SEARCH

SEARCH BY CITATION

Keywords:

  • acetylcholinesterase;
  • alternative splicing;
  • mouse brain;
  • organophosphates;
  • real-time polymerase chain reaction;
  • stress

Abstract

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Acetylcholinesterase (AChE) exists in various molecular forms, depending on alternative splicing of its transcripts and association with structural proteins. Tetramers of the ‘tailed’ variant (AChET), which are anchored in the cell membrane of neurons by the PRiMA (Proline Rich Membrane Anchor) protein, constitute the main form of AChE in the mammalian brain. In the mouse brain, stress and anticholinesterase inhibitors have been reported to induce expression of the unspliced ‘readthrough’ variant (AChER) mRNA which produces a monomeric form. To generalize this observation, we attempted to quantify AChER and AChET after organophosphate intoxication in the mouse brain and compared the observed effects with those of stress induced by swimming or immobilization; we also analyzed the effects of heat shock and AChE inhibition on neuroblastoma cells. Active AChE molecular forms were characterized by sedimentation and non-denaturing electrophoresis, and AChE transcripts were quantified by real-time PCR. We observed a moderate increase of the AChER transcript in some cases, both in the mouse brain and in neuroblastoma cultures, but we did not detect any increase of the corresponding active enzyme.

Abbreviations used
AChE

acetylcholinesterase

AChEH

‘hydrophobic’ variant of acetylcholinesterase

AChER

‘readthrough’ variant of acetylcholinesterase

AChET

‘tailed’ variant of acetylcholinesterase

ARP

acetylcholinesterase readthrough peptide, or r peptide

ChAT

choline acetyltransferase

GAPDH

glyceraldehyde 3-phosphate dehydrogenase

HSP70

heat shock protein 70

OP

organophosphate

PRiMA

membrane anchor of acetylcholinesterase (Proline Rich Membrane Anchor)

RT

reverse transcription

In mammals, the acetylcholine hydrolyzing enzyme, acetylcholinesterase (AChE) presents various molecular forms. A single gene leads to a large variety of transcripts depending on promoter usage (Meshorer et al. 2004), combined with alternative splicing in the 3′ region (Li et al. 1993; Massoulié 2002). Alternative acceptor sites of splicing in the 3′ region leads to three different variants (R, H, T), which possess the same catalytic domain but distinct C-terminal domains (Fig. 1). The AChER (‘readthrough’) variant results from the absence of splicing after the last catalytic exon and produces a non-amphiphilic monomeric (inline image) enzyme, which normally represents a minor AChE species. The AChEH (‘hydrophobic’) variant produces glycophosphatidylinositol-anchored dimers, mostly found in blood cells. The AChET (‘tailed’) variant terminates with a 40-residues peptide (t), which is highly conserved among vertebrates; AChET subunits produce amphiphilic monomers (T1), homomeric dimers (T2) and tetramers (T4), as well as hetero-oligomers with collagen ColQ and with the transmembrane PRiMA (Proline Rich Membrane Anchor) protein.

image

Figure 1. Acetylcholinesterase (AChE) 3′-splice variants. Schematic structure of the 3′ end of the AChE gene. The exons 2, 3 and 4 encoding the catalytic domain are represented by grey boxes. An alternative choice of splice acceptor sites can generate three splice variants: the ‘readthrough’ variant (AChER) is the result of the lack of splicing at the 3′ end after the last catalytic exon 4, the ‘hydrophobic’ variant (AChEH) is produced by splicing from exon 4 to the H region (also called exon 5) or, in the adult muscles and brain, splicing generally occurs between exon 4 and the ‘tailed’ (or ‘synaptic’) variant (AChET) encoding region (also called exon 6) (Li et al. 1991). Specific C-terminal peptidic sequences (r, h and t peptides) for the different protein variants are shown in bold and aligned for human and mouse. For the h peptide, glypiation site is indicated (*) and cleaved region is in italics. The t peptide, which is important for the quaternary association of AChE subunits, particularly for their assembly with anchoring proteins into physiologically active forms, presents a remarkable conservation between mouse and human, among mammals and even throughout vertebrates in general. Positions of the AChER and AChE primers used for real-time PCR are represented on the genomic sequence.

Download figure to PowerPoint

These diverse molecular forms have specific localizations and probably specific functions. In the muscle, the size of the T4-PRiMA pool depends on the activity of the muscle and may exert a specific adaptive function, distinct from that of collagen-tailed forms (Jasmin and Gisiger 1990; Jasmin et al. 1991). In the brain, during early development or in the neurodegenerative Alzheimer's disease, the ratio between monomers and tetramers is higher than in normal adult brain (Atack et al. 1983; Muller et al. 1985) where T4-PRiMA is the main form in the different brain structures, cholinergic or not (Perrier et al. 2003). The t peptide also induces a partial intracellular degradation of unassembled subunits (Belbeoc'h et al. 2003; Falasca et al. 2005).

