SEARCH

SEARCH BY CITATION

Keywords:

  • α-synuclein;
  • membrane translocation;
  • Parkinson's disease;
  • protein transduction domain;
  • repeat sequence

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Many lines of evidence suggest that α-synuclein can be secreted from cells and can penetrate into them, although the detailed mechanism is not known. In this study, we investigated the amino acid sequence motifs required for the membrane translocation of α-synuclein, and the mechanistic features of the phenomenon. We first showed that not only α-synuclein but also β- and γ-synucleins penetrated into live cells, indicating that the conserved N-terminal region might be responsible for the membrane translocation. Using a series of deletion mutants, we demonstrated that the 11-amino acid imperfect repeats found in synuclein family members play a critical role in the membrane translocation of these proteins. We further demonstrated that fusion peptides containing the 11-amino acid imperfect repeats of α-synuclein can transverse the plasma membrane, and that the membrane translocation efficiency is optimal when the peptide contains two repeat motifs. α-Synuclein appeared to be imported rapidly and efficiently into cells, with detectable protein in the cytoplasm within 5 min after exogenous treatment. Interestingly, the import of α-synuclein at 4°C was comparable with the import observed at 37°C. Furthermore, membrane translocation of α-synuclein was not significantly affected by treatment with inhibitors of endocytosis. These results suggest that the internalization of α-synuclein is temperature-insensitive and occurs very rapidly via a mechanism distinct from normal endocytosis.

Abbreviations used
FITC

fluorescein-isothiocyanate

NAC

non-Aβ component of Alzheimer's disease amyloid

PBS

phosphate-buffered saline

PD

Parkinson's disease

pI

isoelectric points

PTD

protein transduction domain

SDS–PAGE

sodium dodecyl sulfate – polyacrylamide gel electrophoresis

STD

synuclein's PTD

TBS

Tris-buffered saline

WT

wild type

α-Synuclein is an acidic neuronal protein which is highly expressed in brain tissues and is primarily localized at the presynaptic terminals of neurons (Ueda et al. 1993; Jakes et al. 1994; Lavedan 1998). It is also expressed in hematopoietic cells (Hashimoto et al. 1997; Shin et al. 2000) and in other tissues, such as the heart, skeletal muscle, pancreas, and placenta, but it is less abundant than in the brain (Ueda et al. 1993; Jakes et al. 1994). In addition to α-synuclein, β- and γ-synucleins constitute the synuclein family in humans (Jakes et al. 1994; Maroteaux et al. 1988; Ji et al. 1997). α-Synuclein has been identified as a major component of intracellular fibrillar protein deposits (Lewy bodies) in several neurodegenerative diseases, including Parkinson's disease (PD), diffuse Lewy body disease and multiple systemic atrophy (Spillantini et al. 1997, 1998; Takeda et al. 1998; Wakabayashi et al. 1998). Particularly, accumulating evidence suggests that aggregation of α-synuclein may contribute to disease pathogenesis (reviewed in Lücking and Brice 2000; Rajagopalan and Andersen 2001; Ericksen et al. 2003). Although significant progress has been made in understanding the pathological role of α-synuclein in neurodegenerative diseases (El-Agnaf et al. 1998; da Costa et al. 2000; Hsu et al. 2000; Saha et al. 2000), the biological function of α-synuclein remains to be clarified. Recent studies suggest that α-synuclein may function in the regulation of synaptic plasticity, neural differentiation, and the regulation of dopamine synthesis (George et al. 1995; Kholodilov et al. 1999; Abeliovich et al. 2000; van der Putten et al. 2000; Stefanis et al. 2001).

α-Synuclein is known to associate with membranous compartments in cultured cells and in brain tissue (George et al. 1995; Irizarry et al. 1996; Jensen et al. 1998; McLean et al. 2000). In vitro studies also showed that α-synuclein can interact with lipid layers, such as artificial liposomes containing phospholipids with acidic head groups, lipid droplets, and lipid rafts (Davidson et al. 1998; Jo et al. 2000; Cole et al. 2002; Fortin et al. 2004). This binding is supposedly mediated by the 11-amino acid imperfect repeats at the N-terminal region of the protein (Jensen et al. 1998; Perrin et al. 2000; Bussel and Eliezer 2003; Jao et al. 2004). The binding interaction between α-synuclein and lipid layers is dynamically regulated (Cole et al. 2002; Ding et al. 2002) and accompanied by conformational changes to the α-helical structure of α-synuclein (Davidson et al. 1998; Bussel and Eliezer 2003; Chandra et al. 2003; Jao et al. 2004). Recently, Lee et al. (2005) reported that part of α-synuclein is either associated with the outer surface of vesicles or even localized in the lumen of vesicles, although the majority of the protein is localized in the cytoplasm. Consistent with these observations, α-synuclein has been implicated in lipid metabolism and vesicle trafficking (Scherzer et al. 2003; Willingham et al. 2003).

Many studies have shown that α-synuclein can be secreted from cells, although the protein has no conventional signal sequence for secretion. For example, Borghi et al. (2000) showed that full-length α-synuclein might be released from neurons into the extracellular space as part of its normal cellular processing. Furthermore, α-synuclein can be detected in serum from both normal and PD subjects (El-Aganaf et al. 2003; Miller et al. 2004). Recently, transfection studies also demonstrated that a portion of α-synuclein can be constitutively secreted from cells through an unconventional exocytic pathway (Lee et al. 2005; Sung et al. 2005). α-Synuclein is also known to penetrate into cells by an unknown mechanism. In previous work, we demonstrated that α-synuclein could penetrate inside neuronal cells by Rab5A-dependent endocytosis and induce cell death (Sung et al. 2001), and that α-synuclein could penetrate into platelets and subsequently inhibit α-granule release upon stimulation (Park et al. 2002). In addition, Forloni et al. (2004) showed that the non-Aβ component of Alzheimer's disease amyloid (NAC) peptide derived from α-synuclein can penetrate inside cells and accumulate in the perinulcear region.

As described above, many lines of evidence suggest that α-synuclein can be secreted from cells and can penetrate into them, although details of the mechanism are not known. In this study, we investigated the amino acid sequence motifs required for the membrane translocation of α-synuclein using a series of deletion mutants and recombinant peptides. We also addressed the mechanistic features of the cellular import of α-synuclein.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Materials

DEAE-Sepharose Fast Flow, CM-Sepharose Fast Flow and Sephacryl S-200 High Resolution were purchased from Amersham Biosciences (Uppsala, Sweden), and the Ni-NTA resin from Invitrogen (Carlsbad, CA, USA). Synucleins (α, β and γ) were obtained from ATGen (Sungnam, Korea). β-d-Thiogalactopyranoside (IPTG) was purchased from Sigma (St Louis, MO, USA). A fluorescein 5-isothiocyanate (FITC) labelling kit was purchased from Pierce (Rockford, IL, USA). Brefeldin A was purchased from Epicenter Technologies (Madison, WI, USA), and cytochalasin D was purchased from Sigma. Leupeptin, pepstatin, phenylmethylsulfonyl fluoride, and imidazole were purchased from Boehringer Mannheim (Mannheim, Germany).

