for 10 min at 65°C to stop the reaction. First-strand cDNA synthesis was done in three steps: (1) addition of 1 μl of oligo(dT) (700 ng μl−1), 2 μl of 10 mM deoxyribonucleotide triphosphates, and 4 μl of RNase-free water to the DNase-treated RNA and incubation for 5 min at 65°C (to remove secondary structures); (2) addition of 8 μl of 5× first-strand buffer (Invitrogen) and 4 μl of 0.1 M dithiothreitol and incubation for 2 min at 42°C; and (3) addition of 1 μl of SuperScript II Reverse Transcriptase (200 units ml−1; Invitrogen) and incubation for 2 h at 42°C. The solution was diluted by adding 60 μl of water, and the quality of the cDNA was tested by performing a standard RT-PCR with some reference genes and checking the products on a 1.5% agarose gel. qRT-PCR was performed and analysed as described in Nahar et al. (2011). The primer sequences used for qRT-PCR are listed in Table 1.

Table 1. Overview of the reference and target genes used in this study, showing their GenBank accession/locus numbers and the primer pair used for quantitative reverse transcription polymerase chain reaction (qRT-PCR)
Reference/target geneGenBank accession/locus no.Forward primer (5′–3′)Reverse primer (5′–3′)
OsEXP LOC_Os03g27010 TGTGAGCAGCTTCTCGTTTGTGTTGTTGCCTGTGAGATCG
OsEXPNarsai LOC_Os07g02340.1 CACGTTACGGTGACACCTTTTGACGCTCTCCTTCTTCCTCAG
OsNCED3 NM_001057300.2 GTTCAAGCTCCAGGAGATGCAGAGGTGGAAGCAGAAGCAG
OsLip9 AB011367 CCGGCTACAGAGGAAGTGAGTCTCCATGATCTTGCCCAGT
OsACO7 Os01g39860 GGACTACTACCAGGGCACCAGATTAGCGCACGCGATTTTA
OsEIN2a Os07g06130 TAGGGGGACTTTGACCATTGTGGAAGGGACCAGAAGTGTT
OsAOS2 NM_001055971.1 TGCGCGACCGCCTCGATTTCGGCCAGGCGGGACGTTGATG
OsJAmyb AY026332 GAGGACCAGAGTGCAAAAGCCATGGCATCCTTGAACCTCT

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. References

Effect of foliar plant hormone application in two rice cultivars against the root rot nematode H. oryzae

Given the observed pivotal role of plant hormones in systemic defense pathways in the rice roots against the sedentary RKN M. graminicola (Nahar et al., 2011), we tested whether these hormones also activate systemic defense in rice towards the migratory endoparasitic RRN H. oryzae, a nematode with a very different lifestyle from that of the RKN. To this end, we sprayed the shoots of two rice cultivars (Nipponbare and Nihonmasari) with BTH, MeJA, Eth and ABA at concentrations of 250, 100, 500 and 50 μM, respectively. Twenty-four hours later they were inoculated with a mixed population of H. oryzae at the rate of 200 per plant. The effects of these hormones were then evaluated by counting the number of nematodes per plant at 21 dai on treated and untreated plants (controls). The results are shown in Fig. 1. BTH, Eth and MeJA treatments resulted in a significant reduction in nematode infection per plant compared with the control plants, while ABA suppressed the basal immunity of both rice cultivars to the RRN (Fig. 1a,b). BTH, Eth and MeJA yielded a slightly stronger effect on cv Nihonmasari (45–52%) than on cv Nipponbare (27–41%; Fig. 1a,b).

image

Figure 1. Effects of foliar hormone application on Hirschmanniella oryzae infection in two different rice (Oryza sativa) cultivars, (a) cv Nihonmasari, (b) cv Nipponbare. Shoots of 18-d-old rice plants were sprayed until runoff with 500 μM Ethephon (Eth), 100 μM methyl jasmonate (MeJA), 250 μM 2-chloroethyl phosphonic acid (BTH), 50 μM abscisic acid (ABA) or the corresponding control solution. At 24 h after hormone treatment, plant roots were inoculated with 200 mixed-stage H. oryzae. The number of nematodes per plant was counted at 3 wk after inoculation. Bars represent means + SE of eight plants. Different letters indicate statistically significant differences (Duncan's multiple range test with P = 0.05). Data represent one of three independent experiments with similar results. Cont, control.

Download figure to PowerPoint

SA/JA biosynthesis triggers systemic-induced defense in roots against H. oryzae and each works independently of the other

To further check the molecular machinery underpinning SA/JA-mediated defense and the interaction between these pathways in the systemically induced plant defense of rice against RRNs, we studied different rice mutants or transgenic plants that are impaired in one of these two pathways: the SA-deficient transgenic NahG plants (Yang et al., 2004) and the JA biosynthesis mutant hebiba (Riemann et al., 2003). In addition, 1 d before nematode inoculation, SA production was inhibited by applying a phenylpropanoid pathway (L-2-aminooxy-3-phenylpropinoic acid) inhibitor, a potent inhibitor of SA-biosynthesis (Mauch-Mani & Slusarenko, 1996; Govrin & Levine, 2002), to wildtype Nipponbare as well as NahG plants. SA-deficient transgenic NahG plants are unable to accumulate SA because they express bacterial SA hydroxylase, which converts SA to catechol (Yang et al., 2004). When BTH, a functional analog of SA, was foliarly sprayed at a concentration of 250 μM, it resulted in a drastic decrease in plant susceptibility to H. oryzae in both the transgenic line (NahG) and wildtype plants as compared with nontreated plants (Fig. 2a). SA biosynthesis inhibition, either genetically or chemically, resulted in significantly higher susceptibility towards H. oryzae, suggesting that SA biosynthesis triggers induced defense against RRNs.

image

Figure 2. Analysis of the role of salicylate (SA)/jasmonate (JA)/ethylene (ET) pathways in induced defense against Hirschmanniella oryzae in rice (Oryza sativa). (a) Effect of 2-chloroethyl phosphonic acid (BTH) pretreatment in SA-deficient NahG plants and inhibition of SA biosynthesis in both wildtype and NahG plants against H. oryzae. (b) SA/JA-induced systemic defense, JA biosynthesis mutant hebiba and the corresponding wildtype Nihonmasari plants were sprayed until runoff with 100 μM methyl jasmonate (MeJA), or 100 μM JA-biosynthesis inhibitor or BTH (250 μM) or the control solution. (c) Role of the JA pathway after application of MeJA in SA-deficient transgenic NahG and corresponding wildtype Nipponbare plants. (d) JA pathway in ET-induced systemic defense against H. oryzae in rice. Eighteen-day-old plants were sprayed until runoff with 500 μM ethephon (Eth) or with the control solution on the shoots of JA-deficient hebiba mutant and JA biosynthesis-inhibited plants. Twenty-four hours after chemical treatment they were challenged with 200 mixed-stage H. oryzae. Bars represent means + SE of the number of nematodes per plant at 3 wk after inoculation recorded on eight plants. Different letters indicate statistically significant differences (Duncan's multiple range test with P = 0.05). Data represent one of two independent experiments with similar results. SA and JA biosynthesis inhibitors are L-2-aminooxy-3-phenylpropinoic acid (PAL-100 μM) and ammonium diethyldithiocarbamic acid (DIECA-100 μM), respectively. Cont, control; Nipo, Nipponbare; Nihon, Nihonmasari.

