SEARCH

SEARCH BY CITATION

Keywords:

  • blood–brain barrier;
  • in vitro model;
  • P-glycoprotein;
  • puromycin;
  • rat brain microvessel endothelium

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

One of the main difficulties with primary rat brain endothelial cell (RBEC) cultures is obtaining pure cultures. The variation in purity limits the achievement of in vitro models of the rat blood–brain barrier. As P-glycoprotein expression is known to be much higher in RBECs than in any contaminating cells, we have tested the effect of five P-glycoprotein substrates (vincristine, vinblastine, colchicine, puromycin and doxorubicin) on RBEC cultures, assuming that RBECs would resist the treatment with these toxic compounds whereas contaminating cells would not. Treatment with either 4 µg/mL puromycin for the first 2 days of culture or 3 µg/mL puromycin for the first 3 days showed the best results without causing toxicity to the cells. Transendothelial electrical resistance was significantly increased in cell monolayers treated with puromycin compared with untreated cell monolayers. When cocultured with astrocytes in the presence of cAMP, the puromycin-treated RBEC monolayer showed a highly reduced permeability to sodium fluorescein (down to 0.75 × 10−6 cm/s) and a high electrical resistance (up to 500 Ω × cm2). In conclusion, this method of RBEC purification will allow the production of in vitro models of the rat blood–brain barrier for cellular and molecular biology studies as well as pharmacological investigations.

Abbreviations used
BBB

blood–brain barrier

CsA

cyclosporin A

DMEM

Dulbecco's modified Eagle's medium

LDH

lactate dehydrogenase

P-gp

P-glycoprotein

RBEC

rat brain endothelial cell

TEER

transendothelial electrical resistance

In the last decade, many efforts have been made to produce reliable in vitro models in order to study the blood–brain barrier (BBB). It is indeed important to better understand the complex cellular and molecular interactions at the interface between blood and brain. The BBB regulates the passage of physiological substances into and out of the CNS and protects it against potentially harmful substances present in the blood. It also prevents the passage of pharmacological substances into the CNS. In order to optimize drug delivery to the CNS, it is important to gain knowledge about the passage of drug candidates through the BBB, especially their effects on the CNS and their toxicity to this barrier (Begley 1996; Tsuji and Tamai 1997). The better we understand BBB regulation, the better we will be able to conceive treatments for CNS pathologies, including neurodegenerative diseases and brain tumours (Joó 1996; Prokai 1997).

Capillary endothelial cells are the main component of the BBB and therefore the primary limitation to the passage of substances from the blood to the CNS. They possess specific properties that distinguish them from peripheral endothelium (Joó 1996), i.e. they form a continuous monolayer of non-fenestrated endothelial cells, presenting numerous tight junctions (Wolburg et al. 1994) and displaying very poor pinocytic activity (for review see Joó 1993). Astrocytes ensheath most of the CNS capillaries with their processes and induce differentiation of the CNS endothelial cells (DeBault 1981; Abbott et al. 1992a). The exact nature of this induction is still obscure but the key role played by astrocytes in regulating BBB functionality has been extensively documented (Dehouck et al. 1990; Joó 1992; Abbott et al. 1992a; Tran et al. 1998; De Boer et al. 1999; Gaillard et al. 2000; Terasaki et al. 2003; Hori et al. 2004).

Several attempts at developing in vitro models of the BBB have been previously reported. Brain endothelial cell primary cultures from different species (Bowman et al. 1983; Audus and Borchardt 1986; Roux et al. 1989; Meyer et al. 1990; Abbott et al. 1992b; Szabóet al. 1997; Mégard et al. 2002; Cucullo et al. 2004) have been widely used but they rapidly dedifferentiate and lose some specific brain endothelial markers (reviewed by Garberg 1998).

The most extensively characterized BBB models consist of a coculture of bovine endothelial cells on the upper side of a porous membrane and rat astrocytes on the lower side or in the bottom of a multiwell plate (Cecchelli et al. 1999; Gaillard et al. 2001). These coculture models retain most of the specific features of the BBB in vitro. The advantage of bovine or porcine cell preparations mainly resides in the large number of brain endothelial cells available in one brain. However, as in vivo BBB experiments are generally performed on rodents, the best in vitro model should be developed using rodent cell cultures (Deli et al. 2005). A rat syngeneic BBB coculture model would thus permit easy correlation between in vitro and in vivo results.

The major difficulty encountered so far with rat brain endothelial cell (RBEC) culture is obtaining pure cultures. This variation in purity may be expected to affect the characteristics of the cultures and thus limit reproducibility between different experiments.

P-glycoprotein (P-gp), multidrug resistance-associated proteins and breast cancer resistance protein are efflux plasma membrane proteins which are over-expressed in tumour cells and which act as efflux pumps for various anticancer drugs, conferring multidrug resistance on these cells. They are also expressed in non-malignant tissues, at the level of physiological epithelial or endothelial barriers, such as lung, kidney, gut epithelium, testis, placenta and brain capillary endothelium (Cordon-Cardo et al. 1989; Thiebaut et al. 1989; Miller et al. 2000; Demeule et al. 2001; Cooray et al. 2002; Eisenblätter et al. 2003; Zhang et al. 2003). P-gp is encoded by a gene family comprising two mdr genes (MDR1 and MDR2) in humans and three mdr genes (mdr1a, mdr1b and mdr2) in rodents (Ng et al. 1989; Hsu et al. 1989), also known, respectively, as hABCB1 and hABCB2 in human and rAbcb1a, rAbcb1b and rAbcb2 in rodents. However, only the expression of human MDR1 and rodent mdr1a and mdr1b appears to selectively confer multidrug resistance. The mdr1a gene is exclusively expressed in the endothelium of rat brain capillaries (Schinkel 1999).

Brain capillary endothelial cells express highly active P-gp in situ (Jettéet al. 1993; Beaulieu et al. 1997) and, when cultured in vitro, can survive treatments with relatively high concentrations, otherwise toxic, of P-gp substrates. Chen et al. (1998) used this characteristic to select murine brain endothelial cells by treatment with 40 nm vincristine. They used this P-gp substrate to purify their culture because contaminating cells lacking P-gp could not survive the treatment. The same type of purification using 60 nm vincristine was also documented with porcine cells (Igarashi et al. 1999). We report in this study on the purification of RBECs with different P-gp substrates: vincristine, vinblastine, colchicine, puromycin and doxorubicin. The aim of this study was to assess whether this treatment would totally eliminate contaminating cells from RBEC cultures without affecting RBEC viability or BBB characteristics. The effect of the treatment on the expression of some specific BBB features, such as P-gp expression and restriction of monolayer permeability to ions and small hydrophilic molecules, has been investigated.