Construction of expression vectors for α-synuclein deletion mutants

A series of α-synuclein deletion mutant constructs were generated by PCR amplification of the α-synuclein gene with the specific primer sets described below. The protein coding regions of the N-terminal amphipathic portion (residues 1–60; Syn1–60 in Fig. 2a) and the N-terminal amphipathic portion plus the NAC peptide (residues 1–95; Syn1–95) were amplified by PCR with the 5′-oligonucleotide primer CGAGCTCCATATGGATGTATTCATGAAAGG and the 3′-oligonucleotide primers CGAGCTCAAGCTTCTATTTGGTCTTCTCAGCCACTGTTGC and AGAGCTCGATTCCTAGACAAAGCCAGTGGCTGCTGCAAT containing the restriction enzyme sites underlined above, respectively. The protein coding regions of the C-terminal acidic tail (residues 96–140; Syn96–140) and the NAC plus acidic tail (residues 61–140; Syn61–140) were amplified by PCR with the 5′-oligonucleotide primers CGATCGCCATATGAAAAAGGACCAGTTGGGCAAGAATGAA and CGATCGCCATATGGAGCAAGTGACAAATGTTGGAGGAGCA, and the 3′-oligonucleotide primer GAGCTCAAGCTTTTAGGCTTCAGGTTCGTAGTCTTGATA containing the restriction enzyme sites underlined above, respectively. The amplified DNAs were gel purified, digested with appropriate enzymes, and then ligated into the pRSETA bacterial expression vector (Invitrogen) that had been digested with the appropriate restriction enzymes. pSynΔNAC, which lacks the NAC portion, was generated by consecutive cloning of the N-terminal amphiphatic portion (residues 1–60) and the C-terminal acidic tail (residues 96–140) into the pRSETA vector (Invitrogen). All constructs were confirmed by DNA sequencing.

image

Figure 2. Membrane translocation of α-synuclein and its deletion mutants. (a) A schematic diagram of α-synuclein and the deletion mutant constructs. α-Synuclein consists of three distinct regions: the N-terminal amphipathic region (residues 1–60), the hydrophobic NAC region (residues 61–95), and the C-terminal acidic tail (residues 96–140). Five deletion mutant constructs encoding the amphipathic region (Syn1–60), the amphipathic region and the NAC region (Syn1–95), the NAC and acidic tail regions (Syn61–140), the acidic tail region (Syn96–140), and the NAC-deleted α-synuclein named SynΔNAC were used in this study. (b) SDS–PAGE analysis of the purified α-synuclein and its deletion mutant proteins. The purified proteins were analysed on a 15% SDS–PAGE, and the protein bands were stained with Coomassie Brilliant Blue R250. (c) The internalization of α-synuclein and deletion mutants analysed by confocal microscopy. Cells were incubated with 5 μm of FITC-labelled proteins for 30 min at 37°C. BSA and lysozyme were used as negative controls. Cells were not fixed to avoid fixation artifacts, but were washed extensively with PBS before confocal microscopic analysis. The scale bar represents 10 μm. (d) Average cell fluorescence intensity. Average cell fluorescence intensity measurements of 30 cells labelled with FITC over the total section area (p < 0.05). Values are expressed as mean ± SE.

Download figure to PowerPoint

Four N-terminally truncated mutant constructs of α-synuclein (Syn16–140, Syn28–140, Syn38–140 and Syn51–140 in Fig. 4a) which serially lacked the 11-mer repeats were generated by the PCR amplification method. The protein coding regions were amplified by PCR with the 5′-oligonucleotide primers CGAGCTCCATATGGTGGCTGCTGCTGAGAAAACCAAA for pSyn16–140, CGAGCTCCATATGGAAGCAGCAGGAAAGACAAAAGAG for pSyn28–140, CGAGCTCCATATGCTCTATGTAGGCTCCAAAACCAAG for pSyn38–140, CGAGCTCCATATGGGTGTGGCAACAGTGGCTGAGAAG for pSyn51–140, and the 3′-oligonucleotide primer GAGCTCAAGCTTTTAGGCTTCAGGTTCGTAGTCTTGATA containing the restriction enzyme sites underlined above. The amplified DNAs were gel purified, digested with appropriate enzymes, and then ligated into the pRSETA vector that had been digested with the appropriate restriction enzymes. All constructs were gel purified and confirmed by DNA sequencing.

image

Figure 4. Membrane translocation of a series of N-terminally truncated α-synuclein mutants. (a) Schematic diagrams of full-length and N-terminally truncated forms of α-Synuclein. Shaded regions represent the 11-mer repeats. Δ1Syn lacks the first repeat found in α-synuclein (residues 1–15); Δ2Syn lacks the first two repeats (residues 1–27); Δ3Syn lacks the first three repeats (residues 1–37); and Δ4Syn lacks the first four repeats (residues 1–50). (b) SDS–PAGE of the purified N-terminally truncated mutant proteins. The purified proteins were analysed on a 13.5% SDS–PAGE, and the protein bands were stained with Coomassie Brilliant Blue R250. (c) Western blot analysis of the membrane translocation of exogenously added α-synuclein and N-terminally truncated mutants. CHO-K1 cells were treated with 10 μm of each protein for 1 h at 37°C. Cells were carefully washed with a trypsin–EDTA solution and with PBS before the preparation of cell lysates. Lane 1, WT; lane 2, Δ1Syn; lane 3, Δ2Syn; lane 4, Δ3Syn; lane 5 Δ4Syn. (d) Confocal microscopic analysis of the membrane translocation of exogenously added α-synuclein and N-terminally truncated mutants. Cells were incubated with 5 αμm of FITC-labelled proteins for 30 min at 37°C. Syn96–140 was used as a negative control. Cells were not fixed to avoid fixation artifacts, but were washed extensively with PBS before confocal microscopic analysis. The scale bar represents 10 μm.

Download figure to PowerPoint

Three expression vectors which encode one, two, and three 11-amino acid repeat sequence motifs of α-synuclein, respectively, were similarly constructed by the PCR amplification method. The protein coding regions were amplified by PCR, and the amplified DNAs were ligated into the NdeI and HindIII sites of the pRSETA expression vector.

Bacterial expression and purification of mutant proteins

The α-synuclein deletion mutants were over-expressed in Escherichia coli (BL21), and the recombinant proteins were purified to apparent homogeneity. This was carried out by taking advantage of the thermosolubility of the protein and using conventional column chromatography, as described previously (Park et al. 2002). Briefly, the transformed bacteria were grown in LB medium with 0.1 mg/mL ampicillin at 37°C to an A600 of 0.8, and then cultured for an additional 4 h after being induced with 0.5 mm IPTG. The cells were harvested by centrifugation at 8000 g for 10 min, re-suspended in 20 mm Tris-Cl pH 7.4, and then disrupted by ultrasonication. The supernatant was subjected to heat treatment at 100°C for 20 min. After removing the precipitates, the supernatant was purified with DEAE anion-exchange chromatography, and subsequently with CM cation-exchange chromatography in 20 mm Tris-Cl, pH 7.4. The bound proteins were eluted with a linear gradient between 0.1 m and 0.5 m NaCl at a flow rate of 1.5 mL/min. All proteins were further purified on an FPLC gel-filtration column pre-equilibrated with 20 mm Tris-Cl, pH 7.4. The proteins were concentrated and buffer-changed with a Centricon apparatus (Amicon, Beverly, MA, USA). The proteins were quantitated with the bicinchoninic acid assay and stored at 30°C. The identity of each deletion mutant proteins was confirmed by mass spectroscopy (Table 1).