Download figure to PowerPoint

As Fig. 2(b) shows, both the JA biosynthesis mutant hebiba and chemical blocking of JA biosynthesis in planta by exogenously applying 100 μM DIECA (Farmer et al., 1994) significantly increase susceptibility to H. oryzae compared with the cv Nihonmasari control. Exogenous MeJA application makes the hebiba mutant less susceptible to RRN and this mutant also responds to exogenous BTH treatment to reduce the amount of infection by H. oryzae (Fig. 2b). On the other hand, exogenous MeJA treatment induced plant systemic defense against the nematodes when applied to SA-deficient NahG plants (Fig. 2c). These data indicate that SA and JA biosynthesis are required in induced systemic defense against H. oryzae and that both pathways act independently of each other in eliciting induced defense toward RRNs in rice roots.

ET-induced defense is independent of the JA biosynthesis pathway against H. oryzae

From our previous research (Nahar et al., 2011) it is known that the ET pathway acts through activation of the JA pathway to induce defense against the sedentary RKN M. graminicola. This knowledge prompted us to assess the involvement of the JA pathway in the ET-induced defense against migratory RRN. To this end we tested the effectiveness of Eth in the jasmonate-deficient hebiba mutant and in JA biosynthesis-inhibited plants. Fig. 2(d) shows that both treatments resulted in significantly lower susceptibility towards H. oryzae than the untreated control, wildtype cv Nihonmasari. This result suggests that the JA pathway is not needed for ET-inducible defense against RRNs in rice.

ABA suppresses basal immunity of rice against RRNs and antagonizes the jasmonate pathway

By contrast to the well-established role of ABA in abiotic stress adaptation (Fujita et al., 2005), its contribution to disease resistance is less well understood and even controversial (De Vleesschauwer et al., 2010). In a first attempt to elucidate the role of ABA in root immunity to H. oryzae, we tested the effect of exogenous application of 50 μM ABA on two rice cultivars and found that ABA rendered the rice seedlings more susceptible to a compatible rice–H. oryzae interaction (Fig. 1). The role of the ABA-inducible mitogen-activated protein kinase OsMPK5 in pathogen defense and abiotic stress tolerance in rice is well documented (Xiong & Yang, 2003). To examine the role of the ABA signal transduction through OsMPK5 in ABA-induced susceptibility to the RRN, an infection experiment on the OsMPK5-suppressed transgenic line RI7 (Xiong & Yang, 2003) was performed. Our results show that the OsMPK5-silenced plants are more resistant to RRNs (Fig. 3a), meaning that OsMPK5 appears to be an integral component of ABA-induced susceptibility against H. oryzae. In accordance with this, treatment with 1 μM fluridone, an inhibitor of ABA biosynthesis, led to a substantial reduction in disease severity (Fig. 3a). These results suggest that ABA biosynthesis and signaling support higher susceptibility to H. oryzae. However, exogenous ABA treatment on OsMPK5-silenced plants restored the susceptibility to wildtype values. The fact that ABA still renders the OsMPK5-silenced lines more susceptible would mean that ABA-induced susceptibility does not only work through the activation of OsMPK5 or that low levels of this gene are sufficient to reduce the root defense system.

image

Figure 3. Abscisic acid (ABA)-induced susceptibility to Hirschmanniella oryzae involves repression of jasmonate (JA)-mediated defenses. (a) ABA suppresses root immunity in rice (Oryza sativa) against the root rot nematode (RRN). (b) Exogenous ABA (50 μM) overrules JA-induced defense. Hormone treatments, pathogen inoculation and collection of data on plant defense parameters were performed exactly as described in Fig. 1. Bars represent means + SE of eight plants. Different letters indicate statistically significant differences (Duncan's multiple range test with P = 0.05). (c) Cross-talk experiments demonstrating reciprocal negative interactions between the ABA and JA pathways in root tissue of cv Nipponbare. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed on RNA from root tissues at 24 h after hormone treatment. The relative expression levels of the JA-responsive (OsAOS2 and OSJAmyb) and ABA-regulatory genes (OsNCED3 and OsLIP9) in roots of treated vs untreated plants are shown. Gene expression levels were normalized using two internal reference genes, OsEXP and OsEXPNarsai. ABA, black bars; methyl jasmonate (MeJA), gray bars. Asterisks indicate statistically significant (P = 0.001) differential expression in comparison with untreated plants. Cont, control; Fluridone, ABA biosynthesis inhibitor; Nipo, Nipponbare.

Download figure to PowerPoint

In Arabidopsis, ABA has been shown to antagonize the JA signaling pathway, and this antagonism is considered responsible for the enhancement of disease susceptibility by ABA against the soilborne fungus Fusarium oxysporum (Anderson et al., 2004). Given the paramount importance of JA in systemic defense against RKNs in rice (Nahar et al., 2011), we decided to investigate further the crosstalk between JA and ABA in the rice–migratory nematode interaction. Interestingly, we found that application of ABA overrules the resistance that is conferred by MeJA application (Fig. 3b), which suggests a negative crosstalk between JA and ABA. To further confirm the hypothesis that JA and ABA antagonize each other in the rice root, we analyzed mRNA levels of genes involved in the JA and ABA pathways in rice root tissue at 24 h after foliar hormone treatment using qRT-PCR. Fig. 3(c) shows that foliar ABA treatment inhibits both the JA biosynthesis gene OsAOS2 (Mei et al., 2006) and the JA-inducible rice myb transcription factor gene OsJAmyb (Lee et al., 2001) in rice roots. On the other hand, treating plants with MeJA resulted in a strong down-regulation of both ABA biosynthesis (OsNCED3) and responsive (OsLip9) genes (Fig. 3c). These findings support the notion that ABA-induced susceptibility to RRNs in rice involves repression of the JA pathway.

Temporal dynamics of the ABA pathway upon H. oryzae attack and in response to hormone treatments

In order to obtain a more detailed understanding of the role of ABA-induced susceptibility and its interaction with SA/JA/ET-mediated defense signaling in the H. oryzae-infected root system, we used qRT-PCR to monitor the steady-state mRNA levels of ABA biosynthetic and responsive genes in roots of inoculated Nipponbare plants grown in the presence or absence of different hormones.