Chemicals

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

Bovine serum albumin, 8-(4-chlorophenylthio)-cAMP, DNAse I, fluorescein sodium salt, fluorescein isothiocyanate-dextran, HEPES, hydrocortisone, collagen type IV from human placenta, fibronectin from bovine plasma and octyl-glucoside were purchased from Sigma (L'Isle d'Abeau Chesnes, France). Dispase II was obtained from Roche Molecular Biochemicals (Mannheim, Germany). Collagenase type 2 was purchased from Worthington Biochemical Corporation (Lakewood, NJ, USA). Endothelial cell basal medium was obtained from Cambrex (Emerainville, France). Dulbecco's modified Eagle's medium (DMEM), foetal bovine serum, Hank's balanced salt solution, basic fibroblast growth factor (human, recombinant), penicillin-streptomycin solution and Trizol reagent were purchased from Invitrogen, Life Technologies (Cergy Pontoise, France). 4-(3-butoxy-4-methoxybenzyl)-2-imidazolidinone (RO-20-1724) was obtained from Calbiochem-Novabiochem Corporation (San Diego, CA, USA). Bovine plasma-derived serum was purchased from First Link (Brierley Hill, West Midlands, UK). ExpressHyb hybridization solution was purchased from Clontech (Palo Alto, CA, USA). Costar Transwell-clear culture inserts were obtained from VWR (Fontenay-sous-Bois, France). [3H]Vincristine sulphate (6.00 Ci/mmol), chemiluminescence detection kit (ECL) and Hybond-N+ sheets were purchased from Amersham (Les Ulis, France). Cyclosporin A (CsA) was a generous gift from Novartis (Basel, Switzerland). Anti-human von Willebrand factor antibody, monoclonal mouse anti-P-gp, clone C219, DAKO LSAB® 2 Kit and DAKO AEC substrate-chromogen system were purchased from Dako S.A. (Trappes, France).

Culture of rat brain capillary endothelial cells

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

This method has been adapted from previously described techniques (Roux et al. 1989; Szabóet al. 1997; Deli et al. 2000). Briefly, 2-week-old Wistar rat cortices were dissected free of meninges and minced. All animals were treated according to protocols evaluated and approved by the ethical committee of INSERM, France. The dissection was performed on ice and in phosphate-buffered saline (NaCl, 137 mm; KCl, 2.7 mm; Na2HPO4, 8 mm; KH2PO4, 1.5 mm). The cortices were cut into very small pieces (1 mm3), homogenized with a 5-mL pipette and digested in a mixture of collagenase/dispase (270 U collagenase/mL, 0.1% dispase) and DNAse (10 U/mL) in DMEM for 1.5 h at 37°C. The cell pellet was separated by centrifugation in 20% bovine serum albumin/DMEM (1000 g, 15 min) and incubated in the collagenase/dispase mixture for 1 h at 37°C. The capillary fragments were retained on a 10-µm nylon filter, removed from the filter with endothelial cell basal medium supplemented with 20% bovine plasma-derived serum and antibiotics (penicillin, 100 U/mL; streptomycin, 100 µg/mL) and seeded on 60-mm Petri dishes coated with collagen type IV (5 µg/cm2).

Either 4 µg/mL puromycin was added for 2 days or 3 µg/mL puromycin for 3 days. Puromycin was then removed from the culture medium and replaced by fibroblast growth factor (2 ng/mL) and hydrocortisone (500 ng/mL).

Quantification of culture purity

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

The purity of the cultures was evaluated by microscopic examination. RBECs were treated for 3 days after seeding with different concentrations of colchicine, vincristine, vinblastine, doxorubicin or puromycin. The concentrations used in the culture medium were 60 nm, 600 nm or 5.51 µm for each substance. The concentration of 5.51 µm corresponds to 3 µg/mL puromycin. On the fifth day of treatment, RBECs and contaminating cells were counted according to morphological criteria in four fields of three separate wells.

Immunocytochemistry

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

To confirm the accuracy of the counting of RBECs and contaminating cells, control and puromycin-treated cells were identified on the basis of expression of a specific endothelial cell marker (von Willebrand factor) or a specific BBB endothelial cell marker (P-gp). Five-day-old cultures treated or not with 4 µg/mL puromycin for the first 2 days were fixed with acetone/ethanol (1/1) at 4°C and incubated with either the rabbit polyclonal anti-human von Willebrand factor antibody (Dako S.A.; 1 : 50 dilution, 10 min) or the monoclonal mouse anti-P-gp, clone C219 (Dako S.A.; 1 : 20 dilution, 30 min). Cells were then stained according to the protocol of the LSAB®2 Kit, Peroxidase for use on rat specimens (Universal K609; Dako S.A.). Red end-product formed at the site of the target antigen using the AEC substrate–chromogen system (K3464; Dako S.A.). Nuclei were counterstained with Mayer's hematoxylin.

Culture of rat astrocytes

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

Primary cultures of astrocytes were prepared from the cerebral cortex of newborn rats according to the protocol of Booher and Sensenbrenner (1972). After removal of the meninges, the brain tissue was minced in DMEM/F12 and gently forced through an 80-µm nylon sieve. The cell suspension was then plated into 75-cm2 flasks at a concentration of 1.2 × 105 cells/mL in DMEM/F12 supplemented with 10% foetal calf serum, 2 mm glutamine and antibiotics (penicillin, 100 U/mL; streptomycin, 100 µg/mL). The medium was changed every 3 days with a 10% foetal calf serum medium. Three weeks after seeding, astrocytes were passaged by treatment with trypsin (0.25% w/v)-EDTA (0.04% w/v) and frozen in liquid nitrogen.

Coculture of endothelial cells and astrocytes and transendothelial permeability studies

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

Four days after seeding, RBECs were passaged by treatment with trypsin (0.25% w/v)-EDTA (0.04% w/v) (Invitrogen, Life Technologies). Cells were incubated at 37°C with trypsin-EDTA for about 5 min until they were gently dissociated by aspiration with a 5-mL pipette. The cell suspension was diluted in endothelial cell basal medium supplemented with 20% bovine plasma-derived serum, antibiotics (penicillin, 100 U/mL; streptomycin, 10 µg/mL), basic fibroblast growth factor (1 ng/mL) and hydrocortisone (500 ng/mL) and seeded on collagen IV-fibronectin (12–6 µg/cm2)-pre-coated Transwell-clear inserts (5 × 104 cells/insert). Three days before RBEC passaging, astrocytes were thawed and 8 × 104 cells/cm2 were seeded in the bottom of 12-multiwell plates for further cocultures with RBECs.

Five days after RBEC passaging, 8-(4-chlorophenylthio)-cAMP (250 µmol/L) and the cAMP phosphodiesterase-4-specific inhibitor RO 20 1724 (17.5 µmol/L) were added to both the upper and lower compartments (Rubin et al. 1991). On the following day, the transendothelial electrical resistance (TEER) (Ω × cm2) was measured in an ENDOHM tissue resistance measurement chamber (World Precision Instruments, Inc., Sarasota, FL, USA) and the permeability coefficient (Pe, cm/s) of sodium fluorescein (MW 376 Da) was measured according to Gaillard et al. (2001).

During each 1-h experiment, the average volume cleared was plotted versus time and the slope estimated by linear regression analysis. The slope of the clearance curve for the collagen IV-fibronectin-pre-coated control filter was denoted PSf and the slope of the clearance curve for the culture was denoted PSt. The PS value for the endothelial monolayer (PSe) was calculated from:

  • image

The PSe values were divided by the area of the porous membrane and the result was the permeability coefficient (Pe, cm/s).

Cytotoxicity assay

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

A Cytotoxicity Detection Kit (LDH) (1 644 793; Roche Diagnostics GmbH, Mannheim, Germany) was used to measure the toxicity of puromycin treatment. The release of the cytoplasmic enzyme lactate dehydrogenase (LDH) is a sign of cell damage and can be used as an indicator of cell death. Cytotoxicity is calculated as the percentage of total LDH release from cells treated with 1% Triton X-100 detergent. An increase in the number of dead or membrane-damaged cells results in an increase in LDH activity in the cell-free culture supernatant fluid. Assays were performed after the 2-day treatment with 4 µg/mL puromycin, followed by an additional 2 days in culture. Moreover, the TEER of monolayers treated or not with 4 µg/mL puromycin for the first 2 days was measured after another 2 days in culture.