Table 1.  Molecular weights, charged residues, isoelectric points (pI) and hydropathy values of α-synuclein and its deletion mutants
ProteinMolecular weightCharged residuespI value*Hydropathy value*
Predicted*Mass spectroscopyPositiveNegative
  1. *The predicted molecular weight, the pI values and the hydropathy values were calculated by using the ProtParam program (http://www.expasy.ch).

α-synuclein14460.114462.2315244.67−0.403
1–606149.16150.441179.52−0.188
1–959391.89392.721299.260.148
61–1408460.18462.664173.85−0.533
96–1405217.55216.13153.76−1.491
ΔNAC11935.311935.4214234.63−0.729

Cell culture

Chinese hamster ovary cells (CHO-K1) and human leukaemia K562 cells were grown in Dulbecco's modified Eagle's medium (Gibco, BRL, Grand Island, NY, USA) supplemented with 10% fetal bovine serum and penicillin–streptomycin, and maintained at 37°C in an atmosphere containing 5% CO2. Human neuroblastoma SH-SY5Y cells and rat adrenal pheochromocytoma PC12 cells were routinely maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum and penicillin–streptomycin in a humid atmosphere of 5% CO2 at 37°C.

Western blot analysis

Cells were lysed using the following lysis buffer: 50 mm Tris (pH 8.0), 110 mm NaCl, 5 mm EDTA, 1% Triton X-100, phenylmethylsulfonyl fluoride (100 μg/mL), 10% glycerol, 1.5 mm MgCl2 and protease inhibitor cocktail (Complete, Roche Molecular Biochemicals, Indianapolis, IN, USA). Protein concentrations were determined using the bicinchoninic acid assay (Pierce). Whole cell lysates containing 50 μg of protein were boiled in equal volumes of loading buffer [125 mm Tris–HCl, pH 6.8, 4% sodium dodecyl sulfate (SDS), 20% glycerol, and 10% of 2-β-mercaptoethanol]. Proteins were separated electrophoretically on 12–15% denaturing polyacrylamide gels and subsequently transferred to Hybond enhanced chemiluminescence nitrocellulose membranes (Amersham Biosciences) using the Bio-Rad Mini-Gel system (Bio-Rad Laboratories, Hercules, CA, USA). For immunoblotting, membranes were blocked with 5% non-fat dried milk in Tris-buffered saline (TBS) for 1 h. Primary antibody against α-synuclein (Syn 211 for Fig. 3b and Syn N-19 for Fig. 3c; Santa Cruz Biotechnology, Santa Cruz, CA, USA) was applied at a 1 : 1000 dilution for 1 h. After washing twice with TBS containing 0.05% Tween 20, secondary antibody (peroxidase-conjugated goat anti-mouse IgG for Fig. 3b; Zymed Laboratories Inc., South San Francisco, CA, USA; peroxidase-conjugated donkey anti-goat IgG for Fig. 3c; Santa Cruz Biotechnology) was applied at a 1 : 2000 dilution for 1 h. Blots were washed twice in TBS containing 0.05% Tween 20 for 10 min, incubated in commercial enhanced chemiluminescence reagents (Pierce) and exposed to photographic film.

image

Figure 3. Flow cytometry and western blot analysis for the membrane translocation of α-synuclein and its deletion mutants. (a) Flow cytometry analysis of cells incubated with FITC-labelled proteins. CHO-K1 cells were incubated with FITC-labelled WT α-synuclein, FITC-labelled Syn1–60, FITC-labelled Syn1–95, FITC-labelled Syn61–140, FITC-labelled Syn96–140, FITC-labelled SynΔNAC, and FITC labelled-BSA for 30 min at 37°C. Cells were washed extensively with a trypsin–EDTA solution and with PBS prior to flow cytometry analysis. Solid white histograms represent untreated control cells, and solid grey histograms represent cells treated with FITC-labelled proteins. (b) Western blot analysis of the membrane translocation of exogenously added α-synuclein and its deletion mutants with a monoclonal antibody (Syn211). Cells were treated with PBS alone (lane 1), 10 μm WT α-synuclein (lane 2), 10 μm Syn1–60 (lane 3), 10 μm Syn1–95 (lane 4), 10 µm Syn61–140 (lane 5), 10 μm Syn96–140 (lane 6) and 10 μm SynΔNAC (lane 7) for 1 h at 37°C. Cells were carefully washed with a trypsin–EDTA solution and with PBS before the preparation of cell lysates. (c) Western blot analysis of the membrane translocation of exogenously added α-synuclein and its deletion mutants with polyclonal antibodies (SynN-19). Cells were treated with PBS alone (lane 1), 10 μm WT α-synuclein (lane 2), 10 μm Syn1–60 (lane 3), 10 μm Syn1–95 (lane 4), 10 μm Syn96–140 (lane 5) and 10 μm SynΔNAC (lane 6) for 1 h at 37°C. Cells were carefully washed with a trypsin–EDTA solution and with PBS before the preparation of cell lysates.

Download figure to PowerPoint

Preparation of FITC-labelled proteins

Proteins were labelled with N-hydroxysuccinimide–FITC according to the manufacturer's instruction (Pierce). Briefly, proteins [1 mg/mL in phosphate-buffered saline (PBS) buffer] were buffer-changed into borate buffer (pH 8.5) by using desalting columns. The fluorescent dye was dissolved in dimethylsulfoxide, and a 24-fold molar excess of the fluorescent dye was mixed rapidly with each protein solutions. The reaction mixtures were incubated for 1 h at room temperature (25°C), then overnight at 4°C in the dark. After coupling, protein solutions were loaded onto a Sephadex G-25 column to remove the unbound dyes. Fractions were carefully monitored for protein content by measuring the absorbance of each fraction at 280 nm. The labelled protein fractions were pooled and concentrated with a Centricon apparatus (Amicon). Protein concentration was determined with a bicinchoninic acid assay kit (Pierce) using bovine serum albumin as standard. To standardize the labelled proteins, the efficiency of the FITC labelling was estimated from the absorbance at 495 nm and from the protein concentration. Labelled proteins were also separated on an SDS–polyacrylamide gel electrophoresis (PAGE) and the fluorescence of each sample was additionally standardized on an image analysis system (Molecular Analyst II, version 1.5, Bio-Rad Laboratories).

Protein internalization, visualization and quantitation

Protein internalization was measured by flow cytometry and confocal microscopy on living cells. For flow cytometry, cells were seeded at 8 × 104 cells/cm2 in 12-well plates and grown for 24 h in complete medium. Before incubation with the FITC-labelled proteins, the cells were washed and pre-incubated in Dulbecco's modified Eagle's medium or RPMI for 1 h at 37°C. Cells were then incubated with 5 μm FITC-labelled protein at either 37°C or 4°C for various periods of time, and then washed and placed in ice-cold PBS (pH 7.4). The cell pellet was washed twice before a 5-min incubation with trypsin (1 mg/mL) at 37°C. For determination of intracellular FITC fluorescence alone, cells were then washed once more with NaCl/Pi and incubated for 5 min with 150 μL of a freshly prepared 0.1% Tween 20 solution (pH 7.4). Cells were further washed and placed in ice-cold PBS. FITC-labelled proteins were excited at 488 nm and fluorescence was measured at 525 nm using a FACScalibur (Becton-Dickinson, Franklin Lakes, NJ, USA) yielding the mean fluorescence intensity per cell, which is a measure of the amount of cell-associated peptide.