Relative expression levels of the ABA pathway genes in H. oryzae-infected roots, compared with corresponding mock-inoculated tissue, are shown in Fig. 4. Soon after infection (3 d after inoculation; dai), the mRNA levels of the ABA biosynthesis gene OsNCED3 are significantly up-regulated whereas the ABA-signaling gene OsLip9 is down-regulated in the infected root tissue. When the systemic defense-inducing compound Eth was administered to the shoots 1 d before root infection with the migratory nematode, the ABA biosynthesis and signaling genes returned to basal expression levels at all time points during the investigation in comparison to roots from untreated and noninfected plants (Fig. 4). Although both OsNCED3 and OsLip9 were strongly down-regulated in the MeJA-treated plant roots at 24 h after foliar treatment (Fig. 3c), at 3 dai mRNA levels of OsNCED3 in the H. oryzae-infected plants but not OsLip9 had returned to control values after exogenous MeJA application. Furthermore, relative expression levels of both OsNCED3 and OsLip9 show strong down-regulation in the roots of inoculated Nipponbare plants grown in the presence of BTH.

image

Figure 4. Temporal dynamics of the abscisic acid (ABA) pathway in response to ABA and other hormones upon Hirschmanniella oryzae attack. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) experiments on ABA biosynthesis (OsNCED3) and signaling genes (OsLip9), demonstrating the interactions among ABA and the salicylate (SA)/jasmonate (JA)/ethylene (ET) pathways in root tissues of rice (Oryza sativa) cv Nipponbare infected with H. oryzae. Seventeen-day-old plants were treated with 50 μM ABA, 100 μM methyl jasmonate (MeJA), 500 μM ethephon (Eth), 250 μM 2-chloroethyl phosphonic acid (BTH) or control solutions, and 1 d after hormone treatment they were inoculated with 200 nematodes per plant. Data are shown as relative expression levels of infected and treated/untreated tissue in comparison with the control tissue (roots of uninfected and untreated plants). Gene expression levels were normalized using two internal reference genes, OsEXP and OsEXPNarsai. Bars represent mean expression levels + SE from two biological and three technical replicates, each containing a pool of three plants. Asterisks indicate statistically significant (P = 0.001) differential expression in comparison with untreated and uninfected plants. Nipo, Nipponbare; HO, H. oryzae-infected; dai, days after inoculation. Black bars, 3 dai; light gray bars, 4 dai; dark gray bars, 5 dai.

Download figure to PowerPoint

ABA interacts with multiple hormone pathways upon H. oryzae infection in rice

Theoretically, crosstalk between hormone pathways may occur at the level of biosynthesis regulation, signal transduction and/or gene expression. Therefore, to further elucidate the molecular machinery underpinning ABA-induced susceptibility to H. oryzae, we focused on exploring the interaction of ABA with other plant defense regulators during rice–nematode interaction.

ABA and SA

Abscisic acid has been shown to antagonize the SA signaling pathway in both dicots and monocots, and this antagonism is considered to be responsible for the enhancement of disease susceptibility by ABA (de Torres-Zabala et al., 2007; Yasuda et al., 2008; Jiang et al., 2010). In order to investigate the crosstalk between the ABA and the SA pathway during the rice–RRN interaction, the expression of an SA biosynthesis (OsICS1) and a signaling (OsWRKY45) gene was analyzed.

As shown in Fig 5(a), expression of OsICS1 responded negatively to H. oryzae at the later stage of infection, whereas OsWRKY45 responded negatively at both the early and later stages of infection. BTH treatment caused a strong induction of both OsICS1 and OsWRKY45 genes, remaining at high levels throughout the course of the infection, suggesting a positive correlation between SA-inducible gene expression and overall defense to H. oryzae. By contrast, treating plants with 50 μM ABA resulted in a strong down-regulation of the SA biosynthesis and signaling genes (Fig. 5a), confirming the antagonism between SA and ABA in rice. In light of the view that BTH also strongly suppresses the ABA pathway (Fig. 5a), our results indicate that SA and ABA cause cross-inhibitory effects on the reciprocal hormone biosynthesis pathways during the rice–migratory nematode interaction.

image

Figure 5. Effects of abscisic acid (ABA)-induced susceptibility on the transcript abundance of OsICS1 and OsWRKY45 (salicylate pathway) (a), OsAOS2 and OsJAmyb (jasmonate pathway) (b) and OsACO7 and OsEIN2a (ethylene pathway) (c) in pretreated and Hirschmanniella oryzae-inoculated plant roots at the indicated time points, as analyzed by quantitative reverse transcription polymerase chain reaction (qRT-PCR).Seventeen-day-old rice (Oryza sativa) plants were treated with 50 μM ABA, 100 μM methyl jasmonate (MeJA), 500 μM ethephon (Eth), 250 μM 2-chloroethyl phosphonic acid (BTH) or control solutions, and 1 d after hormone treatment they were inoculated with 200 nematodes per plant. Data are shown as relative expression levels of infected and treated/untreated tissues in comparison with the control tissue (roots of uninfected and untreated plants). Gene expression levels were normalized using two internal reference genes, OsEXP and OsEXPNarsai. Bars represent mean expression levels + SE from two biological and three technical replicates, each containing a pool of three plants. Asterisks indicate statistically significant (P = 0.001) differential expression in comparison with untreated and uninfected plants. Nipo, Nipponbare; HO, H. oryzae-infected; dai, days after inoculation. Black bars, 3 dai; light gray bars, 4 dai; dark gray bars, 5 dai.

Download figure to PowerPoint

ABA and JA

The results presented in Fig. 4 show no significant changes in transcript abundance of the ABA pathway in nematode-infected roots upon MeJA treatment, except for a minor reduction of OsLip9 at 3 dai. However, when the plants are not infected, we show that the ABA pathway is suppressed by MeJA treatment (Fig. 3c). To further probe the nature of ABA–JA crosstalk during rice–H. oryzae interaction, we next monitored the expression of the JA pathway genes OsAOS2 and OsJAmyb at various times after infection and in the presence or absence of ABA and JA. Temporal expression of both genes seemed to be unchanged upon H. oryzae infection, except for OsAOS2 (Fig. 5b), which was slightly up-regulated at 3 dai. As expected, MeJA treatment induced the expression of both JA biosynthesis (OsAOS2) and signaling (OsJAmyb) genes (Fig. 5b). ABA treatment suppresses the JA pathway genes (Fig. 5b) in comparison with roots from untreated and noninfected plants.