Acute stress and anticholinesterases have been reported to induce a long-term overexpression of the readthrough variant of AChE in the central nervous system (Kaufer et al. 1998; Meshorer et al. 2002). Neuronal AChER accumulation would be accompanied by long-lasting modifications such as hyperexcitation of glutamatergic activity (Cohen et al. 2002). Whether these modifications are due to cholinergic or non-cholinergic action of accumulated ‘readthrough’ is still unclear.

As heat shock is known to affect splicing (Shen et al. 1993; Takechi et al. 1994), we analyzed its effects on AChE transcripts in murine neuroblastoma cells. We also analyzed the effects of irreversible inhibition by an organophosphate on AChE expression and recovery in neuroblastoma cells and in vivo, in different structures of the mouse brain. We also analyzed the effects of immobilization and swimming stresses. AChE transcripts were quantified by real-time PCR, and AChE molecular forms were characterized by non-denaturing electrophoresis and by sedimentation in sucrose gradients.

Experimental procedures

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Soman intoxication

FVB/N and BalbC male mice of 5–6 weeks old were kept under 12 h dark/12 h light diurnal schedule with food and water ad libitum. They were injected intraperitoneally with a single dose of the organophosphate (OP) soman (pinacolylmethylphosphonofluoridate) corresponding to 0.5 LD50 (310 µg/kg); they did not present severe intoxication symptoms such as severe tremors and seizures and no mortality occurred. Control animals were injected with the same volume of saline solution. Animals were killed by decapitation 24, 48 h, 7 and 14 days after soman injection. The brain was removed and the striatum, the somatosensory cortex, and the cerebellum were dissected immediately and frozen in liquid nitrogen. The recovery of AChE activity was similar for BalbC and FVB/N mice; quantifications of mRNA expression were done for FVB/N mice. These experiments were conducted in the Centre d'Etudes du Bouchet (Vert-le-petit, France) and approved by the local animal committee.

Swimming and immobilization stress

FVB/N male mice, kept as indicated above, were subjected to one acute 30-min immobilization in a 50-mL conical tube or to four consecutive days of swimming stress (4 min swim, 4 min rest, 4 min swim in a water bath of 60 × 25 cm at room temperature) (Kaufer et al. 1998). Stress was always performed at the same time in the morning (9.00 am). Naive age-matched males were used as controls. Animals were killed by cervical dislocation. The brain was removed and the structures of interest were dissected immediately after death, frozen into liquid nitrogen and stored at −80°C. Animal care and experiments were approved by the animal committee of Ile-de-France for the Centre National de la Recherche Scientifique.

Cell cultures, heat shock and acetylcholinesterase inhibition

Neuroblastoma cells N18TG2 were grown in Dulbecco's modified essential medium (Sigma Aldrich, St Quentin Fallavier, France) supplemented with 10% fetal bovine serum (Sigma), 1 × penicillin-streptomycin Solution (Sigma), 0.5 g/L of l-glutamine (Sigma) and 0.11 g/L of sodium pyruvate (Sigma).

NG108CC15 cells, which are hybrids of N18TG2 and glioma cells, have been shown to present more cholinergic characteristics, such as choline acetyltransferase (ChAT) activity and membrane electrical activity, than their neuroblastoma parental cells (Daniels and Hamprecht 1974; Melone et al. 1987; Biagioni et al. 1995). They were grown in the same medium as N18TG2 in the presence of 0.13 mm hypoxanthine (Sigma), 0.011 mm aminopterine (Sigma) and 0.02 mm thymidine (Sigma). All cells were grown as monolayer cultures in a 10% CO2 atmosphere.

Semi-confluent undifferentiated cells were placed in fresh medium 24 h before heat shock. They were heat shocked 2 h at 44°C; at the end of the treatment, the media and the cells were collected and stored at −80°C.

For soman treatment, N18TG2 cells were grown in a medium containing fetal calf serum (Gibco Invitrogen, Cergy Pontoise, France) that had been previously treated with soman to block its endogenous AChE activity. Soman (10−10 m or 5.10−10 m) was added to the medium of semiconfluent cells. After 2 or 24 h, the medium was collected and the cells were washed with phosphate-buffered saline, scraped and pelleted for analysis of mRNA and AChE activity.