For confocal microscopic analysis, cells were seeded at 1 × 104 cells/cm2 in Laboratory-Tek® German borosilicate coverglass with eight chambers (Nalge Nunc International, Naperville, IL, USA) and grown for 48 h in complete medium. Subsequently, cells were washed and pre-incubated in 200 μL Dulbecco's modified Eagle's medium or RPMI (30 min at 37°C). Cells were subsequently incubated with the FITC-labelled proteins for 30 min at either 4°C or 37°C, washed, and placed in 200 μL ice-cold PBS (pH 7.4). For determination of the intracellular FITC fluorescence alone, cells were placed at 4°C and incubated for various times with 50 μL of a freshly prepared 0.1% Tween 20 solution (pH 7.4). Cells were further washed and placed in ice-cold PBS. Photographs were taken with a Zeiss model LSM510 invert on the base of a Zeiss Axiovert 100 microscope (Carl Zeiss B.V., Sliedrecht, the Netherlands).

Fluorescence intensity was quantitated using Metamorph software (version 4.6r5, Universal Imaging, Downingtown, PA, USA). Mean fluorescence intensity was measured on each image, and total mean fluorescence was calculated for each sample. To exclude background fluorescence, mean fluorescence intensity of the negative images was subtracted from those of positive images.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Intracellular delivery of α-, β- and γ-synucleins

Recent studies showed that α-synuclein can translocate across the plasma membrane by a mechanism that has yet to be elucidated (Borghi et al. 2000; Sung et al. 2001; Park et al. 2002; Forloni et al. 2004; Sung et al. 2005). As a first step in understanding the membrane translocation mechanism of α-synuclein, we checked whether other synuclein family members (β- and γ-synucleins) could also translocate across the cell membrane. For this purpose, purified recombinant α-, β- and γ-synucleins were FITC-labelled and exogenously added into cell culture media. Cells were then harvested and the intracellular delivery of FITC-labelled synucleins was visualized using a confocal microscope. As shown in Fig. 1(a), not only α-synuclein, but also β- and γ-synucleins penetrated the cell membrane and were localized primarily in the cytoplasm, although internalized proteins might also be localized in vesicles. Interestingly, unlike other membrane-permeating proteins, synuclein family members did not appear to translocate across the nuclear membrane. Membrane translocation of α-, β- and γ-synucleins was also confirmed by flow cytometric analysis (Fig. 1b). The membrane translocation efficiencies of all the synuclein family members appeared to be slightly different (Fig. 1c), and the membrane translocation of these proteins can be detected even at a concentration of 0.1 μm (data not shown). The C-terminal acidic tails of synuclein family members are very diverse in size as well as in sequence, although the N-terminal amphipathic regions of the synuclein family members are well conserved among species (reviewed in Lavedan 1998; Hashimoto and Masliah 1999; Iwai 2000; Lücking and Brice 2000). Thus, it seems likely that the N-terminal part (residues 1–95) may play a critical role in the membrane translocation of synuclein family members.

image

Figure 1. Intracellular delivery of α-, β- and γ-synucleins. (a) Confocal microscopic analysis. CHO-K1 cells were incubated for 30 min with PBS alone (Con-FITC), 5 μm of FITC-labelled α-synuclein (α-Syn-FITC), 5 μm of FITC-labelled β-synuclein (β-Syn-FITC) and 5 μm of FITC-labelled γ-synuclein (γ-Syn-FITC), respectively. Cells were washed extensively with PBS prior to confocal microscopic analysis. (b) Flow cytometric analysis. CHO-K1 cells were incubated with 5 μm of FITC-labelled α-synuclein (α-Syn), β-synuclein (β-Syn), γ-synuclein (γ-Syn), and lysozyme, respectively, for 30 min. Cells were washed extensively with a trypsin–EDTA solution and with PBS prior to analysis by flow cytometry. Solid white histograms represent untreated control cells, and solid grey histograms represent cells treated with FITC-labelled synucleins. (c) Average cell fluorescence intensity. Average cell fluorescence intensity measurements of 30 cells labelled with FITC over the total section area (p < 0.05). Values are expressed as mean ± SE.

Download figure to PowerPoint

The N-terminal and NAC regions contain the motifs for the intracellular delivery of α-synuclein

α-Synuclein consists of three distinct regions: the N-terminal amphipathic region (residues 1–60), the hydrophobic NAC region (residues 61–95), and the C-terminal acidic region (residues 96–140). To investigate which region is responsible for the membrane translocation of α-synuclein, we produced five deletion mutant constructs (Fig. 2a). Syn1–60 encodes the entire region of the amphipathic region, Syn1–95 encodes the amphipathic and NAC regions, Syn61–140 encodes the NAC and acidic tail regions, Syn96–140 encodes the acidic tail region, and SynΔNAC lacks the NAC region. The deletion mutant proteins were over-expressed in E. coli and purified using conventional column chromatography methods. The protein samples used in this study were highly purified as determined by SDS–PAGE (Fig. 2b), and the characteristics of these mutant proteins are summarized in Table 1.

We first investigated the intracellular delivery of the α-synuclein deletion mutants using confocal microscopy. α-Synuclein and its deletion mutants were labelled with FITC, and CHO-K1 cells were treated with the FITC-labelled proteins. Cells were harvested and then visualized using confocal microscopy. As shown in Fig. 2(c), FITC-labelled α-synuclein, Syn1–60, Syn1–95 and SynΔNAC displayed bright fluorescence, indicating that FITC-labelled proteins were delivered into the cells. Interestingly, the fluorescence of wild-type (WT), Syn1–60, Syn1–95 and SynΔNAC proteins appeared to be localized mainly in the cytoplasm and not in the nucleus. The relative fluorescence intensity of Syn61–140 was lower, and that of Syn96–140, which lacks both the N-terminal amphipathic and the hydrophobic NAC regions, was almost invisible (Figs 2c and d). Similar results were obtained in SHSY-5Y cells and PC12 cells (data not shown).

Membrane translocation of α-synuclein deletion mutants was also demonstrated by flow cytometric analysis (Fig. 3a). Consistent with the confocal microscopic studies mentioned above, flow cytometric analysis of cells incubated with WT, Syn1–60 Syn1–95, Syn61–140 and SynΔNAC proteins showed a bright green fluorescence. However, control cells and the cells incubated with Syn96–140 did not show any fluorescence.

