• endoplasmic reticulum stress response;
  • endoplasmic reticulum stress response element;
  • WFS1;
  • XBP1


  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

XBP1 is a key transcription factor in the endoplasmic reticulum (ER) stress response pathway. In a previous study, we suggested a possible link between XBP1 and bipolar disorder, but its role in neuronal cells has not yet been clarified. Here we examined the target genes of XBP1, using DNA microarray analysis in SH-SY5Y cells transfected with an XBP1-expressing vector. Among the genes up-regulated by XBP1, the most significant p-value was observed for WFS1, which is an ER stress response-related gene. Examining the promoter region of WFS1, we found a conserved sequence (CGAGGCGCACCGTGATTGG) that is highly similar to the ER stress response element (ERSE). A promoter assay showed that this ERSE-like motif is critical for the regulation of WFS1 by XBP1. An electrophoretic mobility shift assay suggested that XBP1 does not directly bind to this sequence. Our results demonstrate that WFS1 is one of the target genes of XBP1 in SH-SY5Y cells.

Abbreviations used

Dulbecco's modified Eagle's medium


electrophoretic mobility shift assay


endoplasmic reticulum


endoplasmic reticulum stress response element




fetal bovine serum


mouse embryonic fibroblast


minor groove binder


nutrient-sensing response element


robust multiarray average


spliced-form XBP1


unfolded protein response

The endoplasmic reticulum (ER) is responsible for protein folding within each cell. When unfolded proteins accumulate in the ER, the ER stress response begins. The ER stress response consists of four signaling cascades: (i) induction of ER chaperones such as HSPA5 (GRP78/BiP), which promotes the folding of unfolded proteins (unfolded protein response, UPR); (ii) inhibition of protein synthesis; (iii) induction of the ER-associated degradation pathway; and (iv) induction of apoptosis (Yoshida 2004; Schroder and Kaufman 2005). The UPR begins when HSPA5 proteins are used to fold unfolded proteins. Dissociation of HSPA5 from ATF6 protein on the ER membrane causes cleavage of ATF6, and cleaved ATF6 protein induces the expression of ER chaperones and XBP1. In parallel, dissociation of HSPA5 from IRE1 protein on the ER membrane causes dimerization of IRE1, which splices XBP1 mRNA. The spliced XBP1 mRNA encodes an active form of XBP1 that strongly induces the expression of target genes such as ER chaperones (Yoshida 2004).

We previously showed, by DNA microarray analysis, that XBP1 and HSPA5 are down-regulated in the lymphoblastoid cells of monozygotic twins with bipolar disorder, compared with healthy co-twins (Kakiuchi et al. 2003). However, the role of the ER stress response pathway in the brain has not yet been clarified, except for the possible role of the UPR in the modulation of glutamate receptor trafficking (Shim et al. 2004; Vandenberghe et al. 2005).

To clarify the role of XBP1 in neuronal cells, we investigated the target genes of XBP1 in SH-SY5Y cells. First, we performed DNA microarray analysis in SH-SY5Y cells transfected with an XBP1-expressing vector, and we identified WFS1 as the most up-regulated gene. Next, we found an ER stress response element (ERSE)-like sequence in the promoter region of WFS1. We further searched for ERSE-like sequences in the genes altered by XBP1 overexpression, and found that the gene for glycine cleavage system H protein (GCSH) is another candidate gene with an ERSE-like sequence in its upstream region. We confirmed by a promoter assay that this sequence is critical for the response of WFS1 to XBP1 overexpression. However, XBP1 did not directly bind to the ERSE-like sequence in a gel-shift assay. Our results demonstrate that WFS1 has an ERSE-like sequence in its promoter and XBP1 regulates WFS1 expression indirectly through this motif.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Cell culture

We cultured SH-SY5Y cells in Dulbecco's modified Eagle's medium (DMEM) (Sigma, St Louis, Missouri, USA) containing 10% fetal bovine serum (FBS). Mouse embryonic fibroblasts (MEFs) were generated from embryos of female heterozygous XBP1 knockout mice (XBP1+/–) (Reimold et al. 2000) (kindly provided by Dr Laurie H. Glimcher, Harvard School of Public Health, Boston, MA, USA) mated with male XBP1+/– mice according to the methods described previously (Bruning et al. 1997), including a 3T3 protocol (Todaro and Green 1963). Embryos were dissected around embryonic day 12.5 and cultured in DMEM containing 10% FBS for more than 20 passages. All of the cells were cultured in an atmosphere of 5% CO2 at 37°C.