RNA isolation and northern blot analysis

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

Total RNA was extracted from RBECs by the guanidine isothiocyanate/phenol/chloroform method of Chomczynski and Sacchi (1987) using Trizol reagent. Total RNA (20 µg) was subjected to electrophoresis in a denaturing 6% (v/v) formaldehyde/1% (w/v) agarose gel and transferred onto Hybond-N+ sheets. The sheets were pre-hybridized and then hybridized with [32P]-labelled probes using ExpressHyb solution. They were then washed, dried and autoradiographed at −80°C. Equal gel loading and efficiency of transfer were checked by methylene blue staining of the membranes and by rehybridizing the blots with a glyceraldehyde-3-phosphate dehydrogenase probe. mdr1a and mdr1b mRNA were detected using rat 0.44-kbp mdr1a and 0.35-kbp mdr1b cDNA fragments, respectively. These probes were generated by RT-PCR using rat mdr gene-specific primers: mdr1a forward primer, GGACAGAAACAGAGGATCGC (nucleotides 1597–1616); mdr1a reverse primer, CCCGTCTTGATCATGTGGCC (nucleotides 2037–18); mdr1b forward primer, GGACAGAAACAGAGGATCGC (nucleotides 1699–1718) and mdr1b reverse primer TCAGAGGCACCAGTGTCACT (nucleotides 2054–35). The amplified cDNAs correspond to highly divergent nucleotide sequences of the two rat mdr genes encoding the region linking the two putative domains of P-gp (Teeter et al. 1993).

Drug accumulation studies

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

Cellular uptake of tritiated substrate [3H]vincristine was measured as described previously (El Hafny et al. 1997). Confluent cells, grown in 24-multiwell plates, were washed three times with phosphate-buffered saline and pre-incubated for 30 min at 37°C in a CO2 incubator with culture medium with or without the P-gp inhibitor, CsA (10 µm). [3H]Vincristine (25 nm) was then added for 60 min. The plates were shaken at short intervals during both pre-incubation and incubation periods to reduce the effect of the aqueous boundary layer on drug accumulation. The reaction was stopped by rapidly removing the medium and washing cell monolayers three times with ice-cold phosphate-buffered saline to eliminate the extracellular drug. Cells were then lysed in 0.5 mL of 0.1 m NaOH. The amount of tritiated drug retained in the cells was counted in Pico Fluor by β-scintillation counting (Perkin Elmer, Boston, MA, USA). An aliquot of cell lysate was used in parallel to determine the cellular protein concentration (Lowry et al. 1951). The intracellular vincristine level was expressed in pmol/mg of protein.

Statistical analysis

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

The statistical analysis was carried out using the computer software systat (version 5.0) (systat Inc., Evanston, IL, USA).

Statistical evaluation of the cytotoxicity of puromycin treatment by LDH release was performed by an unpaired Student's t-test. Results are mean ± SEM.

A two-way anova on log-transformed data was performed to evaluate the effect of puromycin treatment on the relative increase in [3H]vincristine accumulation induced by CsA in RBECs. If the interaction term was significant (p < 0.05), multiple comparisons of the data corresponding to different concentrations with the control data were performed using the Bonferroni adjustment. The global risk was fixed at p < 0.05.

The influence of treatment with astrocyte factors and cAMP on TEER and sodium fluorescein permeability was studied by a three-way anova including the culture random factor. Regarding TEER, as the three factors interaction term was significant (p < 0.05), a two-way anova of log-transformed data was performed for each preparation. anova was followed by multiple pairwise comparisons with the Bonferroni adjustment. The global risk was fixed at p < 0.05.

Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

The RBECs were treated for 3 days after seeding with 60 nm, 600 nm or 5.51 µm concentrations of colchicine, vincristine, vinblastine, doxorubicin and puromycin.

Figure 1 shows 6-day-old cultures. In the control culture, contaminating cells (mainly pericytes) proliferated more rapidly than endothelial cells and occupied the entire surface available (Fig. 1a). After 6 days of culture, only 47.6% of the cells were endothelial (Fig. 2). Endothelial cells treated with 5.51 µm vincristine or vinblastine for the first 3 days of culture did not survive. Cells treated with 5.51 µm colchicine (Fig. 1b), 600 nm vincristine (Fig. 1c) or vinblastine (Fig. 1d) showed clear signs of suffering. Very few cells had adhered to the culture dishes, many cells were giant and polynucleated and there was almost no cell proliferation compared with the control culture. Cell counting revealed that 70.8% of surviving cells were endothelial cells after 5.51 µm colchicine treatment and only 66.8 and 61.2% of surviving cells were endothelial cells after 600 nm vincristine and 600 nm vinblastine treatment, respectively (Fig. 2). Treatments with 600 nm colchicine and 60 nm vincristine or vinblastine were less toxic but contaminating cells were still more abundant (Fig. 2). In any of the tested conditions, colchicine, vincristine or vinblastine were thus unable to eliminate all non-endothelial cells from the culture without toxic effect on the endothelial cells.

image

Figure 1. Photomicrographs of 6-day-old cultures of rat brain endothelial cells (RBECs) treated for 3 days after seeding with P-glycoprotein substrates. Scale bar, 50 µm. (a) Untreated primary culture showing the presence of contaminating cells, mainly pericytes. E, endothelial cells; P, pericytes. (b–d) Primary cultures of RBECs treated with 5.51 µm colchicine, 600 nm vincristine and 600 nm vinblastine, respectively. Many cells show signs of suffering. Some endothelial cells are giant and polynucleated. Contaminating cells (pericytes) are also present. (e) Primary culture of brain capillary endothelial cells treated with 5.51 µm doxorubicin. Most contaminating cells were eliminated. The growth of endothelial cells was slower. (f) Primary culture of RBECs treated with 5.51 µm (3 µg/mL) puromycin. Most contaminating cells were eliminated and the growth and phenotype of endothelial cells were not modified by puromycin treatment.

Download figure to PowerPoint

image

Figure 2. Endothelial and contaminating cells were counted in four fields of three separate wells of 6-day-old primary cultures. Cells were treated for the first 3 days after seeding with 5.51 µm, 600 nm or 60 nm P-glycoprotein (P-gp) substrates. The concentration of 5.51 µm corresponds to 3 µg/mL puromycin. Results are mean ± SD of the percentage of rat brain endothelial cells (RBECs) vs. total cells counted in three wells.

Download figure to PowerPoint

Treatments with 5.51 µm doxorubicin were successful in eliminating most contaminating cells with 93.1% of endothelial cells remaining in the culture (Figs 1e and 2). After treatment with 5.51 µm (3 µg/mL) puromycin, most contaminating cells were eradicated when puromycin was added at the seeding time (Fig. 1f). Counting showed that 99% of the surviving cells were endothelial. Lower concentrations of puromycin were less efficient (Fig. 2).