Membrane translocation of α-synuclein deletion mutants was finally verified by western blot analysis. As shown in Fig. 3(b), exogenously added α-synuclein, Syn61–140 and SynΔNAC appeared to penetrate the cell membrane; however, Syn96–140 did not. In addition, the membrane translocation of the α-synuclein deletion mutants was observed in every cell type tested, such as PC12, K562, SHSY-5Y, and CHO-K1 cells (Fig. 3b). Because we used a monoclonal antibody that can only detect the C-terminal acidic tail of α-synuclein, membrane translocation of Syn1–60 and Syn1–95 was not demonstrated in this experiment. To demonstrate the membrane translocation of Syn1–60 and Syn1–95, polyclonal antibodies were used for western blot analysis. As shown in Fig. 3(c), Syn1–60, Syn1–95, and SynΔNAC appeared to penetrate cell membranes. Taken together, our data demonstrated that α-synuclein, Syn1–60, Syn1–95, Syn61–140, and SynΔNAC were able to penetrate cell membrane, but Syn96–140 could not. This suggests that the N-terminal and NAC regions contain the motifs for the intracellular delivery of α-synuclein, although the NAC is less effective than the N-terminal region.

Membrane translocation of a series of N-terminally truncated mutants

The N-terminal and NAC regions (amino acid residues 1–95) of α-synuclein contain seven 11-amino acid imperfect repeats with a highly conserved hexamer motif (KTKEGV). The repeat sequence motifs are also found in β- and γ-synucleins. Interestingly, these repeat regions are structurally homologous to the amphipathic, lipid-binding α-helical domains of apolipoproteinA-I (Segrest et al. 1990, 1992; Clayton and George 1998). Apo A-I has eight 22-mer amphipathic helical repeat domains as the major protein component of human HDL (Clayton and George 1998). A recent report suggested that the lipid binding or membrane interaction is affected by partial deletion of the amphipathic helical domains of ApoA-I. Based on this information, we investigated whether the 11-amino acid imperfect repeats of α-synuclein were responsible for its membrane translocation. For this purpose, we produced a series of N-terminally truncated forms of α-synuclein (Fig. 4a). Δ1Syn lacks one repeat sequence motif, Δ2Syn lacks two repeat sequence motifs, Δ3Syn lacks three repeat sequence motifs, and Δ4Syn lacks four repeat sequence motifs at the N-terminus. These N-terminally truncated forms were purified from E. coli and the purified proteins were FITC-labelled (Fig. 4b). The membrane translocation abilities of these mutant proteins were assessed by western blot analysis. As shown in Fig. 4(c), all the truncated forms appeared to be delivered into CHO-K1 cells, but the translocation efficiencies were different. As the more repeated sequence motifs were deleted, membrane translocation efficiency decreased (Fig. 4c). Confocal microscopic studies also demonstrated that the membrane translocation efficiency of the N-terminally truncated forms of α-synuclein was proportional to the number of repeat sequence motifs present (Fig. 4d). These results indicate that the 11-amino acid imperfect repeats of synuclein family members play a critical role in the membrane translocation of these proteins.

Sequence motifs for the membrane translocation of α-synuclein

To directly demonstrate that the 11-amino acid repeat sequences can transverse the plasma membrane, we produced a series of fusion peptides (Fig. 5a) that contained the repeat sequence motif using recombinant DNA technology. 1XR contains a single repeat motif (amino acids 10–20 of α-synuclein), 2XR contains two repeat motifs (amino acid residues 10–31), and 3XR contains three repeat motifs (amino acid residues 10–42). These fusion peptides were expressed in E. coli and the peptides were FITC-labelled. Using these peptides, membrane translocation abilities were compared using confocal microscopy. As shown in Fig. 5(b), all the peptides appeared to be delivered into CHO-K1 cells, but the translocation efficiencies were different. Interestingly, the fluorescence intensity of 2XR-treated cells was higher than those of 1XR- and 3XR-treated cells, suggesting that the membrane translocation efficiency of 2XR is the greatest. Similar results were obtained using flow cytometry studies (Fig. 5c). These results indicate that the 11-amino acid imperfect repeats of α-synuclein can transverse the plasma membrane, and the membrane translocation efficiency is optimal when the peptide contains two repeat motifs.

image

Figure 5. Transduction efficiency of fusion peptides containing the 11-mer repeat(s). (a) Amino acid sequences of fusion peptides containing the 11-mer repeat(s). 1XR contains one 11-mer repeat, 2XR contains two repeats, and 3XR contains three repeats derived from the N-terminal region of α-synuclein. The C-terminal parts of fusion peptides were derived from the pRSETA expression vector. (b) The internalization of fusion peptides containing the 11-mer repeat(s) analysed by confocal fluorescence microscopy. Cells were incubated with 5 μm of FITC-labelled peptides for 30 min at 37°C. Syn96–140 was used as a negative control. Cells were not fixed to avoid fixation artifacts, but were washed extensively with PBS before confocal microscopic analysis. The scale bar represents 10 μm. (c) Flow cytometry analysis of cells incubated with FITC-labelled fusion peptides. CHO-K1 cells were incubated with FITC-labelled 1XR, 2XR, 3XR, or Syn96–140 for 30 min at 37°C. Cells were washed extensively with a trypsin–EDTA solution and with PBS prior to flow cytometry analysis. Solid white histograms represent untreated control cells, and solid grey histograms represent cells treated with FITC-labelled peptides. Syn96–140 was used as a negative control.

Download figure to PowerPoint

Kinetic and mechanistic features of the membrane translocation of α-synuclein

We next addressed the kinetics of and mechanism behind α-synuclein uptake by cells. CHO-K1 cells were incubated with FITC-labelled α-synuclein at 37°C or 4°C for various time periods. The time course of α-synuclein uptake showed that the protein was imported rapidly and efficiently, with detectable protein in the cytoplasm within 5 min of exogenous treatment (Fig. 6a). Furthermore, the import of α-synuclein at 4°C was comparable with that detected at 37°C by confocal microscopy (Fig. 6a). Flow cytometric studies also resulted in the same conclusion (Fig. 6b). These results suggest that the typical endocytosis pathway might not be responsible for the membrane translocation of α-synuclein.

image

Figure 6. Effects of incubation time and temperature on the membrane permeabilization of α-synuclein. (a) Confocal microscopic analysis. CHO-K1 cells were incubated for 5, 15, 30 or 60 min with 5 μm of FITC-labelled α-synuclein at 4°C and 37°C, respectively. (b) Flow cytometric analysis. CHO-K1 cells were incubated with 5 μm of FITC-labelled α-synuclein for 5 min at 4°C (a), and at 37°C (b). Cells were washed extensively prior to flow cytometry analysis. Solid white histograms represent untreated control cells, and solid grey histograms represent cells treated with FITC-labelled α-synuclein.