ABA and ET

As shown in Fig. 5(c), ET biosynthesis (OsACO7) and signaling (OsEIN2a) genes were not differentially expressed upon nematode attack. A strong up-regulation of both ET-regulated genes (OsACO7 and OsEIN2a) in ET-treated nematode-infected plants was observed. On the other hand, transcription of OsACO7 was down-regulated in ABA-treated H. oryzae-infected plants at all times during the investigation, and for OsEIN2a a significant down-regulation was observed at 4 dai (Fig. 5c).

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. References

Most studies on systemic signals mediated by plant hormones in plant–pathogen interaction focus on the classical defense hormones SA, JA and ET (Hammond-Kosack & Parker, 2003; Robert-Seilaniantz et al., 2007; Bari & Jones, 2009), but the involvement of other hormones, such as ABA, has become apparent (Robert-Seilaniantz et al., 2011). Broadly speaking, the SA-dependent pathway triggers resistance against biotrophic and hemibiotrophic pathogens, whereas resistance against necrotrophic pathogens and insects is usually controlled by the JA/ET-dependent pathway (Felton & Korth, 2000). However, crosstalk among them, either synergistically or antagonistically, is crucial in induced defense against diverse types of pathogens (Durrant & Dong, 2004).

The research described here aims to characterize the role of SA-, JA-, ET- and ABA-mediated systemic defense signaling in rice and their importance in root defense against the RRN H. oryzae. Studies involving plant–nematode interactions provide an opportunity to observe defense signaling in root tissues, which is an inadequately represented perspective in plant defense research. The migratory endoparasite H. oryzae destroys the tissue while moving through the root cortex, resulting in large necrotic root lesions. The data presented in this report show that exogenous Eth, MeJA and BTH are potent inducers of systemic root defense against RRN attack in rice, while ABA application induces susceptibility to this nematode.

Although the production of SA is generally linked to systemic acquired resistance (SAR) in other plants (van Loon et al., 2006), SAR in rice has not been completely elucidated, but SA probably plays a different role based on the pathogen encountered. It has been suggested that local endogenous SA protects rice from oxidative damage caused by aging as well as by biotic and abiotic stress (Yang et al., 2004), and BTH application has been shown to induce defense against many fungal and bacterial pathogens (Rohilla et al., 2002; Shimono et al., 2007; De Vleesschauwer et al., 2008). A number of studies have also been conducted on dicotyledonous plants showing that application of BTH/SA to the roots of Arabidopsis (Arabidopsis thaliana) or tomato (Solanum lycopersicum) and shoots of okra (Abelmoschus esculentus), cowpea (Vigna unguiculata) or grapevines (Vitis vinifera) enhanced resistance to two types of sedentary nematodes, namely the cyst nematodes and the RKNs (Owen et al., 2002; Nandi et al., 2003; Branch et al., 2004; Wubben et al., 2008), possibly by elevated expression of defense-related genes. Based on the data provided here from exogenous BTH treatments, SA biosynthesis inhibition, SA-deficient plants and qPCR analyses, we can conclude that the SA-dependent defense pathway in rice induces a strong defense against the migratory nematode H. oryzae. Recently our research group has shown that exogenous foliar application with the SA analog BTH only results in a minor induction of systemic defense pathways against sedentary RKN attack, while Eth and MeJA are more potent defense inducers in the RKN–rice interaction (Nahar et al., 2011). In the rice–RRN interaction, however, SA, JA and ET each appears to play equally important roles. The different degree to which the SA effect induces defense against RKNs and RRNs might be explained by the different infection strategy of both nematodes. Migratory nematode-affected plant cells are either fed upon or left behind as the nematode migrates away, while RKNs induce specialized feeding structures. During their intimate interaction with the plant, RKNs strongly suppress the plant's innate immunity system both locally and in systemic tissues, mainly through interference with the SA and ET pathways (Kyndt et al., 2012a,b). Such a strong interference with the innate immune system has not been observed for RRN-infected plants, where the SA, JA and ET pathways are instead induced early after infection (Kyndt et al., 2012a,b). Our results show that BTH can still induce defense against RRNs in the JA-deficient hebiba plants, signifying that the SA-induced systemic defense does not need any activity in the JA pathway for this rice–nematode interaction. Similarly, MeJA spraying induces defense against RRNs in NahG plants, containing a lower endogenous concentration of SA (Gaffney et al., 1993; Delaney et al., 1994), indicating the mutual independence of the SA and JA pathways in defense against RRNs. SA and JA cross-talk in either negative or positive ways in different plant–pathogen interaction systems (Kunkel & Brooks, 2002; Rojo et al., 2003; Bostock, 2005; Leon-Reyes et al., 2010). In Arabidopsis, it has been suggested that separate JA- and SA-dependent defense pathways are essential for resistance involving the activation of separate sets of genes encoding antimicrobial proteins to distinct microbial pathogens (Thomma et al., 1998).

Methyl jasmonate application to roots of oat (Avena sativa) and spinach (Spinacia oleracea) and to shoots of tomato enhanced resistance to RKNs, possibly by elevating the concentrations of compounds that are toxic to nematodes, such as phytoectosteroids, flavonoids, and proteinase inhibitors (Soriano et al., 2004a,b; Cooper et al., 2005). Similar to these studies and our previous findings on RKN–rice interaction (Nahar et al., 2011), the current study shows that MeJA is an effective elicitor of systemically induced defense mechanisms against migratory RRNs in rice roots. Foliar application with Eth was shown to activate not only the ET pathway but also the JA pathway and the expression of the pathogenesis-related (PR) genes OsPR1a and OsPR1b in rice roots (Nahar et al., 2011). It has been demonstrated that some defense genes, such as the Arabidopsis genes PDF1.2 (Anderson et al., 2004), need a simultaneous production of both JA and ET. On the other hand, ET alone can also activate JA-independent defense responses in Arabidopsis (Lorenzo et al., 2003). The data provided in the current study show that ET works independently of JA to promote defense against RRNs in rice roots, with ET-induced defense still active in the JA biosynthesis mutant hebiba. However, while Eth also induces defense against RKNs in rice (Nahar et al., 2011), its activity against RKNs was shown to be dependent on activation of the JA pathway, since it was not functional in hebiba. To explain these apparent contradictions in ET dependence on JA, we have to consider the infection strategy of both nematodes and the way they manipulate plant defense pathways to their own benefit. Infection by RRNs involves wounding of the root, and hence the JA and ET pathways will be activated, as shown by Kyndt et al. (2012b) and the qRT-PCR results in this study. Enhancing these pathways by external Eth application leads to higher expression of PR genes (Nahar et al., 2011), indicating stronger defense. However, transcriptional analyses of root galls (Kyndt et al., 2012b) showed a suppression of the ET pathway, but not the JA pathway, in roots infected by RKNs. Also in hebiba plants, ET will be suppressed by the RKNs, which explains why Eth application does not lead to defense in these plants.