To confirm the accuracy of this counting carried out on morphological features, control and puromycin-treated cells were identified on the basis of expression of a specific endothelial cell marker (von Willebrand factor) or a specific BBB endothelial cell marker (P-gp) (Fig. 3). Both staining processes led to the same result, i.e. only cells showing an endothelial morphological feature expressed both von Willebrand factor and P-gp antigen. The von Willebrand factor staining was rather granular and perinuclear, whereas the P-gp staining was more diffuse (Fig. 3). Quantification of stained versus non-stained cells gave similar results as those presented in Fig. 2; 98.8% of the cells were von Willebrand factor positive in puromycin-treated cultures versus 56.8% in untreated cultures.

image

Figure 3. Photomicrographs of 5-day-old cultures of rat brain endothelial cells treated for 3 days after seeding with 5.51 µm (3 µg/mL) puromycin. Scale bar, 100 µm. (a) In untreated primary culture endothelial cells (E) show a granular and perinuclear staining corresponding to the presence of von Willebrand factor, whereas contaminating cells (P) are negative. (b) Every cell of a puromycin-treated culture expresses the von Willebrand factor. (c) In untreated culture endothelial cells (E) show a diffuse staining corresponding to P-glycoprotein (P-gp) expression, whereas contaminating cells (P) do not express P-gp. (d) Most cells of a puromycin-treated culture express P-gp.

Download figure to PowerPoint

After 2 or 3 days of treatment, puromycin used at 4 or 3 µg/mL, respectively, was removed from the culture medium. Endothelial cells had the typical spindle-shaped appearance of RBECs and, at confluence, they formed a monolayer of tightly packed, longitudinally aligned and non-overlapping contact-inhibited cells, as previously observed in RBECs purified by mechanical removal of the contaminating cells (Roux et al. 1989; Regina et al. 1998, 2001). This isolation procedure of the endothelial cells was easily reproducible.

Absence of cytotoxic effects of puromycin treatment

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

Lactate dehydrogenase release was assessed to measure the toxicity of puromycin treatment. Cytotoxicity is calculated as the percentage of total LDH release from cells treated with 1% Triton X-100 detergent. After 2 days of 4 µg/mL puromycin treatment, the percentage of total LDH release (42.7 ± 4.3%, n = 12) was significantly higher than that of untreated cells (31.7 ± 2.5%, n = 11) (p < 0.05). An additional 2 days after the end of treatment, the percentage of total LDH release dropped to 8.1 ± 2.6% (n = 9) and was not significantly different from that of untreated cells (10.9 ± 3.8%, n = 9). The apparent high level of cell toxicity observed with untreated cells was due to numerous dead cells present in the brain capillary fraction that attached to the collagen Petri dish before they were progressively lost from the proliferating RBEC islands for the following days.

The permeability property of the monolayer formed by confluent RBECs on Transwell inserts was assessed 4 days after seeding (Fig. 4). The TEER was significantly increased (p < 0.05) in cell monolayers treated for the first 2 days with 4 µg/mL puromycin (122.5 ± 1.1 Ω × cm2) compared with untreated cell monolayers (82.2 ± 3.9 Ω × cm2). A 24-h treatment with cAMP further significantly increased the TEER of the puromycin-treated cells (196.3 ± 21.6 Ω × cm2) without affecting that of untreated cells.

image

Figure 4. Transendothelial electrical resistance (TEER) of rat brain endothelial cell monolayers cultured in the presence or absence of puromycin for the first 2 days with or without the addition of cAMP. Results are the means ± SD of three independent experiments (3–16 replicates in each experiment). Statistical analysis of the data was performed by multiple pairwise comparisons as indicated in Materials and methods and revealed significant differences (p < 0.05): puromycin-treated cultures/untreated cultures; puromycin-treated cultures exposed to cAMP/untreated cultures exposed or not to cAMP.

Download figure to PowerPoint

Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

We intended to assess whether prolonged puromycin treatment would limit the drop in mdr1a expression repeatedly observed with RBECs in vitro (Regina et al. 1998). The expression of the mdr1a and mdr1b P-gp-encoding mRNAs in RBECs was determined by northern blot analysis of total mRNAs.

Further treatments of RBECs after no passages (P0) or RBECs after one passage (P1) with puromycin could only be performed with concentrations of 1 µg/mL or less because of the toxicity at higher concentrations. Although a long-term treatment with a P-gp substrate was expected to up-regulate mdr1a gene expression, we observed here (Fig. 5) that a 13-day treatment of RBECs with 1 µg/mL puromycin had no significant effect on mdr1a mRNA expression.

image

Figure 5. Northern blot analysis of the effect of puromycin treatment on mdr1a and mdr1b mRNA levels in primary rat brain endothelial cells (RBECs) 16 days after seeding (P0) or after one passage (P1). RNA samples were prepared from primary cultures of RBECs treated for the first 3 days with 3 µg/mL puromycin. P0 RBECs were then cultured without treatment for 13 days (lane 1) or with treatment with 1 µg/mL puromycin for 13 days (lane 2). Five-day-old P1 RBECs (control; lane 3) were treated for the last 4 days before RNA extraction with 0.5 and 1 µg/mL puromycin (lanes 4 and 5, respectively). Results were normalized using a glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specific probe.

Download figure to PowerPoint

When RBECs after one passage were treated for 4 days with 0.5 or 1 µg/mL puromycin, the level of the P-gp-encoding mdr1a mRNA was not modified. However, the mdr1b mRNA level was clearly increased (Fig. 5). As control, the different treatments had no effect on the expression of glyceraldehyde-3-phosphate dehydrogenase mRNA.

Drug accumulation studies

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

In order to verify whether the mdr1b mRNA increase induced by puromycin resulted in an increase in P-gp activity, we measured the effect of puromycin treatment on the uptake of [3H]vincristine, a P-gp substrate, in the presence or absence of the P-gp inhibitor CsA (10 µm) in RBECs after three passages (Table 1). As expected in control RBECs, vincristine accumulation was increased by incubation with CsA. This relative increase in intracellular vincristine concentration was significantly enhanced after a 4-day treatment with 0.5 µg/mL puromycin (39.3 vs. 23.6%; p < 0.05). The effect was greater after 5 weeks of chronic treatment with 0.5 µg/mL puromycin (51.4 vs. 23.6%; p < 0.05) (Table 1).

Table 1. Effect of puromycin treatment on vincristine accumulation in primary rat brain capillary endothelial cell cultures after three passages
 Intracellular vincristine (nmol/g protein)
–CsA+CsAIncrease (%)
  • Cultures of rat brain capillary endothelial cells were passaged three times and either acutely treated with 0.5 µg puromycin for 2 or 4 days or chronically treated with 0.5 µg/mL puromycin for 5 weeks. Cells were incubated for 30 min at 37°C in culture medium alone (–CsA) or culture medium containing 10 µm cyclosporin A (+CsA). 25 nm3H-vincristine was then added and accumulation was measured after 1 h incubation as described in Materials and methods. Results are mean ± SD with, in brackets, the number of wells.

  • a

    p < 0.05 for the relative vincristine accumulation increase induced by CsA (puromycin-treated cells vs. control cells).

Control3.50 ± 0.32 (15)4.34 ± 0.28 (14)23.6
Puromycin3.36 ± 0.13 (6)4.35 ± 0.11 (5)29.4
 0.5 µg/mL
 2 days
Puromycin2.56 ± 0.14 (9)3.56 ± 0.36 (8)39.3a
 0.5 µg/mL
 4 days
Puromycin1.88 ± 0.18 (17)2.85 ± 0.22 (14)51.4a
 0.5 µg/mL
 5 weeks

Such a relative increase in CsA-dependent [3H]vincristine accumulation after puromycin treatment of primary cultured brain endothelial cells is consistent with an increase in P-gp activity induced by puromycin treatment, in parallel with the observed increase in mdr1b mRNA expression.