Sample preparation for DNA microarray

Spliced human XBP1 cDNA was amplified by PCR and cloned into the BamHI/HindIII site of a pcDNA3.1 vector (Invitrogen, San Diego, CA, USA). We transfected SH-SY5Y cells cultured in a 10-cm dish with 10 µg spliced XBP1-expressing vector (n = 5) or control vector (n = 5) using Superfect (Qiagen, Valencia, CA, USA). After incubation for 48 h, cells were collected into TRIZOL reagents (Invitrogen) until use. Overexpression of spliced XBP1 was confirmed by real-time quantitative PCR.

DNA microarray

DNA microarray experiments were performed as described previously using an Affymetrix HU133A chip (Affymetrix, Santa Clara, CA, USA) (Iwamoto et al. 2004). In brief, we used 5 µg total RNA for RT into cDNA. Biotin-labeled cRNA was synthesized from cDNA by in vitro transcription. Fragmented cRNA was first applied to the Test2Chip (Affymetrix) to test the integrity of the sample, and then applied to the HU133A chip. The hybridization signal on the chip was scanned and subjected to image analysis (Affymetrix).

Microarray data analysis

The microarray raw data were processed by MAS5 (Affymetrix) and analyzed using GeneSpring software (SiliconGenetics, Redwood, CA, USA). Data were normalized by the median value. Raw data were also analyzed by the robust multiarray average (RMA) method (Irizarry et al. 2003), which was implemented in the module Affy of Bioconductor microarray analysis software (

Bioinformatic analyses

The promoter regions of WFS1 species were compared among species and the results of this comparison can be seen on the UCSC genome browser web site ( We did a search for three ERSE-like sequences – ERSE (CCAAT-N9-CCACG), a CHOP variant of ERSE (CCAAT-N(9)-GCACG) (Ubeda and Habener 2000), and a WFS1 variant of ERSE (CCAAT-N(9)-CCTCG) (this study) – within the whole human genome sequence using the NCBI 35 assembly ( = 9606&build = 35, June 2004). Next, we determined whether or not other genes altered by XBP1 expression contain the ERSEs by examining the genomic region from the − 9-kb upstream region of exon 1 to the −2-kb downstream region of the last exon. The transcription start site and the 3′-end of the transcript was based on Ensembl v34 (

Real-time quantitative PCR

To quantify mRNA levels of spliced-form XBP1 (sXBP1) and WFS1 genes in the transfected SH-SY5Y cells, we used real-time quantitative PCR with Taqman chemistry [sXBP1 and GAPDH as an inner control; probes were labeled with 6-carboxy-fluorescein (FAM) and quenched by minor groove binder (MGB)] or Sybr/Green I dye (WFS1) according to the manufacturer's protocol (Applied Biosystems, Foster City, CA, USA). Single-strand cDNA was synthesized using oligo (dT) primer and SuperScript II reverse transcriptase (Invitrogen). For quantitative PCR, ABI7900HT (Applied Biosystems) was used. The PCR reaction was carried out as described previously and the relative ratios of sXBP1 and WFS1 to GAPDH were calculated (Kakiuchi et al. 2005). Primers (and probes) for quantitative RT–PCR were as follows: WFS1, 5′-ACCTGGTCGTCCTCAATGTC and 5′-CATGAAGCACACCAGGTAGG; sXBP1, 5′-GGTCCAAGTTGTCCAGAATGC, 5′-GCCAGTGGCCGGGTCT and 5′-FAM-CCTGCACCTGCTGCGGACTCAGC-MGB. A primer and probe mixture of GAPDH was obtained from Assay-on-Demand products (Applied Biosystems).