Processing of cells and tissue samples

Brain samples and cell pellets were homogenized in a detergent-containing buffer [25 mm Tris-HCl pH 7, 20 mm MgCl2, 1% Triton X-100 (Merck, Nogent sur Marne, France), pepstatin (1 : 1000) (Sigma), leupeptin (1 : 1000) (Sigma), and benzamidine (1 : 1000) (Sigma)] then centrifuged 30 min at 10 000 g, at 4°C. The solubilized AChE activities were determined using the Ellman colorimetric method (Ellman et al. 1961), as previously described (Bon et al. 1991). The reaction rate was determined from optical density readings at 414 nm in a Multiskan RC microplate reader (Labsystems, Cergy Pontoise, France) and activities were expressed in variation of optical density units (mOD/min). AChE activities were normalized to the total protein concentration, measured with the BCA protein assay (Pierce, Perbio Science, Brebières, France).

Total RNA was extracted from brain tissues or cell samples using the Nucleospin RNA II kit (Macherey-Nagel, Hoerdt, France). Extracted mRNA (0.1–1 µg) was reverse transcribed using Omniscript reverse transcriptase (Qiagen, Courtaboeuf, France) and poly dT or random primers (Promega, Charbonniéres, France); in negative controls, reverse transcriptase was omitted.

Analysis of acetylcholinesterase molecular forms

For sedimentation analyses, samples of detergent extracts (200 µL) from somatosensory cortex containing similar amounts of extracted proteins (AChE activity of 200 mOD/min for control) were loaded on 5–20% sucrose gradients containing 50 mm Tris-HCl pH 7, 10 mm MgCl2, and 0.2% Triton X-100. The gradients were centrifuged at 36 000 rpm at 6°C for 17 h in a SW41 rotor (Beckman Instruments, Fullerton, CA, USA). The sedimentation coefficients were deduced by a linear relationship from the positions of internal marker proteins, alkaline phosphatase (6.1 S) (Sigma), and β-galactosidase (16 S) from Escherichia coli (Sigma).

Electrophoresis of active AChE was performed in non-denaturing conditions, in 7.5% horizontal polyacrylamide gels, as described by Bon et al. (1988). Migration was performed in the presence of 0.25% Triton X-100 or 0.25% Triton X-100 + 0.05% Na+ deoxycholate (DOC) (Sigma); AChE activity was revealed after electrophoresis by the method of Karnovsky and Roots (1964).

Real-time polymerase chain reaction

Real-time PCR was performed on the reverse transcription (RT) products with the Quantitect SYBR Green kit (Qiagen) in a Lightcycler apparatus (Roche Diagnostics, Meylan, France), following the manufacturer's instructions. The primers used for mouse AChE, AChER, PRiMA, heat shock protein 70 (HSP70), c-fos and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) are shown in Table 1. Ten-fold successive dilutions of purified PCR products were used as calibration standards and relative quantifications were obtained using linearity between log concentration and cycle threshold. Prior to all experiments, we verified that PCR efficiency was the same with dilutions of purified PCR products and with dilutions of RT products in our conditions (Table 1). The mRNA expression levels were normalized to the GAPDH mRNA level and the controls taken at 100%.

Table 1.  Conditions and primers used for real-time PCR quantification of mRNAs
GenePrimer (5′−3′)aAmplification cyclesProduct size (bp)Tm (°C)
  • a

    F, forward primer; R, reverse primer.

GAPDH Glyceraldehyde 3-phosphate dehydrogenase (NM_001001303)F: ATGAATACGGCTACAGCA94°C for 15 s, 58°C for 30 s,18785
R: GCCCCTCCTGTTATTATGG72°C for 10 s  
AChE Acetylcholinesterase (NM_009599)F: GAAGGCCGAGTTCCAC94°C for 15 s, 58°C for 30 s, 18786
R: GGCTCGGTCGTATTATATCC72°C for 10 s  
AChER Acetylcholinesterase (NM_009599)F: GGTAGGCGCATGGAGTGGGGG94°C for 15 s, 64°C for 30 s, 16686
R: GCCGCCTCCCCATGGGCGGGG72°C for 10 s  
Hsp 70 Heat shock protein 70.1 (M35021)F: ACTGTACCAGGGGATTATG94°C for 15 s, 58°C for 30 s, 32379
R: AGGGTGGCAGTGTAGA72°C for 10 s  
c-Fos Proto oncogene c-fos (NM_010234)F: ACTTCTTGTTTCCGGC94°C for 15 s, 58°C for 30 s, 23386
R: AGCTTCAGGGTAGGTG72°C for 10 s  
PRiMA Proline Rich Membrane Anchor (NM_133364)F: CATAAAGAGGAAACCACTG94°C for 15 s, 58°C for 30 s, 19385
R: GGTCAGCTCATGTCCAC72°C for 10 s  

To determine the proportion of the AChER splice variant in total AChE mRNA, a plasmid containing the mouse genomic AChE sequence was used as a common standard, as it was equally amplified with the two sets of primers (AChER and AChE, in Table 1 and Fig. 1). Because the sequence encoding the specific C-terminal region of AChET is conserved in all three transcripts (R, H and T), the products amplified with the corresponding primers indicated total AChE mRNA levels (Fig. 1). We found that in the mouse brain, the levels of H or R transcripts (as shown for R in Fig. 8) were much lower than that of T, which is therefore practically equal to total AChE mRNA, in agreement with previous studies (Li et al. 1991).