Download figure to PowerPoint

We further examined the effects of endocytosis inhibitors on the membrane translocation of α-synuclein. To investigate the role of the Golgi in α-synuclein transport, CHO-K1 cells were pretreated with Brefeldin A, an inhibitor of trans-Golgi transport (Lippincott Schwartz et al. 1990), and incubated with FITC-labelled α-synuclein for 30 min. Confocal microscopic observation indicated that the import of α-synuclein was not significantly affected by Brefeldin A treatment (Fig. 7a). Internalization of α-synuclein was also not significantly affected by pretreatment with Cytochalisin D (Fig 7a), a microfilament-disrupting drug (Elliott and O'Hare 1997). In addition, flow cytometric analysis of the cells resulted in the same conclusion (Fig 7b). Taken together, these results suggest that the internalization of α-synuclein is temperature-insensitive and occurs very rapidly via a route distinct from normal endocytosis.

image

Figure 7. Effects of endocytosis inhibitors on the internalization of α-synuclein. (a) CHO-K1 cells were pretreated with 10 μm of Brefeldin A (b) or 5 μm of Cytochalasin D (c) for 30 min, and then FITC-labelled α-synuclein was added to the medium. After a 30-min incubation, cells were washed and observed using confocal fluorescence microscopy. Control cells were treated with PBS only (a). (b) CHO-K1 cells were pretreated with (red curves) or without (green curves) inhibitors for indicated time periods, and then FITC-labelled α-synuclein was exogenously added to the medium. After a 30-min incubation, cells were extensively washed with a trypsin–EDTA solution and with PBS, and analysed by flow cytometry. Solid white histograms represent untreated control cells, and red and green histograms are cells treated with FITC-labelled α-synuclein.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Many proteins with no signal sequence can be secreted through an unconventional exocytosis pathway independent of the ER/Golgi pathway (reviewed in Kuchler 1993; Nickel 2003). α-Synuclein is also known to be secreted into CSF and plasma (Borghi et al. 2000; El-Aganaf et al. 2003; Miller et al. 2004). Furthermore, exogenous α-synuclein can be imported into cells (Sung et al. 2001; Park et al. 2002). In this study, we demonstrated that the N-terminal amphipathic (amino acid residues 1–60) and the NAC peptide (amino acid residues 61–95) regions are responsible for the membrane translocation of α-synuclein, although the NAC is less effective than the N-terminal region. Particularly, the 11-amino acid imperfect repeat sequences in these regions appear to mediate the import of α-synuclein into cells. These sequence motifs are distinct from those of other protein transduction domain (PTD) containing proteins, including Tat and VP22 (discussed below in detail). However, mechanistic features of the membrane translocation of α-synuclein appear to be very similar to other PTD-containing proteins. These results extend our understanding of the secretary proteins lacking signal sequences, particularly of the PTD-containing protein family.

Although α-synuclein does not possess a hydrophobic N-terminal signal sequence for secretion, earlier studies demonstrated that α-synuclein is secreted in both PD patients and in normal subjects (Borghi et al. 2000; El-Aganaf et al. 2003; Miller et al. 2004). Secreted α-synuclein can be detected at nanomolar concentrations in the CSF and blood. Interestingly, the blood levels of α-synuclein have been shown to be increased in familial PD patients with an α-synuclein gene triplication (Miller et al. 2004). α-Synuclein secretion has also been demonstrated in vitro by transfection studies (Lee et al. 2005; Sung et al. 2005). Particularly, Lee et al. (2005) demonstrated that a portion of cellular α-synuclein is present in vesicles and is secreted from cells through an unconventional exocytic pathway in a constitutive manner. Secretion of α-synuclein was temperature sensitive, but was not affected by Brefeldin A treatment, suggesting that an unconventional exocytosis mechanism might be involved.

In this study, we showed that α-synuclein can be translocated into HeLa cells, neuronal cells (SH-SY5Y), hematopoietic cells, and Chinese hamster ovary cells (CHO-K1). Previous studies also showed that α-synuclein can penetrate into undifferentiated neuronal cells and platelets (Sung et al. 2001; Park et al. 2002). These results suggest that the membrane translocation of α-synuclein is not specific to certain cell types. If α-synuclein uses a specific receptor for its import into cells, penetration of α-synuclein should be limited to cell types expressing the receptor(s). Therefore, it seems highly likely that α-synuclein may bind to common molecules on the cell surface. As the N-terminal region of α-synuclein is known to interact with lipid layers in vitro as well as in vivo (Perrin et al. 2000; Bussel and Eliezer 2003; Jao et al. 2004), we propose that the interaction between α-synuclein and the plasma membrane is an essential step for the membrane translocation of α-synuclein. Transfection studies demonstrated that the secretion of α-synuclein is also not specific to certain cell types (Lee et al. 2005; Sung et al. 2005). Over-expressed α-synuclein can even be secreted from yeast (Dixon et al. 2005) and from E. coli. (authors' unpublished results). Interestingly, Lee and colleagues reported that a portion of α-synuclein is stored in the lumen of vesicles in the cytoplasm, and that the α-synuclein in vesicles might be secreted through an unconventional exocytosis pathway. These results suggest that the interaction between α-synuclein and vesicle membranes is critical for the translocation of α-synuclein into vesicles, and presumably for the subsequent secretion process. Thus, our data clearly indicate that the 11-amino acid imperfect repeat motifs are responsible for the membrane translocation of α-synuclein, i.e. both secretion and penetration.

The 11-amino acid repeat motifs contain a well-conserved core sequence of KTKEGV, and these repeats are also present in the N-terminal region of β- and γ-synuclein. The 11-mer repeats of α-synuclein are supposed to form amphiphatic α-helices when the protein is bound to lipid molecules (Bussel and Eliezer 2003). Although no significant sequence homology is found, the repeat region is structurally homologous to the lipid binding domain of exchangeable apolipoproteins, in which the repeat sequence motifs also form amphipathic α-helices (Segrest et al. 1992). In this study, all the α-synuclein deletion mutants and recombinant peptides that contained one or more of the repeat sequence motif(s) appeared to translocate the cell membrane (Figs 2, 4 and 5). However, Syn96–140 and control proteins, which have no such motif, did not permeate into cells (Fig. 2). Taken together, the data suggest that the repeat sequence motifs bind to the lipid bilayer, and the binding interaction might be critical for the membrane translocation of synuclein proteins.

We demonstrated that the cellular uptake of α-synuclein could be detected within 5 min, and that this uptake was not inhibited when cells were incubated at 4°C. It is well established that receptor-mediated endocytosis is blocked by incubation at 4°C (Pastan and Willingham 1981). The cellular uptake of α-synuclein also appeared to be insensitive to treatment with the general endocytosis inhibitors, Brefeldin A and Cytochalasin D. Brefeldin A is known to disrupt the Golgi apparatus and inhibit transport through the Golgi (Lippincott Schwartz et al. 1990), whereas Cytochalasin D is a microfilament-disrupting drug (Elliott and O'Hare 1997). Therefore, these results suggest that internalization of α-synuclein is temperature insensitive and occurs via a route distinct from normal endocytosis, as is the case for other PTDs.

Basic peptides derived from translocatory proteins, such as the Tat protein, the Antennapedia protein and VP22, and even many arginine-rich peptides, have been reported to have a membrane permeability and a carrier function for intracellular cargo delivery (reviewed in Futaki 2002; Leifert and Whitton 2003; Zhao and Weissleder 2004). These peptides are called protein transduction domains (PTDs). Like other translocatory proteins and PTDs derived from them, α-synuclein appears to pass through the cell membrane in an energy-independent, non-endocytic manner, at temperatures as low as 4°C. Unlike other translocatory proteins, however, α-synuclein does not appear to penetrate into the nucleus. Translocated α-synuclein is localized primarily in the cytoplasm, although it is not clear whether the internalized protein is localized in vesicles or in particular organelles at this stage. Furthermore, the amino acid sequence of the α-synuclein's PTD (STD) is distinct from those of other PTDs. No significant amino acid sequence homology exists between STD and other PTDs, but a common feature is that they are all basic peptides. STD is composed of 11-mer repeats that contain no arginine residues. Instead, each 11-mer repeat includes one or two lysine residues. Rather, the 11-mer repeats are structurally homologous to those found in apolipoproteins, but it is not known whether the apolipoproteins are actually able to tanslocate across cell membranes.