Promoter assay

We amplified each fragment of the promoter region of WFS1 by PCR and cloned it into the Mlu1/BglII site of the pGL3-Basic vector (Promega, Madison, WI, USA). We transfected SH-SY5Y cells cultured in a 96-well plate (4 × 104 cells per well) with 0.6 µg DNA containing 0.25 µg reporter plasmid, 0.25 µg pcDNA3.1 vector with or without the insert of spliced XBP1, and 0.1 µg reference plasmid (pRL-CMV) (Promega) using SuperFect reagent (Qiagen). After a 48-h incubation, we measured luciferase activities using the Dual-Glo Luciferase assay system (Promega). The assay was performed independently three times.

Electrophoretic mobility shift assay (EMSA)

Electrophoretic mobility shift assays (EMSAs) were performed using the Light Shift Chemiluminescent EMSA Kit (Pierce, Rockford, IL, USA) according to the protocol recommended by the manufacturer. SH-SY5Y cells were transfected with vector expressing c-myc-tagged sXBP1 and treated with 10 µm MG-132 (Sigma) for 2 h followed by nuclear extraction. For the supershift assay, nuclear extracts were prepared using low-salt lysis buffer (buffer A) and high-salt extraction buffer (buffer C) containing the protease inhibitor cocktail CompleteTM (Roche, Mannheim, Germany). High-salt crude nuclear extracts were desalted into EMSA buffer as described previously (Sevinsky et al. 2004) except for the use of CompleteTM and a ZebaTM Micro Spin Column (Pierce). The probe was biotin-labeled, double-stranded DNA containing nucleotides −147 to − 96. We incubated 20 fmol biotin-labeled double-stranded DNA with 4 µg nuclear extract in EMSA buffer in a final volume of 20 µL. Binding competition was performed using a 200-fold excess of unlabeled oligonucleotides. A supershift assay was performed using 2 µg anti-c-myc antibody (A-14; Santa Cruz Biotechnology, Santa Cruz, CA, USA.). EMSAs were also performed using 6 µg nuclear extracts of XBP1+/+ MEFs and XBP1–/– MEFs.


  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

WFS1 is induced by overexpression of XBP1

To identify the target genes of XBP1, we performed gene expression analysis using DNA microarray in SH-SY5Y cells transfected with sXBP1-expressing vector (n = 5) and control vector (n = 5). Putative XBP1-regulated genes were selected by the following criteria: (1) called as present in all samples and (2) parametric test showed significant difference (p < 0.05) between two groups by both normalization methods (MAS5.0 and RMA). As a result, 50 up-regulated genes and 154 down-regulated genes were selected among 9849 genes that were present. This list included Erdj4 (DNAJB9), which has been shown to be regulated mainly by XBP1 (Lee et al. 2003; Kanemoto et al. 2005). Among the genes listed, the highest p-value was observed for WFS1 (NM_006005) (Table 1), and we focused on the effects of XBP1 on WFS1 expression in the following analyses. The difference in WFS1 mRNA levels between sXBP1 overexpression and control was confirmed by real-time quantitative PCR (control vector, mean ± SEM 0.00772 ± 0.00023; sXBP1-expressing vector, 0.0127 ± 0.00089; p = 0.00063, t-test) (Fig. 1). In a similar experiment (n = 3), we independently confirmed that the overexpression of sXBP1 induced the expression of WFS1 (control vector, 0.00990 ± 0.000475; sXBP1-expressing vector, 0.01675 ± 0.000936; p = 0.00284, t-test).

Table 1.  Genes altered by overexpression of XBP1
Probe IDMASAffySymbolMapGenbank
ControlsXBP1 p-valueControlsXBP1 p-value
  1. The genes were sorted according to the p-value calculated from the normalized data by MAS 5.0.