Results

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Effect of heat shock on neuroblastoma and neuroblastoma-glioma hybrid cell lines

The levels of mRNAs encoding AChE, AChER, PRiMA and HSP70 were determined in N18TG2 and NG108CC15 cells, in control cultures and after heat shock at 44°C for 2 h. Although the basal levels of the mRNA encoding the heat shock protein HSP70 differed in the two cell lines, it was highly induced (> 100-fold) by heat shock in both cases (Fig. 2). The level of AChER transcripts was significantly increased (sixfold) as well as that of total AChE (twofold) in mouse neuroblastoma N18TG2 cells; in contrast, the level of PRiMA mRNA was not affected by heat shock. The basal level of AChE mRNA was higher in the neuroblastoma-glioma NG108CC15 cells than in N18TG2, in agreement with their relative AChE activities (Melone et al. 1987; Biagioni et al. 1995) (Fig. 3b). In these hybrid cells, we did not observe any modification of AChE mRNA expression after heat shock.

image

Figure 2. mRNA expression after heat shock in mouse neuroblastoma cells and neuroblastoma-glioma hybrids. The cells were maintained 2 h at 44°C then collected for analysis. The mRNA expression levels were normalized to those of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA and considered 100% for N18TG2 control cells. Values are means ± SD (n = 4) and are represented on a logarithmic scale in white for controls and dark grey for heat-shocked cells (NG108CC15 dark striped), significant difference (p < 0.05) is indicated by *. Heat shock protein 70 (HSP70) mRNA level was markedly increased (∼1000-fold) during heat shock treatment for both cell lines. In N18TG2 cells, the levels of total acetylcholinesterase (AChE) mRNA and of its R splice variant increased (two and sixfold, respectively) but not that of membrane anchor of acetylcholinesterase (PRiMA) mRNA. In NG108CC15 hybrid cells, the levels of total and R mRNAs were higher in controls and were not increased by heat shock.

Download figure to PowerPoint

image

Figure 3. (a) Migrations were performed in the presence of Triton X-100 + Na+ deoxycholate (Triton DOC) or in the presence of Triton X-100 alone. Migration of amphiphilic monomers of acetylcholinesterase (AChE) (inline image) from N18TG2 cellular extracts is slowed down in the absence of DOC. Extracts from transfected COS cells expressing mouse AChER were used to indicate the expected migration of the non-amphiphilic (inline image), AChER form. Amphiphilic and non-amphiphilic monomers of AChE (inline image) and (inline image) co-migrate in Triton + DOC and can only be separated in Triton X-100 condition. (b) Migration of AChE molecular forms from cellular extracts and media of neuroblastoma N18TG2 and neuroblastoma-glioma NG108CC15 hybrids. Migrations were performed in the presence of Triton X-100 detergent. Hybrid cells produce much more AChE activity than their parental cell line, in these cells we found (inline image) (inline image) and tetramers (T4) of AChE. (c) AChE of control and heat-shocked (hs) N18TG2 cells was analyzed by non-denaturing electrophoresis in the presence of Triton X-100, for both cellular extracts and medium. We observed no modification of AChE molecular forms in cells directly after heat shock or after 1 h recovery at 37°C, in cellular extracts or in the media (not shown).

Download figure to PowerPoint

In both cell lines, AChE activity was not significantly different between control and heated cells, or in the media, after the heat shock treatment. We analyzed AChE molecular forms of neuroblastoma and hybrid cells by non-denaturing electrophoresis (Fig. 3): in Triton X-100 conditions AChET amphiphilic monomers (inline image) could be clearly distinguished from non-amphiphilic AChER monomers (inline image), which were produced and secreted by transfected COS cells expressing the corresponding construct (Fig. 3a). In NG108CC15 hybrids we observed non-amphiphilic monomers, probably inline image (Fig. 3b).