In summary, not only α-synuclein, but also β- and γ-synucleins can penetrate into live cells, and the 11-amino acid imperfect repeats of synuclein family members appear to play a critical role in the membrane translocation of these proteins. Fusion peptides containing the 11-amino acid imperfect repeats of α-synuclein (STD) can transverse the plasma membrane, and the membrane translocation efficiency is optimal when the peptide contains two repeat motifs. Internalization of α-synuclein is temperature insensitive and occurs very rapidly via a route distinct from normal endocytosis. These features suggest that the synuclein proteins will create a useful model for analysing unconventional import and export pathways in mammalian cells. Furthermore, STD could be a potential carrier for the efficient delivery of peptides that do not permeate living cells.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We thank Dr R. Jakes (MRC, Cambridge, UK) for the recombinant DNA of α- and β-synucleins. This work was supported in part by a basic research grant (R01-2004-000-10673-0), and by a medical research center grant (R13-2002-054-02002-0) of the KOSEF.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • Abeliovich A., Schmitz Y., Farinas I. et al. (2000) Mice lacking α-synuclein display functional deficits in the nigrostriatal dopamine system. Neuron 25, 239252.
  • Borghi R., Marchese R., Negro A., Marinelli L., Forloni G., Zaccheo D., Abbruzzese G. and Tabaton M. (2000) Full-length α-synuclein is present in cerebrospinal fluid from Parkinson's disease and normal subjects. Neurosci. Lett. 287, 6567.
  • Bussel R. Jr and Eliezer D. (2003) A structural and functional role for 11-mer repeats in α-synuclein and other exchangeable lipid binding proteins. J. Mol. Biol. 329, 763778.
  • Chandra S., Chen X., Rizo J., Jahn R. and Sudhof T. C. (2003) A broken alpha-helix in folded alpha-synuclein. J. Biol. Chem. 278, 1531315318.
  • Clayton D. F. and George J. M. (1998) The synucleins: a family of proteins involved in synaptic function, plasticity, neurodegeneration and disease. Trends Neurosci. 21, 249254.
  • Cole N. B., Murphy D. D., Grider T., Ruter S., Brasaemle D. and Nussbaum R. I. (2002) Lipid droplet binding and oligomerization properties of the Parkinson's disease protein α-synuclein. J. Biol. Chem. 277, 63446352.
  • Da Costa C. A., Ancolio K. and Checler F. (2000) Wild-type but not Parkinson's disease-related ala-53 [RIGHTWARDS ARROW] Thr mutant α-synuclein protects neuronal cells from apoptotic stimuli. J. Biol. Chem. 275, 2406524069.
  • Davidson W. S., Jonas A., Clayton D. F. and George J. M. (1998) Stabilization of α-synuclein secondary structure upon binding to synthetic membranes. J. Biol. Chem. 273, 94439449.
  • Ding T. T., Lee S. J., Rochet J. C. and Lansbury, P. T. Jr (2002) Annular α-synuclein protofibrils are produced when spherical protofibrils are incubated in solution or bound to brain-derived membranes. Biochemistry 41, 1020910207.
  • Dixon C., Mathias N., Zweig R. M., Davis D. A. and Gross D. S. (2005) α-Synuclein targets the plasma membrane via the secretory pathway and induces toxicity in yeast. Genetics 170, 4759.
  • El-Aganaf O. M., Salem S. A., Paleologou K. E. et al. (2003) α-Synuclein implicated in Parkinson's disease is present in extracellular biological fluids, including human plasma. FASEB J. 17, 19451947.
  • El-Agnaf O. M., Jakes R., Curran M. D., Middleton D., Ingenito R., Bianchi E., Pessi A., Neill D. and Wallace A. (1998) Aggregates from mutant and wild-type α-synuclein proteins and NAC peptide induce apoptotic cell death in human neuroblastoma cells by formation of β-sheet and amyloid-like filaments. FEBS Lett. 440, 7175.
  • Elliott G. and O'Hare P. (1997) Intercellular trafficking and protein delivery by a herpes virus structural protein. Cell 88, 223233.
  • Ericksen J. L., Dawson T. M., Dickson D. W. and Petrucelli L. (2003) Caught in the act: α-synuclein is the culprit in Parkinson's disease. Neuron 40, 453456.
  • Forloni G., Bertani I., Calella A. M., Thaler F. and Invernizzi R. (2004) α-Synuclein and Parkinson's disease: selective neurodegenerative effect of α-synuclein fragment on dopaminergic neurons in vitro and in vivo. Ann. Neurol. 47, 632640.
  • Fortin D. L., Troyer M. D., Nakamura K., Kubo S., Anthony M. D. and Edwards R. H. (2004) Lipid rafts mediate the synaptic localization of α-synuclein. J. Neurosci. 24, 67156723.
  • Futaki S. (2002) Arginine-rich peptides: potential for intracellular delivery of macromolecules and the mystery of the translocation mechanisms. Int. J. Pharm. 245, 17.
  • George J. M., Jin H., Woods W. S. and Clayton D. F. (1995) Characterization of a novel protein regulated during the critical period for song learning in the zebra finch. Neuron 2, 361372.
  • Hashimoto M. and Masliah E. (1999) α-Synuclein in Lewy body disease and Alzheimer's disease. Brain Pathol. 9, 707720.
  • Hashimoto M., Yoshimoto M., Sisk A., Hsu L. J., Sundsmo M., Kittel A., Saitoh T., Miller A. and Masliah E. (1997) NACP, a synaptic protein involved in Alzheimer's disease, is differentially regulated during megakaryocyte differentiation. Biochem. Biophys. Res. Commun. 237, 611616.
  • Hsu L. J., Sagara Y., Arroyo A., Rockenstein E., Sisk A., Mallory M., Wong J., Takenouchi T., Hashimoto M. and Masliah E. (2000) α-Synuclein promotes mitochondrial deficit and oxidative stress. Am. J. Pathol. 157, 401410.
  • Irizarry M. C., Kim T. W., McNamara M., Tanzi R. E., George J. M., Clayton D. F. and Hyman B. T. (1996) Characterization of the precursor protein of the non-Aβ component of senile plaques (NACP) in the human central nervous system. J. Neuropathol. Exp. Neurol. 55, 889895.
  • Iwai A. (2000) Properties of NACP/α-synuclein and its role in Alzheimer's disease. Biochim. Biophys. Acta. 1502, 95109.
  • Jakes R., Spillantini M. G. and Goedert M. (1994) Identification of two distinct synucleins from human brain. FEBS Lett. 345, 2732.
  • Jao C. C., Der-Sarkissian A., Chen J. and Langen R. (2004) Structure of membrane-bound α-synuclein studied by site-directed spin labeling. Proc. Natl Acad. Sci. USA 101, 83318336.
  • Jensen P. H., Nielsen M. S., Jakes R., Dotti C. G. and Goedert M. (1998) Binding of α-synuclein to brain vesicles is abolished by familial Parkinson's disease mutation. J. Biol. Chem. 273, 2629226294.