202908_at1.382.134.12E-051.131.540.00695 WFS1 4p16 NM_006005
635_s_at1.431.780.0006381.501.660.0477PPP2R5B11q12-q13 L42374
203411_s_at4.236.820.001034.265.400.00524LMNA1q21.2-q21.3 NM_005572
221728_x_at22.4428.930.0017316.1218.160.0429 AA628440
208735_s_at2.503.490.001822.522.680.0417CTDSP212q13-q15 AF022231
212052_s_at3.895.260.002032.833.310.00149KIAA06765q35.3 AB014576
60528_at2.613.330.002522.082.480.0243PLA2G4B15q11.2-q21.3 N71116
211051_s_at0.931.190.002610.800.920.0489EXTL38p21 BC006363
36475_at2.523.370.002712.743.110.0115GCAT22q13.1 Z97630
214726_x_at4.715.460.00343.153.470.00386ADD14p16.3 AL556041
203857_s_at2.753.610.003731.682.180.00105PDIA53q21.1 NM_006810
213144_at2.904.130.004862.713.150.0427GOSR217q21 AI074611
214951_at0.781.040.004970.630.700.0487SLC26A1012q13 AL050358
213242_x_at2.133.000.005482.422.640.0351 AB006622
214383_x_at9.9115.440.006047.929.650.0338KLHDC36p21.1 BF063121
209325_s_at1.341.950.006871.441.710.00117RGS161q25-q31 U94829
218012_at2.043.650.007042.143.180.00128TSPYL2Xp11.2 NM_022117
36084_at3.955.060.00714.314.870.0435CUL76p21.1 D38548
213378_s_at3.424.560.007732.232.930.00221DDX1112p11 AI983033
203254_s_at1.862.690.007741.701.920.014TLN19p13 NM_006289
202418_at6.398.280.008733.864.400.00709YIF111q13 NM_020470
219390_at1.872.640.009081.001.210.0111FKBP147p15.1 NM_017946
218140_x_at9.1011.700.01145.787.320.000242SRPRB3q22.1 NM_021203
201469_s_at5.276.990.01213.654.680.000432SHC11q21 AI809967
214196_s_at1.161.520.01290.600.760.0333TPP111p15 AA602532
218058_at4.876.570.01384.855.780.02CXXC118q12 NM_014593
217888_s_at2.743.460.01391.962.430.00386ARFGAP120q13.33 NM_018209
202842_s_at7.239.090.01433.454.340.0189 DNAJB9 7q31|14q24.2-q24.3 AL080081
209607_x_at3.916.020.01522.893.710.0308SULT1A316p11.2 U08032
210616_s_at17.6122.560.017913.3415.480.00793SEC31L14q21.3 AB020712
210580_x_at4.666.450.01843.584.770.0248SULT1A316p11.2 L25275
201894_s_at5.636.720.01852.763.220.0423SSR16p24.3 NM_001920
203602_s_at2.803.310.01912.112.280.0421ZBTB171p36.2-p36.1 NM_003443
204017_at0.921.330.02120.610.810.0204KDELR322q13.1 NM_006855
632_at4.094.870.02162.953.220.0469GSK3A19q13.2 L40027
217861_s_at4.505.920.02343.924.760.00862PREB2p23.3 NM_013388
201082_s_at4.966.430.02372.913.640.017DCTN12p13 NM_004082
202722_s_at2.603.050.02371.501.790.0135GFPT12p13 NM_002056
200917_s_at2.143.180.0242.403.010.0168SRPR11q24.3 BG474541
212041_at12.0215.350.02488.4810.100.0181ATP6V0D116q22 AL566172
203648_at4.875.810.02513.664.120.0332TATDN23p25.3 NM_014760
65086_at2.042.640.02843.053.390.0459MGC326219p13.2 Z78349
216483_s_at4.735.850.03133.904.560.0377C19orf1019p13.3 AC005339
204382_at3.614.270.03233.503.940.0275EBSP17q25.1 NM_015654
216484_x_at17.2720.460.034110.5611.450.0452HDGF1q21-q23 L24521
65635_at3.313.800.04114.895.470.00597FLJ2186517q25.3 AL044097
200710_at3.935.530.04412.964.020.000234ACADVL17p13-p11 NM_000018
214969_at1.081.490.04490.951.120.0284MAP3K914q24.3-q31 AF251442
203827_at0.680.910.04690.320.370.00867WIPI4917q24.2 NM_017983
200825_s_at15.9020.220.048211.6314.750.000148HYOU111q23.1-q23.3 NM_006389
41386_i_at7.914.710.0001695.964.820.00104JMJD317p13.1 AB002344