The effects of ABA have been shown to be different depending on the pathogen's lifestyle, both in monocots and dicots (Mauch-Mani & Mauch, 2005; Asselbergh et al., 2008; De Vleesschauwer et al., 2010). Most studies have shown that ABA leads to enhanced pathogen susceptibility (Ward et al., 1989; McDonald & Cahill, 1999; Audenaert et al., 2002; Mohr & Cahill, 2003; Koga et al., 2004; Achuo et al., 2006; Fan et al., 2009; Jiang et al., 2010). Pretreatment of potato plants with ABA increased susceptibility to Phytophthora infestans and Cladosporium cucumerinum (Henfling et al., 1980). ABA-deficient tomato plants were more resistant to the necrotrophic pathogen Botrytis cinerea and the bacterial pathogen Pseudomonas syringae pv tomato (Pst), whereas exogenous application of ABA restored the susceptibility to this pathogen in the mutant plants (Audenaert et al., 2002; Thaler & Bostock, 2004). ABA treatment drastically enhanced disease susceptibility in rice not only to compatible but also to incompatible strains of Magnaporthe grisea (Jiang et al., 2010). Our experiments with exogenous ABA and ABA biosynthesis inhibitors reveal that ABA also plays a negative role in rice defense against migratory nematodes in roots. Nevertheless, Karimi et al. (1995) revealed a lower reproduction of the sedentary nematode M. incognita on potato roots of ABA-treated plants, but in that study higher ABA concentrations were used (100 μM), and the effect might vary depending on the lifestyle of the nematode.

It has been revealed by Xiong & Yang (2003) that dsRNAi transgenic OsMPK5 plants show constitutive expression of PR genes such as PR1 and PR10 and significantly enhance resistance to fungal and bacterial pathogens in rice. Our data provide evidence that these plants are also more resistant to RRNs. It has been suggested that ABA interacts antagonistically with the SA pathway in the rice–M. grisea interaction (Jiang et al., 2010). In this study, we have also shown that SA and ABA mutually antagonize each other's signaling pathways in the rice–H. oryzae interaction. Foliar ABA application suppresses SA biosynthesis (OsICS1) and SA signaling (OsWRKY45) in rice roots, accompanied by an enhanced susceptibility to H. oryzae infection. Conversely, SA (BTH) suppressed ABA-related gene expression during nematode infection. Interestingly, the compatible rice–H. oryzae interaction induced a strong up-regulation of an ABA biosynthesis gene soon after infection, which results in induction of the ABA-responsive gene OsLip9 at later stages of infection. These data suggest that during a compatible interaction the ABA pathway is activated, resulting in enhanced rice susceptibility. Although it is hard to distinguish whether these observations are the result of nematode effects or systemic hormone signaling effects, we can speculate that the RRN is interfering with the normal hormone homeostasis, resulting in the suppression of the SA pathway and induction of the ABA pathway, to promote root susceptibility. These data, taken together, strongly suggest that the balance of interaction between SA and ABA signaling is an important determinant in the outcome of the rice–H. oryzae interaction.

The JA and ET pathways are known to play synergistic roles in plant innate immunity (Pieterse et al., 2009). In the case of migratory nematode-infected roots, a trend of coregulation of genes involved in these pathways was also observed, with them generally being unchanged or up-regulated compared with noninfected roots, similar to their systemic induction upon RRN infection (Kyndt et al., 2012a). Besides the negative effect of ABA on SA-dependent defense, our data suggest a crucial role of ABA–JA/ET signal interactions in determining rice–H. oryzae outcomes. qRT-PCR analysis shows that JA and ET pathways are suppressed in ABA-treated infected plants compared with untreated uninfected plants, suggesting antagonistic effects of ABA on the JA/ET pathway. It has also been suggested that, in Arabidopsis, ABA negatively regulates defense against the soilborne fungus F. oxysporum, by antagonizing JA and ET signaling networks (Anderson et al., 2004). Recently, Bailey et al. (2009) reported that the exogenous application of ABA drastically reduces ET concentrations in rice and enhances rice blast susceptibility. In addition, RNAi-mediated suppression of OsEIN2b, a central component of ET signal transduction, resulted in ABA hypersensitivity, reduced defense gene expression, and enhanced blast susceptibility. Bailey et al. (2009) suggested that ABA antagonistically interacts with the ET signaling pathway and, consequently, enhances susceptibility of rice to M. grisea.

The data provided in this study suggest that exogenous BTH, MeJA or Eth supplied to the rice shoot induce systemic SA/JA/ET pathways in the infected root tissues, hence protecting the plant from infection with migratory nematodes. When taken together, our results support the idea that ABA opposes the SA/ET/JA signaling pathways to suppress the defense response against H. oryzae in rice.

Conclusion

In closing, we present an in-depth characterization of the roles of SA, JA, ET and ABA in mediating effective systemic rice response to the root nematode H. oryzae. H. oryzae is a migratory endoparasite which can easily escape from the plant defense system by moving through and out of the root system. Yet, to our knowledge, no study has addressed the role of hormones in the plant–migratory nematode interaction. Our results show that application of BTH, MeJA or Eth to the shoots induces systemic defense pathways in rice roots, which are active against the migratory nematode H. oryzae. On the other hand, ABA induces susceptibility to this nematode. Our data also demonstrate that SA and ET act independently of the JA pathway in switching on the induced defense mechanisms in rice–H. oryzae interaction. Moreover, the results presented here and those published previously (Xiong & Yang, 2003; Yasuda et al., 2008; Bailey et al., 2009; de Torres-Zabala et al., 2009; Jiang et al., 2010) emphasize that ABA-induced susceptibility interacts antagonistically with other hormonal pathways (SA/JA/ET).