We observed no significant modification of the molecular forms of AChE in the cells or in the medium, at the end of the heat shock, either for N18TG2 (Fig. 3c) or for NG108CC15 hybrids (not shown). The distribution of AChE molecular forms remained unchanged compared to controls in heat-shocked N18TG2 cells after 1 h recovery at 37°C. In spite of an increased level of ‘readthrough’ AChER transcripts, we observed no detectable non-amphiphilic monomers derived from these transcripts (inline image), either in cell extracts or secreted in the culture medium, under experimental conditions which allowed the characterization of such molecules, expressed in COS cells. We always used antiproteases in our extraction buffer and we performed our analysis immediately after extraction. In fact, transfected COS cells expressing a murine AChER construct produced large amounts of active monomers (inline image), which were not lost in our extraction protocol even when mixed with cell or brain extracts (not shown).

The level of acetylcholinesterase mRNA is unaffected by acetylcholinesterase inhibition in neuroblastoma cells

Because N18TG2 cells, contrary to NG108CC15 hybrids, responded to heat shock by a significant increase in AChE expression, we analyzed the effect of AChE inhibition on these cells by adding the irreversible inhibitor soman to the culture medium. We observed no modification of either total AChE mRNA, or of the R variant, after acute inhibition of AChE (Fig. 4). With a low concentration of inhibitor, decreasing the cellular AChE activity to 60% after 1 h, the original level was rapidly recovered, indicating that the metabolic half life of the enzyme mainly present as (inline image) is short, as previously observed (Lazar et al. 1984). As inhibition induced no overexpression of AChE mRNA (Fig. 4a), we assume that the inhibited enzyme was replaced by de novo synthesis at a normal rate. With a higher concentration of inhibitor, inhibition was maintained for almost 24 h, but we still observed no modification in the level of AChE mRNA, at 2 or 24 h after treatment (Fig. 4b).

image

Figure 4. Irreversible inhibition of acetylcholinesterase (AChE) in neuroblastoma cells had no effect on AChE mRNA level. Two different concentrations of irreversible inhibitor soman were added to the medium of N18TG2 (final concentration of 10−10 m in (a) or 5.10−10 m in (b). mRNA levels were quantified by RT–PCR as indicated in Methods; the indicated values represented on a logarithmic scale are means ± SD of three independent asssays. Cellular AChE activity was measured by the Ellman colorimetric method and plotted on a linear scale. With the lower concentration of soman, the cellular AChE activity was significantly inhibited (p < 0.05 as indicated by *) by 60% after 2 h and recovered its original level within 24 h. With the higher soman concentration, the cellular activity was completely inhibited after 2 h, and only recovered about 45% of its original level after 24 h. In both conditions, we observed no modification of mRNA expression of total AChE or ‘readthrough’ variant.

Download figure to PowerPoint

Relative levels of R and T transcripts in the mouse brain

To quantify the relative amount of R transcripts to total AChE transcripts in the brain of naive FVB/N mice, we used real-time PCR, using a plasmid containing the murine AChE gene as a common standard for both couples of primers (as shown in Fig. 1). We first verified that reverse-transcribed mRNA extracted from our tissue samples and our plasmid standard were amplified with similar efficiency. Amplification of DNA was assessed and subtracted using a negative control without reverse transcription; this was very low (less than 1/100 or 1/1000 times) for GAPDH or total AChE transcripts, but higher for AChER transcripts. We obtained similar results when reverse transcription was performed with poly dT and random primers, indicating that R transcripts were not under-evaluated because of a bias of reverse transcription. In fact, they might be over-estimated, because their amplification products could not be distinguished from those produced from unspliced premessenger RNA.

We found that R transcripts represented less than 1% of total AChE transcripts in the striatum, cortex or cerebellum of naive control mice (Fig. 5). This result is in good agreement with previous observations: using an RNA protection assay, Li et al. (1991) found no detectable R or H transcripts in the mouse brain, so that the level of the T transcript can be considered equal to that of total AChE mRNA.

image

Figure 5. Relative levels of R and total transcripts in the naive mouse brain. To quantify relative amounts of the two variants in the mouse striatum, somatosensory cortex and cerebellum, successive 10-fold dilutions of plasmid construction containing mouse genomic acetylcholinesterase (AChE) were amplified with R and AChE primers equally and used as a common standard. The level of AChE is higher in the striatum than in the somatosensory cortex or the cerebellum. The ratio of R to total transcripts is estimated at most, with our experimental conditions, at 0.2% in the striatum, 0.5% in the somatosensory cortex and 0.8% in the cerebellum. We obtained similar ratios when reverse transcription was initiated with random oligonucleotides rather than polyT oligonucleotides (not shown). H transcripts are also low in brain and total transcripts levels correspond de facto to T transcripts.