214317_x_at71.1132.660.00033738.4736.540.0339RPS919q13.4 BE348997
201944_at6.784.960.0003533.122.540.0251HEXB5q13 NM_000521
212702_s_at3.422.110.0005482.662.200.0289BICD29q22.31 N45111
202963_at6.864.390.0005893.943.420.0417RFX51q21 AW027312
201487_at9.065.180.0006045.504.410.00736CTSC11q14.1-q14.3 NM_001814
202195_s_at1.691.050.0006070.760.600.0098TMED51pter-q31.3 NM_016040
210361_s_at1.891.300.0006471.020.820.0185ELF24q28 AF256223
218200_s_at65.9444.790.00079935.3831.070.0226NDUFB27q34 NM_004546
204285_s_at6.184.230.001093.993.070.0306PMAIP118q21.32 AI857639
201339_s_at5.394.060.001283.112.600.043SCP21p32 NM_002979
204529_s_at3.633.000.001372.121.760.00412TOX8q12.1 AI961231
220768_s_at7.174.800.001425.063.730.0129CSNK1G35q23 NM_004384
202278_s_at3.893.010.001572.261.990.0224SPTLC19q22.2 NM_006415
208456_s_at2.231.770.001871.140.940.0447RRAS211p15.2 NM_012250
204720_s_at9.457.080.001947.195.400.0115DNAJC61pter-q31.3 AV729634
202693_s_at2.842.170.002281.751.380.000314STK17A7p12-p14 AW194730
201260_s_at2.731.970.002371.661.440.00573SYPL7q22.3 NM_006754
208016_s_at5.923.590.002913.122.650.0279AGTR13q21-q25 NM_004835
203962_s_at2.341.670.003081.200.990.0394NEBL10p12 NM_006393
221047_s_at3.942.990.003132.712.340.0111MARK11q41 NM_018650
204053_x_at19.2116.120.0037110.879.480.00737PTEN10q23.3 U96180
212589_at2.902.240.004062.171.730.0121SCP21p32 AI753792
200750_s_at70.4154.890.0042141.7933.290.0162RAN12q24.3 AF054183
212560_at1.501.070.004470.590.500.0397C11orf32 AV728268
203613_s_at20.8216.410.0045514.4212.280.0141NDUFB69p21.1 NM_002493
201580_s_at5.414.420.005384.253.850.0101DJ971N18.220p12 AL544094
211025_x_at35.5028.350.0053822.6420.130.00104COX5B2cen-q13 BC006229
221726_at35.4130.000.0057122.2319.440.0432RPL221p36.3-p36.2 BE250348
212744_at2.261.400.005731.201.020.0168BBS415q22.3-q23 AI813772
201773_at18.8113.050.0057511.619.200.0169ADNP20q13.13 NM_015339
221763_at2.802.220.006361.421.250.0485JMJD1C10q21.3 AI694023
201142_at7.816.620.006454.734.360.0365EIF2S114q23.3 AA577698
218313_s_at5.354.350.006653.252.840.0106GALNT74q31.1 NM_017423
207467_x_at3.422.580.006872.502.200.034CAST5q15-q21 NM_001750
201242_s_at23.7418.850.00712.979.950.0346ATP1B11q24 BC000006
212244_at5.053.900.007263.633.220.0108GRINL1A15q22.1 AL050091
203493_s_at1.741.150.007430.940.750.0339PIG811q21 AL525206
216511_s_at1.841.430.007680.860.740.0104TCF7L210q25.3 AJ270770
222237_s_at2.091.460.007771.391.220.00743ZNF22819q13.2 AC084239
202078_at15.2412.170.0091212.4410.140.0245COPS317p11.2 NM_003653
200821_at1.040.690.009240.300.270.0189LAMP2Xq24 NM_013995
212200_at1.871.400.009590.690.600.0432KIAA069212q24.33 AK025933
201385_at38.1124.540.010527.8524.610.00227DHX154p15.3 NM_001358
208923_at23.5020.920.010517.5616.070.0391CYFIP115q11 BC005097
202172_at6.835.290.01064.283.750.0232ZNF16117q23.2 BG035116
219863_at3.352.810.01071.681.470.00993HERC54q22.1-q23 NM_016323
212476_at1.451.020.01090.620.470.0182CENTB23q29 D26069
202429_s_at8.676.550.0116.685.650.00231PPP3CA4q21-q24 AL353950
202143_s_at12.2110.420.01127.946.940.0425COPS82q37.3 NM_006710
221208_s_at3.202.260.01151.601.210.0267FLJ2334211q24.2 NM_024631