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. References
  • Abad P, Gouzy J, Aury J-M, Castagnone-Sereno P, Danchin EGJ, Deleury E, Perfus-Barbeoch L, Anthouard V, Artiguenave F, Blok VC et al. 2008. Genome sequence of the metazoan plant parasitic nematode Meloidogyne incognita. Nature Biotechnology 26: 909915.
  • Achuo EA, Prinsen E, Hofte M. 2006. Influence of drought, salt stress and abscisic acid on the resistance of tomato to Botrytis cinerea and Oidium neolycopersici. Plant Pathology 55: 178186.
  • Adie B, Chico JM, Rubio-Somoza I, Solano R. 2007. Modulation of plant defenses by ethylene. Journal of Plant Growth Regulation 26: 160177.
  • Anderson JP, Badruzsaufari E, Schenk PM, Manners JM, Desmond OJ, Ehlert C, Maclean DJ, Ebert PR, Kazan K. 2004. Antagonistic interaction between abscisic acid and jasmonate-ethylene signaling pathways modulates defense gene expression and disease resistance in Arabidopsis. Plant Cell 16: 34603479.
  • Asselbergh B, Curvers K, Franca SC, Audenaert K, Vuylsteke M, Van Breusegem F, Hoefte M. 2007. Resistance to Botrytis cinerea in sitiens, an abscisic acid deficient tomato mutant, involves timely production of hydrogen peroxide and cell wall modifications in the epidermis. Plant Physiology 144: 18631877.
  • Asselbergh B, De Vleesschauwer D, Hofte M. 2008. Global switches and fine-tuning – ABA modulates plant pathogen defense. Molecular Plant–Microbe Interactions 21: 709719.
  • Audenaert K, De Meyer GB, Hofte MM. 2002. Abscisic acid determines basal susceptibility of tomato to Botrytis cinerea and suppresses salicylic acid-dependent signaling mechanisms. Plant Physiology 128: 491501.
  • Bailey TA, Zhou XJ, Chen JP, Yang Y. 2009. Role of ethylene, abscisic acid and MAP kinase pathways in rice blast resistance. In: Wang G, Valent B, eds. Advances in Genetics, Genomics and Control of Rice Blast Disease. Springer: UK, 185190.
  • Bari R, Jones J. 2009. Role of plant hormones in plant defense responses. Plant Molecular Biology 69: 473488.
  • Bhattarai KK, Xie QG, Mantelin S, Bishnoi U, Girke T, Navarre DA, Kaloshian I. 2008. Tomato susceptibility to root-knot nematodes requires an intact jasmonic acid signaling pathway. Molecular Plant–Microbe Interactions 21: 12051214.
  • Bodenhausen N, Reymond P. 2007. Signaling pathways controlling induced resistance to insect herbivores in Arabidopsis. Molecular Plant–Microbe Interactions 20: 14061420.
  • Bostock RM. 2005. Signal crosstalk and induced resistance: Straddling the line between cost and benefit. Annual Review of Phytopathology 43: 545580.
  • Branch C, Hwang CF, Navarre DA, Williamson VM. 2004. Salicylic acid is part of the Mi-1-mediated defense response to root-knot nematode in tomato. Molecular Plant–Microbe Interactions 17: 351356.
  • Bridge J, Plowright RA, Peng D. 2005 Nematode parasites of rice. In: Luc M, Sikora RA, Bridge J, eds. Plant-parasitic nematodes in subtropical and tropical agriculture. Wallingford, UK: CAB International, 87130.
  • Campbell EJ, Schenk PM, Kazan K, Penninckx I, Anderson JP, Maclean DJ, Cammue BPA, Ebert PR, Manners JM. 2003. Pathogen-responsive expression of a putative ATP-binding cassette transporter gene conferring resistance to the diterpenoid sclareol is regulated by multiple defense signaling pathways in Arabidopsis. Plant Physiology 133: 12721284.
  • Chinnasri B, Sipes BS, Schmitt DP. 2006. Effects of inducers of systemic acquired resistance on reproduction of Meloidogyne javanica and Rotylenchulus reniformis in pineapple. Journal of Nematology 38: 319325.
  • Cooper WR, Jia L, Goggin L. 2005. Effects of jasmonate-induced defenses on root-knot nematode infection of resistant and susceptible tomato cultivars. Journal of Chemical Ecology 31: 19531967.
  • De Vleesschauwer D, Djavaheri M, Bakker P, Hofte M. 2008. Pseudomonas fluorescens WCS374r-induced systemic resistance in rice against Magnaporthe oryzae is based on pseudobactin-mediated priming for a salicylic acid-repressible multifaceted defense response. Plant Physiology 148: 19962012.
  • De Vleesschauwer D, Yang YN, Cruz CV, Hofte M. 2010. Abscisic acid-induced resistance against the brown spot pathogen Cochliobolus miyabeanus in rice involves MAP kinase-mediated repression of ethylene signaling. Plant Physiology 152: 20362052.
  • De Vos M, Van Oosten VR, Van Poecke RMP, Van Pelt JA, Pozo MJ, Mueller MJ, Buchala AJ, Metraux JP, Van Loon LC, Dicke M et al. 2005. Signal signature and transcriptome changes of Arabidopsis during pathogen and insect attack. Molecular Plant–Microbe Interactions 18: 923937.
  • Delaney TP, Uknes S, Vernooij B, Friedrich L, Weymann K, Negrotto D, Gaffney T, Gutrella M, Kessmann H, Ward E et al. 1994. A central role of salicylic-acid in plant-disease resistance. Science 266: 12471250.
  • Durrant WE, Dong X. 2004. Systemic acquired resistance. Annual Review of Phytopathology 42: 185209.
  • Fan J, Hill L, Crooks C, Doerner P, Lamb C. 2009. Abscisic acid has a key role in modulating diverse plant-pathogen interactions. Plant Physiology 150: 17501761.
  • Farmer EE, Caldelari D, Pearce G, Walkersimmons K, Ryan CA. 1994. Diethyldithiocarbamic acid inhibits the octadecanoid signaling pathway for the wound induction of proteinase-inhibitors in tomato leaves. Plant Physiology 106: 337342.
  • Felton GW, Korth KL. 2000. Trade-offs between pathogen and herbivore resistance. Current Opinion in Plant Biology 3: 309314.
  • Fujita Y, Fujita M, Satoh R, Maruyama K, Sayama H, Mohammad P, Seki M, Hiratsu K, Ohme-Takagi M, Shinozaki K et al. 2005. AREB1 is a transcription activator of novel ABRE-dependent ABA signaling that enhances drought stress tolerance in Arabidopsis. Plant Cell 17: 34703488.
  • Gaffney T, Friedrich L, Vernooij B, Negrotto D, Nye G, Uknes S, Ward E, Kessmann H, Ryals J. 1993. Requirement of salicylic-acid for the induction of systemic acquired-resistance. Science 261: 754756.
  • Glazebrook J. 2005. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annual Review of Phytopathology 43: 205227.