Permeability studies

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

Paracellular permeability to ions of puromycin-treated RBEC monolayers was analysed by measuring the TEER of RBEC monolayers whereas sodium fluorescein (MW 376 Da) was used as a standard for low molecular weight molecules.

Results are presented as a percentage of the control mean (monoculture without cAMP) in three independent experiments and are the means ± SD of three filters. Absolute values of TEER and sodium fluorescein permeability were found to vary greatly between different primary cultures (Figs 6a and b); TEER of cocultures treated with cAMP varied from 169 to 508 Ω × cm2, whereas the corresponding sodium fluorescein permeability varied from 1.87 to 0.75 × 10−6 cm/s.

image

Figure 6. (a) Transendothelial electrical resistance (TEER) and (b) permeability coefficients for sodium fluorescein of rat brain endothelial cell monolayers cultured in the presence or absence of astrocytes with or without the addition of cAMP. Results from three independent experiments performed with different primary cultures are presented. For each experiment, they are expressed as the percentage of the control mean (monoculture without cAMP) and are the means ± SD of three replicates. In all cases, statistical analysis of the data was performed by multiple pairwise comparisons as indicated in Materials and methods and revealed significant differences (p < 0.05): cocultures/monocultures; cAMP-treated monocultures/untreated monocultures; cAMP-treated cocultures/untreated cocultures.

Download figure to PowerPoint

Coculture of RBECs with astrocytes or treatment of RBEC monocultures with cAMP induced a significant increase in TEER (Fig. 6a) in parallel with a decrease in sodium fluorescein permeability (Fig. 6b). When cocultures were treated with cAMP, TEER was further significantly increased (Fig. 6a), whereas the permeability coefficient of sodium fluorescein was markedly decreased (Fig. 6b).

Altogether, these results provide further evidence that puromycine-based purification of RBECs largely favours the formation of tight endothelial monolayers.

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

The greatest challenge when cultivating RBECs is to achieve reproducibility between different cultures. One of the major difficulties encountered is the presence of contaminating cells such as pericytes, smooth muscle cells, astrocytes and fibroblasts (Greenwood 1992). These cells have higher proliferation capacities than RBECs which they rapidly overgrow. After 6 days of culture, only 47.6% of cells in control cultures were endothelial cells. P-gp confers multidrug resistance by the active efflux of a wide range of lipophilic drugs and P-gp substrates are often cytotoxic substances. As P-gp is strongly expressed in the luminal membranes of the endothelium of blood capillaries in the brain (Cordon-Cardo et al. 1989; Jettéet al. 1993; Beaulieu et al. 1997; Demeule et al. 2001), we have tested the effect of five P-gp substrates (vincristine, vinblastine, colchicine, puromycin and doxorubicin) on RBEC cultures. The rationale for this study was that RBECs, which are known to express a high level of P-gp, would be able to resist puromycin treatment while contaminating cells, lacking P-gp, would not.

In our primary cultures, vincristine, vinblastine or colchicine, at any tested concentration, could not eliminate all contaminating cells without causing endothelial cell toxicity. These observations are at variance with previous reports indicating that 40 nm vincristine in murine brain endothelial cell cultures (Chen et al. 1998) and 60 nm vincristine in porcine brain endothelial cell cultures (Igarashi et al. 1999) were effective for eliminating undesirable cells. Our interpretation of this discrepancy is that tolerance to vincristine treatment thus seems to be very different between porcine, mouse and rat brain endothelial cells, rat cells appearing much more sensitive to vincristine.

By contrast, doxorubicin treatment of RBECs led to a significant increase of brain endothelial cell purity (up to 93% purity). However, proliferation of the cultures was slow in comparison to puromycin-treated cells and controls. As doxorubicin is inserted between the DNA chains and blocks transcription, it might indeed have delayed and prolonged deleterious effects by comparison to puromycin.

Systematic treatment of RBEC cultures with 4 µg/mL puromycin for 2 days or 3 µg/mL puromycin for 3 days, immediately after brain capillary isolation, led to eradication of almost all contaminating cells (99% purity). Moreover, endothelial cells were similar in morphology and growth rate to control cells purified by mechanical removal of contaminating cells (Roux et al. 1989). As RBECs express a high level of P-gp, which prevents intracellular accumulation of puromycin, they attach to the culture support and proliferate normally.

Puromycin is an aminoacylnucleoside antibiotic produced by Streptomyces alboniger. It is an analogue of aminoacyl-tRNA, which can bind 70S and 80S ribosomes. It takes part in the ribosomal peptide bond-forming reaction and accepts the nascent peptide chain. As puromycin binds only weakly to ribosomes, the resultant peptidyl-puromycin molecule usually separates from the ribosome almost at once, thus stopping protein synthesis (Cundliffe 1981). Puromycin could also be cytotoxic to the cells lacking P-gp if puromycin is metabolized in the cells into puromycin aminonucleoside. As the passage from puromycin to puromycin aminonucleoside requires the cleavage of the equivalent of a peptide bond CO-NH, a cellular enzyme may recognize this site. Puromycin aminonucleoside is known to produce reactive oxygen species and can then be toxic to cells lacking P-gp (Thakur et al. 1988; Shah 1989; Ricardo et al. 1994; Zent et al. 1995; Gwinner et al. 1997).

We measured LDH release in order to be sure that the puromycin treatment induced no toxicity for the endothelial cells. After 2 days of treatment, the percentage of cytotoxicity was higher in puromycin-treated cells compared with control. This cytotoxicity, possibly related to the death of many contaminating cells present at the beginning of the culture, disappeared immediately after the end of the treatment, showing a short-term effect on endothelial cells. Accordingly, the elimination of contaminating cells resulted in higher TEER.

We further characterized the culture model by analysing the permeability of the endothelial cell monolayer to ions and small molecules, such as sodium fluorescein. Cocultures of RBECs and astrocytes treated for 24 h with cAMP resulted in a significant augmentation of the TEER (up to 508 Ω × cm2), showing that the RBEC monolayer is able to limit the passage of ions. The sodium fluorescein permeability coefficients (down to 0.75 ± 0.03 × 10−6 cm/s) were lower than the sucrose permeability coefficients obtained with bovine brain endothelial cells cocultured with rat astrocytes (Cecchelli et al. 1999; Gaillard et al. 2001) and with human brain endothelial cells cocultured with human astrocytes (Mégard et al. 2002). This fluorescein Pe value was also in good agreement with the Pe of other paracellular permeability markers obtained on in vitro BBB models (Deli et al. 2005). As the purity of the culture is essential for obtaining electrical resistance and restricted permeability to small molecules, these results justify our purification strategy using puromycin treatment.

Endothelial cells from freshly isolated capillaries treated with a cytotoxic concentration of puromycin (3 or 4 µg/mL) for the first days of culture resisted enough to be able to migrate out of the capillaries, attach to the support and proliferate normally. However, passaged RBECs treated with cytotoxic concentrations of puromycin showed a higher sensitivity to the treatment. Cultured brain endothelial cells indeed dedifferentiate very rapidly and lose their specific characteristics, such as P-gp expression in rodents (Barrand et al. 1995; Fenart et al. 1998; Regina et al. 1998; Gaillard et al. 2000).

Puromycin treatment did not seem to contribute to higher expression of the P-gp encoding mdr1a mRNA in RBEC, as a further treatment of 13 days after the initial 3-day treatment did not have any effect on the mdr1a mRNA level detected by northern blot analysis.