Download figure to PowerPoint

Acetylcholinesterase mRNA and activity after organophosphate poisoning in different brain structures

The levels of transcripts encoding PRiMA and total AChE were not modified 24 and 48 h after intoxication with a non-lethal dose of soman (0.5 LD50). AChER transcripts were increased threefold in the striatum 24 h after OP poisoning; however, their level remained very low (∼1%) relative to total AChE mRNA, as shown in Fig. 6. We observed no significant modification of AChER transcripts in the somatosensory cortex and the cerebellum during this period (not shown).

image

Figure 6. Effect of irreversible acetylcholinesterase (AChE) inhibition on AChE mRNA level in the mouse striatum of control animals and 24 h and 48 h after acute intraperitoneal injection of soman (310 µg/kg). The quantification of mRNA levels was performed as previously indicated (Fig. 5); the indicated values are means ± SD of the results obtained for five animals and are represented on a logarithmic scale: they are taken as 100% for total AChE transcripts and for membrane anchor of AChE (PRiMA) transcripts, in controls. Asterisks (*) indicate significant differences from controls (p < 0.05). The level of expression of total AChE and of PRiMA were not affected by soman intoxication, but AChER mRNA was significantly increased (3.2-fold) 24 h after soman poisoning. At 48 h after soman injection, the difference between control and poisoned animals, was not significant, due to variability.

Download figure to PowerPoint

After soman poisoning, the degree of AChE inhibition differed in the cortex, striatum and cerebellum of poisoned mice (Fig. 7a). The relative decrease of AChE activity was higher in the somatosensory cortex and in the cerebellum than in the striatum, in which the specific activity of AChE is highest (Bernard et al. 1995; Perrier et al. 2003). This difference is unlikely to result from an incomplete access of soman, as this inhibitor is membrane-permeable and freely crosses the blood–brain barrier. Rather, it seems that the amount of soman in the brain was limiting, so that the striatum retained a more important fraction of its original AChE activity, although the absolute decrease in this region was actually higher than in the cortex or cerebellum. Seven days after OP poisoning, AChE had recovered its original level in the striatum and the cerebellum, but not in the somatosensory cortex. Although AChE activity partially recovered in this region, it remained significantly lower than its original level for more than 14 days after soman poisoning, resulting in a long-term modification of the cholinergic system.

image

Figure 7. Acetylcholinesterase (AChE) recovery after irreversible inhibition in the mouse brain. (a) AChE activities, expressed as nmoles of acetylcholine hydrolyzed/min/µg of protein in extracts of striatum, somatosensory cortex and cerebellum of control animals and 24 h, 48 h, 7 days and 14 days after acute intraperitoneal injection of soman. In the striatum, activity was reduced 48 h after soman intoxication (65% of original level) and had recovered 7 days after. In the cerebellum and the somatosensory cortex, activity was more affected by soman poisoning, 51% and 23% of original level, respectively, 24 h after intoxication. Activity recovered in cerebellum in 7 days but in somatosensory cortex, it had not recovered its original level after 14 days. (b) Non-denaturing electrophoresis of AChE extracts from the striatum, the somatosensory cortex and the cerebellum of control animals and of soman-treated animals after 24 h, 48 h, 7 days and 14 days. As in Fig. 3, extracts from transfected COS cells expressing mouse AChER were used as a reference. Non-amphiphilic AChER monomers (inline image) and amphiphilic AChET monomers (inline image) can be separated by their migration in Triton X-100. The migration of a minor form that did not seem to be affected by inhibition corresponds to that of an amphiphilic monomer, indicating that it consists of AChET subunits. The Tetrameric form (T4) was more affected by inhibition in all structures analyzed.

Download figure to PowerPoint

In the somatosensory cortex or in the cerebellum, the ratio of monomers to tetramers was higher than in the striatum, mainly because of the lower amount of tetrameric form, which was correlated with a lower activity. An analysis of active AChE molecular forms after OP poisoning showed no non-amphiphilic monomer (inline image), but only amphiphilic ones (inline image) (Fig. 7b). In contrast with the major tetrameric form (T4), these monomers, representing a biosynthetic precursor of membrane-bound tetramers, had already recovered their original level after 24 h, as shown both by electrophoresis and sedimentation (Figs 7b and 8). At 24 h after soman poisoning, we observed no modification in the overall level of total AChE mRNA or of monomeric AChE in the analyzed structures, indicating that the level of synthesis of AChE was not significantly affected by its inhibition.

image

Figure 8. Sedimentation analysis of acetylcholinesterase (AChE) molecular forms from the somatosensory cortex of control and 24 h, 48 h, 7 days and 14 days after organophosphate (OP) poisoning in sucrose gradients containing 0.2% Triton X-100. The minor monomeric form (T1), representing a biosynthetic precursor of membrane-bound tetramers, had already recovered its control level after 24 h in the somatosensory cortex remained stable during recovery. The predominant form corresponding to tetramers (T4) was more affected by soman inhibition, and had not recovered its original level in somatosensory cortex 14 days after soman poisoning.