205934_at1.230.860.01160.580.480.0134PLCL12q33 NM_006226
201146_at4.373.250.01192.742.370.0413NFE2L22q31 NM_006164
203075_at5.464.330.01192.682.140.00525SMAD218q21.1 AW151617
207974_s_at37.2422.950.011924.8518.320.0354SKP1A5q31 NM_006930
205329_s_at3.722.830.01232.431.920.0453SNX43q21.2 NM_003794
212459_x_at3.463.000.01282.111.820.0403SUCLG23p14.1 BF593940
200047_s_at12.4210.130.01297.676.100.0128YY114q NM_003403
202868_s_at7.696.480.01294.874.340.0362POP419q12 NM_006627
209300_s_at3.252.650.01292.021.770.0367NECAP112p13.31 BC002888
213129_s_at16.1011.450.01312.599.270.0206GCSH16q23.2 AI970157
205308_at4.303.400.01323.803.240.0162CGI-628q21.11 NM_016010
210532_s_at47.5037.380.013227.1823.610.0357C14orf214q32.33 AF116639
219200_at2.822.170.01322.081.580.0234MGC52975p15.3-p15.2 NM_024091
207164_s_at1.370.980.01360.470.420.00458ZNF238ss1q44-qter NM_006352
218320_s_at28.6522.610.013715.8914.330.0156NDUFB11Xp11.3 NM_019056
207654_x_at9.877.830.01396.215.280.0434 DR1 1p22.1 NM_001938
203376_at6.674.580.01434.193.730.0257CDC406q21 BG528818
206038_s_at1.050.800.01430.560.480.033NR2C23p25 NM_003298
221933_at2.531.620.01451.481.350.0118NLGN4XXp22.32-p22.31 AI338338
203917_at8.887.720.01466.325.410.00366CXADR21q21.1 NM_001338
212181_s_at6.034.870.01584.253.880.00455NUDT412q21 AF191654
218339_at6.135.130.01584.393.690.00542MRPL225q33.1-q33.3 NM_014180
204030_s_at7.986.580.01613.593.010.00732 SCHIP1 3q25.32-q25.33 NM_014575
221916_at13.808.150.01679.788.140.0427NEFL8p21 BF055311
211725_s_at10.488.890.01778.377.050.00908BID22q11.1 BC005884
202457_s_at7.306.420.01815.444.850.00333PPP3CA4q21-q24 AA911231
203216_s_at1.681.260.01810.890.650.0103MYO66q13 NM_004999
202393_s_at1.671.190.01820.520.420.0359KLF108q22.2 NM_005655
212230_at3.392.580.01822.381.810.00389PPAP2B1pter-p22.1 AV725664
213249_at5.694.500.01913.883.370.0112FBXL75p15.1 AU145127
218209_s_at7.835.460.01924.753.690.0365P15RS18q12.2 NM_018170
212229_s_at10.548.770.01946.595.360.0317FBXO2112q24.22 AK001699
209206_at1.731.440.01950.970.850.00979SEC22L11q21.2-q21.3 AV701283
215091_s_at26.0222.600.019714.0412.730.0242GTF3A13q12.3-q13.1 BE542815
219080_s_at2.181.600.01981.401.260.00437CTPS2Xp22 NM_019857
200730_s_at8.837.430.02015.204.390.0448PTP4A16q12 BF576710
218379_at4.043.100.02082.241.850.0222RBM711q23.1-q23.2 NM_016090
200914_x_at4.653.320.0212.451.630.0499KTN114q22.1 BF589024
201200_at4.093.190.02132.922.210.00333CREG11q24 NM_003851
210986_s_at15.0711.730.02168.306.320.006TPM115q22.1 Z24727
203593_at1.080.840.02220.270.240.0235CD2AP6p12 NM_012120
204435_at4.322.870.02242.221.610.0325NUPL113q12.13 NM_014778
208811_s_at5.434.050.02245.344.220.0041DNAJB67q36.3 AF080569
218549_s_at3.582.580.02252.181.810.041CGI-908q21.3 NM_016033
202352_s_at15.6113.620.02288.347.090.02PSMD1217q24.2 AI446530
213306_at4.913.210.02313.823.300.0242MPDZ9p24-p22 AA917899
204634_at1.691.340.02320.890.730.00523NEK43p21.1 NM_003157
212455_at16.8815.230.023810.539.000.0159YT5214q13.2 N36997
208742_s_at32.1728.120.024818.2016.950.0212SAP1813q12.11 U78303
218351_at2.111.510.02552.021.670.00284COMMD84p12 NM_017845
218055_s_at3.402.530.02612.472.210.0189WDR415q13.3 NM_018268
222273_at0.790.590.02640.290.250.0201 AI419423