Puromycin treatment of passaged RBECs induced mdr1b expression without a change in mdr1a expression. Cultures were essentially pure and changes in mdr expression could thus not be attributed to changes in the proportion of mdr1b-positive contaminating cells versus endothelial cells induced by this puromycin treatment. mdr1b expression has been shown to be up-regulated by a variety of endogenous and environmental stimuli that evoke stress responses, including UV irradiation, heat shock, inflammatory cytokines, growth factors, protein synthesis inhibitors and cytotoxic drugs (Sukhai and Piquette-Miller 2000). The activation by puromycin of the stress-activated protein kinase/c-jun NH2-terminal protein kinase pathway, as previously shown (Iordanov et al. 1997; Sidhu and Omiecinski 1998; Sah et al. 2003), might be involved in mdr1b overexpression in RBECs as activation of c-jun NH2-terminal protein kinase was shown to correlate with increased MDR expression (Osborn and Chambers 1996).

Increased mdr1b mRNA expression could be associated with increased P-gp functionality. As the two P-gp isoforms do not have the same substrate specificity (Tang-Wai et al. 1995), a switch from the mdr1a to mdr1b expression, as observed after prolonged or repeated treatment with puromycin, would affect the efflux of metabolites or drugs. Thus, in order to avoid any enhancement of the mdr1b expression, the improvement in brain endothelial cell culture that we suggest is a 3-day treatment with 3 µg/mL puromycin or a 2-day treatment with 4 µg/mL puromycin after seeding.

In vitro screenings of drug transport through the BBB have mainly used cultured bovine or porcine brain microvascular endothelial cells (Cecchelli et al. 1999; Franke et al. 1999; Gaillard et al. 2000; Deli et al. 2005). However, most in vivo studies on drug transport through the BBB have used small laboratory animals, especially rats. To correlate results between in vitro and in vivo experiments, it is important to establish a cell culture system for laboratory animals that are commonly used in in vivo studies. We have shown in the present study that treatment of RBEC cultures with puromycin leads to a cell culture system characterized by high and reproducible purity and yield.

In conclusion, we report here a study on the purification of RBECs with the following different P-gp substrates, vincristine, vinblastine, colchicine, doxorubicin and puromycin. Treatment with 3 µg/mL puromycin for the first 3 days or 4 µg/mL puromycin for the first 2 days after capillary seeding totally eliminated contaminating cells from RBEC culture without toxic effects. Treatment with puromycin should not be prolonged or repeated in order to avoid cytotoxic effects and overexpression of the mdr1b stress-responsive gene. Syngeneic cocultures of RBECs and rat astrocytes were able to restrict the passage of ions and small molecules, showing that, after puromycin treatment, RBECs retain some of the important characteristics of brain endothelial cells.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References