  • Glazer I, Apelbaum A, Orion D. 1985. Effect of inhibitors and stimulators of ethylene production on gall development in Meloidogyne javanica-infected tomato roots. Journal of Nematology 17: 145149.
  • Govrin EM, Levine A. 2002. Infection of Arabidopsis with a necrotrophic pathogen, Botrytis cinerea, elicits various defense responses but does not induce systemic acquired resistance (SAR). Plant Molecular Biology 48: 267276.
  • Grant MR, Jones JDG. 2009. Hormone (dis)harmony moulds plant health and disease. Science 324: 750752.
  • Hammond-Kosack KE, Parker JE. 2003. Deciphering plant–pathogen communication: fresh perspectives for molecular resistance breeding. Current Opinion in Biotechnology 14: 177193.
  • Henfling J, Bostock R, Kuc J. 1980. Effect of abscisic-acid on rishitin and lubimin accumulation and resistance to Phytophthora infestans and Cladosporium cucumerinum in potato-tuber tissue-slices. Phytopathology 70: 10741078.
  • Hiei Y, Ohta S, Komari T, Kumashiro T. 1994. Efficient transformation of rice (Oryza sativa) mediated by agrobacterium and sequence-analysis of the boundaries of the T-DNA. Plant Journal 6: 271282.
  • Hollis JP, Keoboonrueng S. 1984 Nematode parasites of rice. In: Nickle WR, ed. Plant and insect nematodes. New York, NY, USA: Marcel Dekker, 95146.
  • Hooper DJ, Hallmann J, Subbotin SA. 2005. Methods for extraction, processing and detection of plant and soil nematodes. In: Luc M, Sikora RA, Bridge J, eds. Plant-parasitic nematodes in subtropical and tropical agriculture. Wallingford, UK: CAB International, 5386.
  • Howe GA, Jander G. 2008. Plant immunity to insect herbivores. Annual Review of Plant Biology 59: 4166.
  • Jiang C-J, Shimono M, Sugano S, Kojima M, Yazawa K, Yoshida R, Inoue H, Hayashi N, Sakakibara H, Takatsuji H. 2010. Abscisic acid interacts antagonistically with salicylic acid signaling pathway in rice-Magnaporthe grisea interaction. Molecular Plant-Microbe Interactions 23: 791798.
  • Karakas M. 2004. Life cycle and mating behaviour of Hirschmanniella oryzae (Namatoda: Pratylenchidae) on excised Oryzae sativa roots. Fen Bilimleri Dergisi 25: 16.
  • Karimi M, Van Montagu M, Gheysen G. 1995. Exogenous application of abscisic acid to potato plants suppresses reproduction of Meloidogyne incognita. Mededelingen van de Faculteit Landbouwkundige en Toegepaste Biologische Wetenschappen, Universiteit Gent 60/3b: 10331035.
  • Kessler A, Baldwin IT. 2002. Plant responses to insect herbivory: the emerging molecular analysis. Annual Review of Plant Biology 53: 299328.
  • Koga H, Dohi K, Mori M. 2004. Abscisic acid and low temperatures suppress the whole plant-specific resistance reaction of rice plants to the infection of Magnaporthe grisea. Physiological and Molecular Plant Pathology 65: 39.
  • Koornneef A, Pieterse CMJ. 2008. Cross talk in defense signaling. Plant Physiology 146: 839844.
  • Kunkel BN, Brooks DM. 2002. Cross talk between signaling pathways in pathogen defense. Current Opinion in Plant Biology 5: 325331.
  • Kyndt T, Nahar K, Haegeman A, De Vleesschauwer D, Hofte M, Gheysen G. 2012a. Comparing systemic defense-related gene expression changes upon migratory and sedentary nematode attack in rice. Plant Biology 14: 7382.
  • Kyndt T, Denil S, Haegeman A, Trooskens G, Bauters L, Van Criekinge W, De Meyer T, Gheysen G. 2012b. Transcriptional reprogramming by root knot and migratory nematode infection in rice. New Phytologist, doi: 10.1111/j.1469-8137.2012.04311.x.
  • Lee MW, Qi M, Yang YO. 2001. A novel jasmonic acid-inducible rice MYB gene associates with fungal infection and host cell death. Molecular Plant–Microbe Interactions 14: 527535.
  • Leon-Reyes A, Van der Does D, De lange ES, Delker C, Wasternack C, Van Wees SCM, Ritsema T, Pieterse CMJ. 2010. Salicylate-mediated suppression of jasmonate-responsive gene expression in Arabidopsis is targeted downstream of the jasmonate biosynthesis pathway. Planta 232: 14231432.
  • van Loon LC, Rep M, Pieterse CMJ. 2006. Significance of inducible defense-related proteins in infected plants. Annual Review of Phytopathology 44: 135162.
  • Lopez MA, Bannenberg G, Castresana C. 2008. Controlling hormone signaling is a plant and pathogen challenge for growth and survival. Current Opinion in Plant Biology 11: 420427.
  • Lorenzo O, Chico JM, Sanchez-Serrano JJ, Solano R. 2004. Jasmonate-insensitive1 encodes a MYC transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis. Plant Cell 16: 19381950.
  • Lorenzo O, Piqueras R, Sánchez-Serrano JJ, Solano R. 2003. Ethylene Response Factor 1 integrates signals from ethylene and jasmonate pathways in plant defense. Plant Cell 15: 165178.
  • Mauch-Mani B, Mauch F. 2005. The role of abscisic acid in plant-pathogen interactions. Current Opinion in Plant Biology 8: 409414.
  • Mauch-Mani B, Slusarenko AJ. 1996. Production of salicylic acid precursors is a major function of phenylalanine ammonia-lyase in the resistance of Arabidopsis to Peronospora parasitica. The Plant Cell 8: 203212.
  • Mazarei M, Elling AA, Maier TR, Puthoff DP, Baum TJ. 2007. GmEREBP1 is a transcription factor activating defense genes in soybean and Arabidopsis. Molecular Plant–Microbe Interactions 20: 107119.
  • Mazarei M, Puthoff DP, Hart JK, Rodermel SR, Baum TJ. 2002. Identification and characterization of a soybean ethylene-responsive element-binding protein gene whose mRNA expression changes during soybean cyst nematode infection. Molecular Plant–Microbe Interactions 15: 577586.
  • McDonald KL, Cahill DM. 1999. Influence of abscisic acid and the abscisic acid biosynthesis inhibitor, norflurazon, on interactions between Phytophthora sojae and soybean (Glycine max). European Journal of Plant Pathology 105: 651658.
  • Mei CS, Qi M, Sheng GY, Yang YN. 2006. Inducible overexpression of a rice allene oxide synthase gene increases the endogenous jasmonic acid level, PR gene expression, and host resistance to fungal infection. Molecular Plant–Microbe Interactions 19: 11271137.
  • Mohr PG, Cahill DM. 2003. Abscisic acid influences the susceptibility of Arabidopsis thaliana to Pseudomonas syringae pv. tomato and Peronospora parasitica. Functional Plant Biology 30: 461469.