205176_s_at12.2510.340.02658.747.050.0127ITGB3BP1p31.3 NM_014288
214101_s_at1.421.080.02720.640.510.0339NPEPPS17q21 BG153399
215321_at0.790.550.02780.510.430.0489RPIB97q21.12 AI825798
212446_s_at4.393.380.02932.592.100.023LASS62q24.3 AI658534
34764_at2.261.870.02931.181.040.0433LARS23p21.3 D21851
202202_s_at1.030.790.02940.680.580.0211LAMA46q21 NM_002290
201483_s_at22.6318.700.029615.0614.250.0351SUPT4H117q21-q23 BC002802
204353_s_at5.393.940.03033.242.660.022POT17q31.33 BC002923
202623_at6.004.850.03053.622.960.026C14orf1114q13.1 NM_018453
200096_s_at8.157.430.03155.374.570.0047ATP6V0E5q35.1 AI862255
204058_at1.140.870.03150.470.400.0166ME16q12 AL049699
208867_s_at5.684.440.03164.504.140.0466CSNK1A15q32 AF119911
216438_s_at33.1925.460.032412.3210.000.0185TMSB4X/// TMSL3Xq21.3-q22/// 4q22.1 AL133228
221702_s_at14.1711.110.032410.859.740.0218BLP215q26.3 AF353992
202651_at7.456.020.03264.053.210.0406LPGAT11p36.13-q42.3 NM_014873
204791_at3.032.560.03271.251.000.0161NR2C112q22 NM_003297
218698_at8.474.930.03274.093.410.0188MMRP1911p13 NM_015957
203131_at7.695.780.03424.173.630.0288PDGFRA4q11-q13 NM_006206
213883_s_at3.602.440.03452.401.890.012BBP1p31.3 AA012917
202001_s_at6.575.780.03525.904.950.0306NDUFA622q13.2-q13.31 NM_002490
204872_at7.075.020.03524.383.460.0399TLE49q21.31 NM_007005
204049_s_at2.401.640.03531.961.400.00427PHACTR26q24.2 NM_014721
205168_at6.305.510.03546.956.380.0366DDR21q12-q23 NM_006182
214431_at12.459.530.03627.966.250.00604GMPS3q24 NM_003875
209106_at6.455.110.03674.173.590.026NCOA12p23 BF576458
208693_s_at42.2235.220.03726.5923.450.0462GARS7p15 D30658
204246_s_at18.2515.770.037410.529.500.0373DCTN39p13 NM_007234
202241_at2.461.820.03751.781.520.0443TRIB18q24.13 NM_025195
203372_s_at2.852.360.03782.161.780.000286SOCS212q AB004903
213424_at1.090.600.03780.310.260.0453KIAA08957p14.1 AB020702
205656_at5.114.290.03792.972.510.0418PCDH1713q21.1 NM_014459
212507_at3.933.420.03873.042.500.0295RW12q11.2 D87446
213513_x_at11.419.510.03889.927.940.0105ARPC22q36.1 BG034239
202003_s_at9.227.110.039210.418.980.0405ACAA218q21.1 NM_006111
204516_at1.330.950.03930.990.830.0264ATXN73p21.1-p12 BG390306
207845_s_at1.611.170.03930.690.530.0215ANAPC104q31 NM_014885
202342_s_at3.402.890.04032.141.750.017TRIM24q31.3 NM_015271
222011_s_at4.093.530.04172.662.290.0374TCP16q25.3-q26 BF224073
203137_at10.398.680.04287.476.110.0393WTAP6q25-q27 NM_004906
57739_at3.122.350.04532.442.050.0442DND15q31.3 AI949010
207173_x_at3.442.780.04541.811.470.0351 CDH11 16q22.1 D21254
204675_at1.450.970.04560.700.540.0287SRD5A15p15 NM_001047
201498_at7.736.400.04575.524.720.0305USP716p13.3 AI160440
218718_at2.422.060.04571.351.050.0194PDGFC4q32 NM_016205
218611_at3.052.460.0461.521.270.0478IER51q25.3 NM_016545
205429_s_at2.632.100.04611.711.370.0267MPP67p15 NM_016447
203621_at26.1721.420.046416.9715.330.0359NDUFB53q26.33 NM_002492
202786_at8.086.720.04656.275.090.0141STK392q24.3 NM_013233
212077_at11.018.690.0486.885.910.0262CALD17q33 AL583520
218125_s_at2.311.810.04822.592.187.82E-05FLJ108538p21.1 NM_018246
217266_at4.042.860.04962.582.080.00307 RPL15/// LOC1363213p24.2/// 7q33 Z97353