We thank Dr Annette Bartmann, Dr Léa Payen, Dr Olivier Fardel, Dr Françoise Cailler and Christian Federici for technical demonstrations and helpful discussions. This work was supported by grants from the Institut National de la Santé et de la Recherche Médicale, the EU (contract Bio4-CT 98-0337) and the Hungarian Research Fund (OTKA T37834). Dr Maria Deli is a recipient of the János Bolyai Research Fellowship from the Hungarian Academy of Sciences. The work was also supported by a grant from ANRT (Association Nationale pour la Recherche et la Technologie) to Nicolas Perrière.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Chemicals
  5. Culture of rat brain capillary endothelial cells
  6. Quantification of culture purity
  7. Immunocytochemistry
  8. Culture of rat astrocytes
  9. Coculture of endothelial cells and astrocytes and transendothelial permeability studies
  10. Cytotoxicity assay
  11. RNA isolation and northern blot analysis
  12. Drug accumulation studies
  13. Statistical analysis
  14. Results
  15. Effect of P-glycoprotein substrates on the purity of rat brain endothelial cells
  16. Absence of cytotoxic effects of puromycin treatment
  17. Effects of puromycin treatment on mdr1a and mdr1b gene expression in rat brain endothelial cells
  18. Drug accumulation studies
  19. Permeability studies
  20. Discussion
  21. Acknowledgements
  22. References
  • Abbott N. J. , Revest P. A. and Romero I. A. ( 1992a ) Astrocyte–endothelial interaction: physiology and pathology . Neuropathol. Appl. Neurobiol. 18 , 424433 .
  • Abbott N. J. , Hughes C. C. , Revest P. A. and Greenwood J. ( 1992b ) Development and characterisation of a rat brain capillary endothelial culture: towards an in vitro blood–brain barrier . J. Cell Sci. 103 , 2337 .
  • Audus K. L. and Borchardt R. T. ( 1986 ) Characterization of an in vitro blood–brain barrier model system for studying drug transport and metabolism . Pharm. Res. 3 , 8187 . DOI: 10.1023/A:1016337202335
  • Barrand M. A. , Robertson K. J. and von Weikersthal S. F. ( 1995 ) Comparisons of P-glycoprotein expression in isolated rat brain microvessels and in primary cultures of endothelial cells derived from microvasculature of rat brain, epididymal fat pad and from aorta . FEBS Lett. 374 , 179183 .
  • Beaulieu E. , Demeule M. , Ghitescu L. and Beliveau R. ( 1997 ) P-glycoprotein is strongly expressed in the luminal membranes of the endothelium of blood vessels in the brain . Biochem. J. 326 , 539544 .
  • Begley D. J. ( 1996 ) The blood–brain barrier: principles for targeting peptides and drugs to the central nervous system . J. Pharm. Pharmacol. 48 , 136146 .
  • Booher J. and Sensenbrenner M. ( 1972 ) Growth and cultivation of dissociated neurons and glial cells from embryonic chick, rat and human brain in flask cultures . Neurobiology 2 , 97105 .
  • Bowman P. D. , Ennis S. R. , Rarey K. E. , Betz A. L. and Goldstein G. W. ( 1983 ) Brain microvessel endothelial cells in tissue culture: a model for study of the blood–brain barrier permeability . Ann. Neurol. 14 , 396402 .
  • Cecchelli R. , Dehouck B. , Descamps L. , Fenart L. , Buée-Scherrer V. , Duhem C. , Lundquist S. , Rentfel M. , Torpier G. and Dehouck M. P. ( 1999 ) In vitro model for evaluating drug transport across the blood–brain barrier . Adv. Drug Deliv. Rev. 36 , 165178 .
  • Chen Z. , Zandonatti M. , Jakubowski D. and Fox H. S. ( 1998 ) Brain capillary endothelial cells express MBEC1, a protein that is related to the Clostridium perfringens enterotoxin receptors . Lab. Invest. 78 , 353363 .
  • Chomczynski P. and Sacchi N. ( 1987 ) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction . Anal. Biochem. 162 , 156159 .
  • Cooray H. C. , Blackmore C. G. , Maskell L. and Barrand M. A. ( 2002 ) Localisation of breast cancer resistance protein in microvessel endothelium of human brain . Neuroreport 13 , 20592063 .
  • Cordon-Cardo C. , O'Brien J. P. , Casals D. , Rittman-Grauer L. , Biedler J. L. , Malamed M. R. and Bertino J. R. ( 1989 ) Multidrug-resistance gene (P-glycoprotein) is expressed by endothelial cells at blood–brain barrier sites. Proc. Natl Acad. Sci. USA 86 , 695698 .
  • Cucullo L. , Hallene K. , Dini G. , Dal Toso R. and Janigro D. ( 2004 ) Glycerophosphoinositol and dexamethasone improve transendothelial electrical resistance in an in vitro study of the blood–brain barrier . Brain Res. 997 , 147151 .
  • Cundliffe E. ( 1981 ) Antibiotic inhibitors of ribosome function , in The Molecular Bases of Antibiotic Action ( Gale E. F. , Cundliffe E. , Reynolds P. E. , Richmond M. H. and Waring M. J. , eds) , pp. 402547 . John Wiley and Sons , London .
  • DeBault L. E. ( 1981 ) Gamma-glutamyl transpeptidase induction mediated by glial foot process-to endothelium contact in co-culture . Brain Res. 220 , 432435 . DOI: 10.1016/0006-8993(81)91238-5
  • De Boer A. G. , Gaillard P. J. and Breimer D. D. ( 1999 ) The transference of results between blood–brain barrier cell culture systems . Eur. J. Pharm. Sci. 8 , 14 . DOI: 10.1016/S0928-0987(99)00003-2
  • Dehouck M. P. , Méresse S. , Delorme P. , Fruchart J. C. and Cecchelli R. ( 1990 ) An easier, reproducible, and mass-production method to study the blood–brain barrier in vitro . J. Neurochem. 54 , 17981801 .
  • Deli M. A. , Sakaguchi S. , Nakaoke R. , Abraham C. S. , Takahata H. , Kopacek J. , Shigematsu K. , Katamine S. and Niwa M. ( 2000 ) PrP fragment 106–126 is toxic to cerebral endothelial cells expressing PrP(C) . Neuroreport 11 , 39313936 .
  • Deli M. A. , Ábrahám C. S. , Kataoka Y. and Niwa M. ( 2005 ) Permeability studies on in vitro blood–brain barrier models: physiology, pathology, and pharmacology . Cell Mol. Neurobiol. 25 , 59127 .
  • Demeule M. , Labelle M. , Regina A. , Berthelet F. and Béliveau R. ( 2001 ) Isolation of endothelial cells from brain, lung, and kidney: expression of the multidrug resistance P-glycoprotein isoforms . Biochem. Biophys. Res. Commun. 281 , 827834 . DOI: 10.1006/bbrc.2001.4312
  • Eisenblätter T. , Hüwel S. and Galla H.-J. ( 2003 ) Characterisation of the brain multidrug resistance protein (BMDP/ABCG2/BCRP) expressed at the blood–brain barrier . Brain Res. 971 , 221231 . DOI: 10.1016/S0006-8993(03)02401-6
  • El Hafny B. , Cano N. , Piciotti M. , Regina A. , Scherrmann J.-M. and Roux F. ( 1997 ) Role of P-glycoprotein in colchicine and vinblastine cellular kinetics in an immortalized rat brain microvessel endothelial cell line . Biochem. Pharmacol. 53 , 17351742 . DOI: 10.1016/S0006-2952(97)00093-2
  • Fenart L. , Buée-Scherrer V. , Descamps L. , Duhem C. , Poullain M. G. , Cechelli R. and Dehouck M. P. ( 1998 ) Inhibition of P-glycoprotein: rapid assessment of its implication in blood–brain barrier integrity and drug transport to the brain by an in vitro model of the blood–brain barrier . Pharm. Res. 15 , 9931000 . DOI: 10.1023/A:1011913723928
  • Franke H. , Galla H. J. and Beuckmann C. T. ( 1999 ) An improved low-permeability in vitro-model of the blood–brain barrier: transport studies on retinoids, sucrose, haloperidol, caffeine and mannitol . Brain Res. 818 , 6571 . DOI: 10.1016/S0006-8993(98)01282-7
  • Gaillard P. J. , van der Sandt I. C. J. , Voorwinden L. H. , Vu D. , Nielsen J. L. , de Boer A. G. and Breimer D. D. ( 2000 ) Astrocytes increase the functional expression of P-glycoprotein in an in vitro model of the blood–brain barrier . Pharm. Res. 17 , 11981205 . DOI: 10.1023/A:1026406528530
  • Gaillard P. J. , Voorwinden L. H. , Nielsen J. L. , Ivanov A. , Atsumi R. , Engman H. , Ringbom C. , de Boer A. G. and Breimer D. D. ( 2001 ) Establishment and functional characterization of an in vitro model of the blood–brain barrier, comprising a co-culture of brain capillary endothelial cells and astrocytes . Eur. J. Pharm. Sci. 12 , 215222 . DOI: 10.1016/S0928-0987(00)00123-8
  • Garberg P. ( 1998 ) In vitro models of the blood–brain barrier . ATLA 26 , 821847 .
  • Greenwood J. ( 1992 ) Characterisation of a rat retinal endothelial cell culture and the expression of P-glycoprotein in brain and retinal endothelium in vitro . J. Neuroimmun. 39 , 123132 . DOI: 10.1016/0165-5728(92)90181-J