Download figure to PowerPoint

Stress

FVB/N mice were submitted to swimming or immobilization stress, as described in Methods. The brains were then collected for analysis of AChE mRNA and molecular forms. One hour after the last of four daily sessions of swimming stress, we did not observe any significant modification of either c-fos, AChER or total AChE transcripts (not shown). In contrast, 1 h after a 30 min immobilization stress, we observed an induction (about threefold) of c-fos mRNA, and a 3.7-fold increase of AChER mRNA; total AChE transcripts were not detectably modified (Fig. 9).

image

Figure 9. mRNA expression in the mouse brain after immobilization stress. FVB/N mice were immobilized for 30 min and killed 1 h later. Quantification of mRNA levels was performed as previously indicated; the means ± SD of results obtained for five animals are represented on a logarithmic scale. To show the impact on acetylcholinesterase (AChE) splicing we quantified relative amounts of R and total transcripts levels, considered as 100% in control animals; c-fos transcripts were taken as 100% in controls. We observed significant increase of stress inducible c-fos (2.8-fold) and of AChER (3.7-fold) mRNA but not total AChE transcripts. Even increased, R mRNA levels remained low (∼1.5%) compared to total AChE transcripts. We did not observe significant modification of mRNA expression 1 h after the last session of four consecutive days of swimming stress (not shown).

Download figure to PowerPoint

One hour or 1 week after both stresses the total AChE activity was not significantly modified in the striatum, the somatosensory cortex or the cerebellum. In these experiments, we observed no active (inline image) form, in the total brain or in the striatum, somatosensory cortex or cerebellum (not shown). We did not reproduce the previous observations of (Kaufer et al. 1998).

Discussion

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

In this study, we examined the recovery of acetylcholinesterase (AChE) after partial inhibition, in several regions of the mouse brain. We considered the effect of such inhibition, as well as of other perturbations, on the production of the R (‘readthrough’) and T (‘tailed’) mRNA variants, which differ by the splicing of the 3′ region following the last exon encoding the catalytic domain. In addition to the mouse brain, we examined these transcripts in a neuroblastoma cell line (N18TG2) and in a neuroblastoma × glioma hybrid cell line (NG108CC15), under control conditions, after AChE inhibition, and after heat shock.

In the mouse brain, the level of AChE activity is about 10-fold higher in the striatum than in the somatosensory cortex or the cerebellum. All brain regions mostly contained a minor monomeric species and a major species which consists of an AChE tetramer associated with the membrane anchoring protein PRiMA (T4-PRiMA) (Perrier et al. 2002). Following a non-lethal treatment with the irreversible organophosphorous inhibitor soman, the monomers had already recovered their control level after 24 h. The relative activity of tetramers was decreased, after 24–48 h, in the order cortex > cerebellum > striatum; it recovered its original level after 1 week in the cerebellum and the striatum, but not in the cortex where it remained lower than control level after 2 weeks. The time required for assembly, transport and membrane insertion of the heteromeric T4-PRiMA form certainly contributes to its slower, recovery, but cannot explain the observed differences between brain regions. These differences probably arise from the fact that AChE tetramers are mostly produced locally by interneurons in the striatum, but at least partly imported by axonal flow from basal nuclei and from the brain stem to the cortex and cerebellum. In contrast, monomers mostly represent locally synthesized, rapidly renewed precursors of the tetramers. A predominantly intrinsic origin of the monomeric species is consistent with the fact that they are not transported by the fast axonal flow (Couraud and Di Giamberardino 1980; Brimijoin 1983) contrary to tetramers. Their relative amounts show a good correlation with total AChE mRNA expression in the cortex, striatum and cerebellum and therefore reflect the biosynthesis of AChE in these regions (Perrier et al. 2003). It has also been shown in cultured neuroblastoma cells that the half life of monomers is very short (2–3 h) compared to that of tetramers (about 50 h) (Lazar et al. 1984).

The levels of AChE transcripts and of PRiMA transcripts were not significantly changed, 24 h or 48 h after treatment with soman, in the three mouse brain regions examined, or in neuroblastoma cells after partial or complete inhibition. This shows that AChE inhibition did not trigger an up-regulation of the genes encoding the catalytic subunits or their anchoring protein, PRiMA. In the striatum, the level of the ‘readthrough’ transcript (R), appeared transiently increased (threefold at 24 h) after soman poisoning. It is not surprizing that this was not correlated with any change in total AChE transcripts, as splicing towards either T or R variants occurs post-transcriptionally. In addition the R transcripts represented at most 2% of the total AChE transcripts. In soman-treated neuroblastoma cells, the R transcripts did not increase, indicating that the effect observed in the mouse brain probably arises from the perturbation experienced by the nervous system, rather than from a cell-autonomous response to AChE inhibition.