  • Mohr PG, Cahill DM. 2007. Suppression by ABA of salicylic acid and lignin accumulation and the expression of multiple genes, in Arabidopsis infected with Pseudomonas syringae pv. tomato. Functional & Integrative Genomics 7: 181191.
  • Nahar K, Kyndt T, De Vleesschauwer D, Hofte M, Gheysen G. 2011. The jasmonate pathway is a key player in systemically induced defense against root knot nematodes in rice. Plant Physiology 157: 305316.
  • Nakagami H, Sugiyama N, Mochida K, Daudi A, Yoshida Y, Toyoda T, Tomita M, Ishihama Y, Shirasu K. 2010. Large-scale comparative phosphoproteomics identifies conserved phosphorylation sites in plants. Plant Physiology 153: 11611174.
  • Nandi B, Kundu K, Banerjee N, Babu SPS. 2003. Salicylic acid-induced suppression of Meloidogyne incognita infestation of okra and cowpea. Nematology 5: 747752.
  • Owen KJ, Green CD, Deverall BJ. 2002. A benzothiadiazole applied to foliage reduces development and egg deposition by Meloidogyne spp. in glasshouse-grown grapevine roots. Australasian Plant Pathology 31: 4753.
  • Pieterse CMJ, Leon-Reyes A, Van der Ent S, Van Wees SCM. 2009. Networking by small-molecule hormones in plant immunity. Nature Chemical Biology 5: 308316.
  • Reversat G, Boyer J, Sannier C, Pando-Bahuon A. 1999. Use of a mixture of sand and water-absorbent synthetic polymer as substrate for the xenic culturing of plant-parasitic nematodes in the laboratory. Nematology 1: 209212.
  • Riemann M, Muller A, Korte A, Furuya M, Weiler EW, Nick P. 2003. Impaired induction of the jasmonate pathway in the rice mutant hebiba. Plant Physiology 133: 18201830.
  • Robert-Seilaniantz A, Grant M, Jones JDG. 2011. Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism. Annual Review of Phytopathology 49: 317343.
  • Robert-Seilaniantz A, Navarro L, Bari R, Jones JD. 2007. Pathological hormone imbalances. Current Opinion in Plant Biology 10: 372379.
  • Rohilla R, Singh US, Singh RL. 2002. Mode of action of acibenzolar-S-methyl against sheath blight of rice, caused by Rhizoctonia solani Kuhn. Pest Management Science 58: 6369.
  • Rojo E, Solano R, Sanchez-Serrano JJ. 2003. Interactions between signaling compounds involved in plant defense. Journal of Plant Growth Regulation 22: 8298.
  • Shimono M, Sugano S, Nakayama A, Jiang CJ, Ono K, Toki S, Takatsuji H. 2007. Rice WRKY45 plays a crucial role in benzothiadiazole-inducible blast resistance. Plant Cell 19: 20642076.
  • Soriano IR, Asenstorfer RE, Schmidt O, Riley IT. 2004a. Inducible flavone in oats (Avena sativa) is a novel defense against plant-parasitic nematodes. Phytopathology 94: 12071214.
  • Soriano IR, Riley IT, Potter MJ, Bowers WS. 2004b. Phytoecdysteroids: a novel defense against plant-parasitic nematodes. Journal of Chemical Ecology 30: 18851899.
  • Thaler JS, Bostock RM. 2004. Interactions between abscisic-acid-mediated responses and plant resistance to pathogens and insects. Ecology 85: 4858.
  • Thomma BPHJ, Eggermont K, Penninckx IAMA, Mauch-mani B, Vogelsangn R, Cammue BPA, Broekaert WF. 1998. Separate jasmonate-dependent and salicylate-dependentdefense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Plant Biology 95: 1510715111.
  • Ton J, Flors V, Mauch-Mani B. 2009. The multifaceted role of ABA in disease resistance. Trends in Plant Science 14: 310317.
  • Ton J, Mauch-Mani B. 2004. Beta-amino-butyric acid-induced resistance against necrotrophic pathogens is based on ABA-dependent priming for callose. Plant Journal 38: 119130.
  • de Torres-Zabala M, Bennett MH, Truman WH, Grant MR. 2009. Antagonism between salicylic and abscisic acid reflects early host-pathogen conflict and moulds plant defence responses. Plant Journal 59: 375386.
  • de Torres-Zabala M, Truman WH, Bennett MH, Lafforgue G, Mansfield JW, Egea PR, Bogre L, Grant MR. 2007. Pseudomonas syringae pv. tomato hijacks the Arabidopsis abscisic acid signalling pathway to cause disease. EMBO Journal 26: 14341443.
  • Tucker ML, Xue P, Yang R. 2010. 1-Aminocyclopropane-1-carboxylic acid (ACC) concentration and ACC synthase expression in soybean roots, root tips, and soybean cyst nematode (Heterodera glycines)-infected roots. Journal of Experimental Botany 61: 463472.
  • Volkmar KM. 1991. Abscisic acid and ethylene increase in Heterodera avanae-infected tolerant or intolerant oat cultivars. Journal of Nematology 23: 425431.
  • Ward EWB, Cahill DM, Bhattacharyya MK. 1989. Abscisic-acid suppression of phenylalanine ammonia-lyase activity and messengerrna, and resistance of soybeans to Phytophthora megasperma fsp. glycinea. Plant Physiology 91: 2327.
  • Wubben MJE, Jin J, Baum TJ. 2008. Cyst nematode parasitism of Arabidopsis thaliana is inhibited by salicylic acid (SA) and elicits uncoupled SA-independent pathogenesis-related gene expression in roots. Molecular Plant–Microbe Interactions 21: 424432.
  • Wubben MJE, Su H, Rodermel SR, Baum TJ. 2001. Susceptibility to the sugar beet cyst nematode is modulated by ethylene signal transduction in Arabidopsis thaliana. Molecular Plant–Microbe Interactions 14: 12061212.
  • Xiong LZ, Yang YN. 2003. Disease resistance and abiotic stress tolerance in rice are inversely modulated by an abscisic acid-inducible mitogen-activated protein kinase. Plant Cell 15: 745759.
  • Yamaguchi-Shinozaki K, Shinozaki K. 2006. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annual Review of Plant Biology 57: 781803.
  • Yang YN, Qi M, Mei CS. 2004. Endogenous salicylic acid protects rice plants from oxidative damage caused by aging as well as biotic and abiotic stress. Plant Journal 40: 909919.
  • Yasuda M, Ishikawa A, Jikumaru Y, Seki M, Umezawa T, Asami T, Maruyama-Nakashita A, Kudo T, Shinozaki K, Yoshida S et al. 2008. Antagonistic interaction between systemic acquired resistance and the abscisic acid-mediated abiotic stress response in Arabidopsis. Plant Cell 20: 16781692.
  • Zhang HM, Yang H, Rech EL, Golds TJ, Davis AS, Mulligan BJ, Cocking EC, Davey MR. 1988. Transgenic rice plants produced by electroporation-mediated plasmid uptake into protoplasts. Plant Cell Reports 7: 379384.