  • Gwinner W. , Landmesser U. , Brandes R. P. , Kubat B. , Plasger J. , Eberhard O. , Koch K. M. and Olbricht C. J. ( 1997 ) Reactive oxygen species and antioxydant defense in puromycin aminonucleoside glomerulopathy . J. Am. Soc. Nephrol. 8 , 17221731 .
  • Hori S. , Ohtsuki S. , Tachikawa M. , Kimura N. , Kondo T. , Watanabe M. , Nakashima E. and Terasaki T. ( 2004 ) Functional expression of rat ABCG2 on the luminal side of brain capillaries and its enhancement by astrocyte-derived soluble factor(s) . J. Neurochem. 90 , 526536 . DOI: 10.1111/j.1471-4159.2004.02537.x
  • Hsu S. I.-H. , Lothstein L. and Horwitz S. B. ( 1989 ) Differential overexpression of three mdr gene family members in multidrug-resistant J774.2 mouse cells . J. Biol. Chem. 264 , 12 05312 062 .
  • Igarashi Y. , Utsumi H. , Chiba H. et al. ( 1999 ) Glial cell line-derived neurotrophic factor induces barrier function of endothelial cells forming the blood–brain barrier . Biochem. Biophys. Res. Commun. 261 , 108112 . DOI: 10.1006/bbrc.1999.0992
  • Iordanov M. S. , Pribnow D. , Magun J. L. , Dinh T. H. , Pearson J. A. , Chen S. L. and Magun B. E. ( 1997 ) Ribotoxic stress response: activation of the stress-activated protein kinase JNK1 by inhibitors of the peptidyl transferase reaction and by sequence-specific RNA damage to the alpha-sarcin/ricin loop in the 28S rRNA . Mol. Cell Biol. 17 , 33733381 .
  • Jetté L. , Têtu B. and Beliveau R. ( 1993 ) High levels of P-glycoprotein in isolated brain capillaries . Biochim. Biophys. Acta 1150 , 147154 .
  • Joó F. ( 1992 ) The cerebral microvessels in culture, an update . J. Neurochem. 58 , 117 .
  • Joó F. ( 1993 ) The blood–brain barrier in vitro: the second decade . Neurochem. Int. 23 , 499521 . DOI: 10.1016/0197-0186(93)90098-P
  • Joó F. ( 1996 ) Endothelial cells of the brain and other organ systems: some similarities and differences . Prog. Neurobiol. 48 , 255273 . DOI: 10.1016/0301-0082(95)00046-1
  • Lowry O. H. , Rosebrough N. J. , Farr A. L. and Randall R. J. ( 1951 ) Protein measurement with the Folin phenol reagent . J. Biol. Chem. 193 , 265275 .
  • Mégard I. , Garrigues A. , Orlowki S. , Jorajuria S. , Clavette P. , Ezan E. and Mabondzo A. ( 2002 ) A co-culture-based model of human blood–brain barrier: application to active transport of indinavir and in vivo-in vitro correlation . Brain Res. 927 , 153167 . DOI: 10.1016/S0006-8993(01)03337-6
  • Meyer J. , Mischeck U. , Veyhl M. , Henzel K. and Galla H. J. ( 1990 ) Blood–brain barrier characteristic enzymatic properties in cultured brain capillary endothelial cells . Brain Res. 514 , 305309 . DOI: 10.1016/0006-8993(90)91425-G
  • Miller D. S. , Nobmann S. N. , Gutmann H. , Toeroek M. , Drewe J. and Fricker G. ( 2000 ) Xenobiotic transport across isolated brain microvessels studied by confocal microscopy . Mol. Pharmacol. 58 , 13571367 .
  • Ng W. F. , Sarangi F. , Zastawny R. K. , Veinot-Drebot L. and Ling V. ( 1989 ) Identification of members of the P-glycoprotein multigene family . Mol. Cell Biol. 9 , 12241232 .
  • Osborn M. T. and Chambers T. C. ( 1996 ) Role of the stress-activated/c-Jun NH2-terminal protein kinase pathway in the cellular response to adriamycin and other chemotherapeutic drugs . J. Biol. Chem. 271 , 30 95030 955 .
  • Prokai L. ( 1997 ) Peptide delivery into the central nervous system: invasive, physiological and chemical approaches . Exp. Opin. Ther. Patents 7 , 233245 .
  • Regina A. , Koman A. , Piciotti M. , El Hafny B. , Center M. S. , Bergmann R. , Couraud P. O. and Roux F. ( 1998 ) Mrp1 multidrug resistance-associated protein and P-glycoprotein expression in rat brain microvessel endothelial cells . J. Neurochem. 71 , 705715 .
  • Regina A. , Morchoisne S. , Borson N. D. , McCall A. L. , Drewes L. R. and Roux F. ( 2001 ) Factor(s) released by glucose-deprived astrocytes enhance glucose transporter expression and activity in rat brain endothelial cells . Biochim. Biophys. Acta 1540 , 233242 . DOI: 10.1016/S0167-4889(01)00133-1
  • Ricardo S. D. , Bertram J. F. and Ryan G. B. ( 1994 ) Reactive oxygen species in puromycin aminonucleoside nephrosis: in vitro studies . Kidney Int. 45 , 10571069 .
  • Roux F. S. , Mokni R. , Hughes C. C. , Clouet P. M. , Lefauconnier J.-M. and Bourre J. M. ( 1989 ) Lipid synthesis by rat brain microvessel endothelial cells in tissue culture . J. Neuropathol. Exp. Neurol. 48 , 437447 .
  • Rubin L. L. , Hall D. E. , Porter S. et al. ( 1991 ) A cell culture model of the blood–brain barrier . J. Cell Biol. 115 , 17251735 . DOI: 10.1083/jcb.115.6.1725
  • Sah N. K. , Munshi A. , Kurland J. F. , McDonnell T. J. , Su B. and Meyn R. E. ( 2003 ) Translation inhibitors sensitize prostate cancer cells to apoptosis induced by tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) by activating c-Jun N-terminal kinase . J. Biol. Chem. 278 , 20 59320 602 .
  • Schinkel A. H. ( 1999 ) P-glycoprotein, a gatekeeper in the blood–brain barrier . Adv. Drug Deliv. Rev. 36 , 179194 . DOI: 10.1016/S0169-409X(98)00085-4
  • Shah S. V. ( 1989 ) Role of reactive oxygen metabolites in experimental glomerular disease . Kidney Int. 35 , 10931106 .
  • Sidhu J. S. and Omiecinski C. J. ( 1998 ) Protein synthesis inhibitors exhibit a nonspecific effect on phenobarbital-inducible cytochome P450 gene expression in primary rat hepatocytes . J. Biol. Chem. 273 , 47694775 . DOI: 10.1074/jbc.273.8.4769
  • Sukhai M. and Piquette-Miller M. ( 2000 ) Regulation of the multidrug resistance genes by stress signals . J. Pharm. Pharmaceut. Sci. 3 , 262280 .
  • Szabó C. A. , Deli M. A. , Ngo T. K. and Joó F. ( 1997 ) Production of pure primary rat cerebral endothelial cell culture: a comparison of different methods . Neurobiology (Budapest ) 5 , 116 .
  • Tang-Wai D. F. , Kajiji S. , DiCapua F. , de Graaf D. , Roninson I. B. and Gros P. ( 1995 ) Human (MDR1) and mouse (mdr1, mdr3) P-glycoproteins can be distinguished by their respective drug resistance profiles and sensitivity to modulators . Biochemistry 34 , 3239 .
  • Teeter L. D. , Estes M. , Chan J. Y. , Atassi H. , Sell S. , Becker F. F. and Kuo M. T. ( 1993 ) Activation of distinct multidrug resistance (P-glycoprotein) genes during rat liver regeneration and hepatocarcinogenesis . Mol. Carcinogen 8 , 6773 .
  • Terasaki T. , Ohtsuki S. , Hori S. , Takanaga H. , Nakashima E. and Hosoya K. ( 2003 ) New approaches to in vitro models of blood–brain barrier drug transport . Drug Discov. Today 8 , 944954 . DOI: 10.1016/S1359-6446(03)02858-7
  • Thakur V. , Walker P. D. and Shah S. V. ( 1988 ) Evidence suggesting a role for hydroxyl radical in puromycin aminonucleoside-induced proteinuria . Kidney Int. 34 , 494499 .
  • Thiebaut F. , Tsuruo T. , Hamada H. , Gottesman M. M. , Pastan I. and Willingham M. ( 1989 ) Immunohistochemical localization in normal tissues of different epitopes in the multidrug transport protein P170: evidence for localization in brain capillaries and crossreactivity of one antibody with a muscle protein . J. Histochem. Cytochem. 37 , 159164 .
  • Tran N. D. , Schreiber S. S. and Fisher M. ( 1998 ) Astrocyte regulation of endothelial tissue plasminogen activator in a blood–brain barrier model . J. Cereb. Blood Flow Metab. 18 , 13161324 . DOI: 10.1097/00004647-199812000-00006
  • Tsuji A. and Tamai I. ( 1997 ) Blood–brain barrier function of P-glycoprotein . Adv. Drug Deliv. Rev. 25 , 287298 . DOI: 10.1016/S0169-409X(97)00504-8
  • Wolburg H. , Neuhaus J. , Kniesel U. , Kraub B. , Schmid E. M. , Öcalan M. , Farrell C. and Risau W. ( 1994 ) Modulation of tight junction structure in blood–brain barrier endothelial cells . J. Cell Sci. 107 , 13471357 .
  • Zent R. , Ailenberg M. , Wadell T. K. , Downey G. P. and Silverman M. ( 1995 ) Puromycin aminonucleoside inhibits mesangial cell-induced contraction of collagen gels by stimulating production of reactive oxygen species . Kidney Int. 47 , 811817 .
  • Zhang W. , Mojsilovic-Petrovic J. , Andrade M. F. , Zhang H. , Ball M. and Stanimirovic D. B. ( 2003 ) The expression and functional characterization of ABCG2 in brain endothelial cells and vessels . FASEB J. 17 , 20852087 .