  • Ji H., Liu Y. E., Jia T., Wang M., Liu J., Xiao G., Joseph B. K., Rosen C. and Shi Y. E. (1997) Identification of a breast cancer-specific gene, BCSG1, by direct differential cDNA sequencing. Cancer Res. 57, 759764.
  • Jo E., McLaurin J., Yip C. M., St. George-Hyslop P. and Fraser P. E. (2000) α-Synuclein membrane interactions and lipid specificity. J. Biol. Chem. 275, 3432834334.
  • Kholodilov N. G., Neystat M., Oo T. F., Lo S. E., Larsen K. E., Sulzer D. and Burke R. E. (1999) Increased expression of rat synuclein in the substantia nigra pars compacta identified by mRNA differential display in a model of developmental target injury. J. Neurochem. 73, 25862599.
  • Kuchler K. (1993) Unusual routes of protein secretion: the easy way out. Trends Cell. Biol. 3, 421426.
  • Lavedan C. (1998) The synuclein family. Genome Res. 8, 871880.
  • Lee H. J., Patel S. and Lee S. J. (2005) A broken α-helix in folded α-synuclein. J. Neurosci. 25, 60166024.
  • Leifert J. A. and Whitton J. L. (2003) ‘Translocatory proteins’ and ‘protein transduction domains’: a critical analysis of their biological effects and the underlying mechanisms. Mol. Ther. 8, 1320.
  • Lippincott Schwartz J., Donaldson J. G., Schweizer A., Berger E. G., Hauri H. P., Yuan L. C. and Klausner R. D. (1990) Microtubule-dependent retrograde transport of proteins into the ER in the presence of brefeldin A suggests an ER recycling pathway. Cell 60, 821836.
  • Lücking C. B. and Brice A. (2000) α-Synuclein and Parkinson's disease. Cell Mol. Life Sci. 57, 18941908.
  • Maroteaux L., Campanelli J. T. and Scheller R. H. (1988) Synuclein: a neuron-specific protein localized to the nucleus and presynaptic nerve terminal. J. Neurosci. 8, 28042815.
  • McLean P. J., Kawamata H., Ribich S. and Hyman B. T. (2000) Membrane association and protein conformation of α-synuclein in intact neurons. Effect of Parkinson's disease-linked mutations. J. Biol. Chem. 275, 88128816.
  • Miller D. W., Hague S. M., Clarimon J., Baptista M., Gwinn-Hardy K., Cookson M. R. and Singleton A. B. (2004) α-Synuclein in blood and brain from familial Parkinson disease with SNCA locus triplication. Neurology 62, 18351838.
  • Nickel W. (2003) The mystery of non-classical protein secretion. A current view on cargo proteins and potential export routes. Eur. J. Biochem. 270, 21092119.
  • Park S. M., Jung H. Y., Kim H. O., Paik S. R., Chung K. C. and Kim J. (2002) Evidence that α-synuclein functions as a negative regulator of Ca2+-dependent α-granule release from human platelets. Blood 100, 25062514.
  • Pastan I. H. and Willingham M. C. (1981) Journey to the center of the cell: role of the receptosome. Science 14, 504509.
  • Perrin R. J., Woods W. S., Clayton D. F. and George J. M. (2000) Interaction of human α-Synuclein and Parkinson's disease variants with phospholipids. Structural analysis using site-directed mutagenesis. J. Biol. Chem. 275, 3439334398.
  • Van Der Putten H., Wiederhold K. H., Probst A. et al. (2000) Neuropathology in mice expressing human α-synuclein. J. Neurosci. 20, 60216029.
  • Rajagopalan S. and Andersen J. K. (2001) α-Synuclein aggregation: is it the toxic gain of function responsible for neurodegeneration in Parkinson's disease? Mech. Ageing Dev. 122, 14991510.
  • Saha A. R., Ninkina N. N., Hanger D. P., Anderton B. H., Davies A. M. and Buchman V. L. (2000) Induction of neuronal death by α-synuclein. Eur. J. Neurosci. 12, 30733077.
  • Scherzer C. R., Jensen R. V., Gullans S. R. and Feany M. B. (2003) Gene expression changes presage neurodegeneration in a Drosophila model of Parkinson's disease. Hum. Mol. Genet. 12, 24572466.
  • Segrest J. P., De Loof H., Dohlman J. G., Brouillette C. G. and Anantharamaiah G. M. (1990) Amphipathic helix motif: classes and properties. Proteins 8, 103117.
  • Segrest J. P., Jones M. K., De Loof H., Brouillette C. G., Venkatachalapathi Y. V. and Anantharamaiah G. M. (1992) The amphipathic helix in the exchangeable apolipoproteins: a review of secondary structure and function. J. Lipid Res. 33, 141166.
  • Shin E. C., Cho S. E., Lee D. K., Hur M. W., Paik S. R., Park J. H. and Kim J. (2000) Expression patterns of α-synuclein in human hematopoietic cells and in Drosophila at different developmental stages. Mol. Cells 10, 6570.
  • Spillantini M. G., Schmidt M. L., Lee V. M., Trojanowski J. Q., Jakes R. and Goedert M. (1997) α-Synuclein in Lewy bodies. Nature 388, 839840.
  • Spillantini M. G., Crowther R. A., Jakes R., Hasegawa M. and Goedert M. (1998) α-Synuclein in filamentous inclusions of Lewy bodies from Parkinson's disease and dementia with lewy bodies. Proc. Natl Acad. Sci. USA 95, 64696473.
  • Stefanis L., Kholodilov N., Rideout H. J., Burke R. E. and Greene L. A. (2001) Synuclein-1 is selectively up-regulated in response to nerve growth factor treatment in PC12 cells. J. Neurochem. 76, 11651176.
  • Sung J. Y., Kim J., Paik S. R. et al. (2001) Induction of neuronal cell death by Rab5A-dependent endocytosis of α-synuclein. J. Biol. Chem. 276, 2744127448.
  • Sung J. Y., Park S. M., Lee C. H., Um J. W., Lee H. J., Kim J., Oh Y. J., Lee S. T., Paik S. R. and Chung K. C. (2005) Proteolytic cleavage of extracellular secreted α-synuclein via matrix metalloproteinases. J. Biol. Chem. 280, 2521625224.
  • Takeda A., Mallory M., Sundsmo M., Honer W., Hansen L. and Masliah E. (1998) Abnormal accumulation of NACP/α-synuclein in neurodegenerative disorders. Am. J. Pathol. 152, 367372.
  • Ueda K., Fukushima H., Masliah E., Xia Y., Iwai A., Yoshimoto M., Otero D. A., Kondo J., Ihara Y. and Saitoh T. (1993) Molecular cloning of cDNA encoding an unrecognized component of amyloid in Alzheimer disease. Proc. Natl Acad. Sci. USA 90, 1128211286.
  • Wakabayashi K., Yoshimoto M., Tsuji S. and Takahashi H. (1998) α-Synuclein immunoreactivity in glial cytoplasmic inclusions in multiple system atrophy. Neurosci. Lett. 249, 180182.
  • Willingham S., Outeiro T. F., DeVit M. J., Lindquist S. L. and Muchowski P. J. (2003) Yeast genes that enhance the toxicity of a mutant huntingtin fragment or α-synuclein. Science 302, 17691772.
  • Zhao M. and Weissleder R. (2004) Intracellular cargo delivery using tat peptide and derivatives. Med. Res. Rev. 24, 112.