To study the effect of stress, we followed as closely as possible the protocols used previously by the group of H. Soreq for forced swimming and for an immobilization stress, and we used the same strain of mice (Kaufer et al. 1998; Meshorer et al. 2002). We observed no significant changes in c-fos or AChE transcripts after a 4-day swimming protocol. However, immobilization did induce a two to threefold increase of c-fos transcripts, which may be considered as an index of stress response; it did not significantly change total AChE transcripts but increased the proportion of R transcripts about threefold, reaching about 1.5% of the total AChE mRNA. This increase in ‘readthrough’ mRNA levels did not significantly change total mRNA levels, in contrast with previous reports. Our estimations of R transcripts are consistent with previous observations that they represent a very low proportion of total AChE transcripts in the brain (Li et al. 1991) and in other tissues (Legay et al. 1995). In addition, we did not find any significant contribution of the AChER species to AChE activity in the brain, in agreement with the fact that the proportion of R transcripts remained very low.

Because heat shock can affect splicing (Shen et al. 1993; Takechi et al. 1994), we examined its effect on AChE transcripts in N18TG2 and NG108CC15 cells. The two cell types differ markedly in their expression of cholinergic traits: in particular the level of AChE activity is higher in the neuroblastoma × glioma hybrid cell line NG108CC15 (Melone et al. 1987). Both cell lines contain a higher proportion of R transcripts than in the mouse brain, compared to total AChE transcripts, and this may represent a character of incomplete differentiation, as it is also observed in embryonic tissues (Legay et al. 1995). As expected, HSP70 transcripts were highly increased after heat shock in the two cell lines; PRiMA transcripts were unaffected. In NG108CC15 cells, which express a higher level of AChE activity than N18TG2 cells (Biagioni et al. 1995), we found no change in total AChE transcripts or in the AChER variant; in contrast, we observed a modest increase of AChE transcripts in N18TG2, and a sixfold increase of AChER, which reached approximately the same level as in NG108CC15 cells. This suggests that the proportion of spliced (T) and unspliced (R) transcripts largely depends on the level of transcription of the AChE gene, which can be increased by heat shock in N18TG2, but not in NG108CC15, possibly because it is already maximal, corresponding to a more advanced cholinergic differentiation of these neuroblastoma × glioma hybrid cells.

When expressed in transfected COS cells, the R cDNA produced non-amphiphilic monomers (inline image), migrating faster than amphiphilic AChET monomers (inline image) in non-denaturing electrophoresis in the presence of Triton X100. The (inline image) species represented a small component of AChE activity in extracts of NG108CC15 cells. However, it was not detectable in N18TG2 cells, even after heat shock, although R transcripts appeared to represent a comparable proportion of AChE transcripts in this case. It has been shown that AChET transcripts are not necessarily translated into active enzyme (Rotundo 1988; Choi et al. 1996; Falasca et al. 2005); in a similar way, AChER transcripts might also produce catalytically inactive protein. However, the AChER variant has been proposed to play non-cholinergic roles, based on its specific C-terminal R peptide, also called ARP (Grisaru et al. 2001). The lack of sequence conservation of this peptide in mammals raises an intriguing question regarding its hypothetic biological function.

The present results show that heat shock may affect splicing of the 3′ region of AChE transcripts, in a cell autonomous manner. In the mouse brain, AChER transcripts were increased under some stress conditions and after poisoning with an anti-AChE inhibitor, probably through multicellular stimulation effects rather than by cell autonomous mechanisms; their level remained low, compared to those of total AChE transcripts, which were unchanged; thus, the AChER transcript does not represent a sensitive indicator of stress. We did not detect active AChER enzyme in the mouse brain. It seems very unlikely that stress-induced suppression of splicing in the 3′ region of AChE transcripts would result in any physiologically significant change of AChE activity and of cholinergic activation in the brain.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Mouse AChE genomic DNA, and plasmid constructs expressing mouse AChET and AChER were generously provided by Dr Palmer Taylor. We thank Professor Stefano Biagioni for his help, Professor Ronald L. Schnaar for providing N18TG2 cells; Dr François Tronche and M. Jean-Denis Rouzeau for their help with swimming and immobilization stress; Drs Laurent Taysse and Séraphin Delamanche for soman intoxications; Dr Nilson Nunes-Tavares and Ms Claudine Schmitt for technical assistance. This work was supported by grants from the Centre National de la Recherche Scientifique, the Association Française contre les Myopathies, the Direction des Systèmes de Force et de la Prospective and the European Community.

References

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References