Figure 1. Confirmation of DNA microarray results by quantitative real-time PCR. Induction of WFS1 by sXBP1 overexpression in SH-SY5Y cells was confirmed. The mRNA levels were normalized using GAPDH as the standard. *p = 0.00063 (t-test).

Download figure to PowerPoint

Identification of an ERSE-like sequence in the promoter region

We next examined the promoter region of the WFS1 gene and found several elements that might be responsible for its induction by XBP1 overexpression. A sequence that resembles nutrient-sensing response element-1 (NSRE-1; GGATGAAA) was found within nucleotides − 384 to − 377 (from the start codon) and NSRE-2 (GTTACA) was within nucleotides −340 to −335. An ERSE-like sequence (CGAGGCGCACCGTGATTGGCGG; similar to the consensus sequence of ERSE CCAAT-N(9)-CCACG) was identified within nucleotides −140 to −122. Interestingly, a 11-bp sequence of the ERSE-like sequence (GTGATTGGCGG) appeared downstream of the ERSE-like sequence (− 109 to − 99). Comparison of several mammalian genomes revealed that the ERSE-like sequence and the 11-bp repeated sequence on the WFS1 promoter are well conserved across species (Fig. 2).


Figure 2. Promoter region of WFS1. WFS1 has an ERSE-like element on its promoter (upper panel), which is highly conserved among mammals (lower panel). In addition to the ERSE-like sequence, a well-conserved 11-bp repeated sequence, which is the same as part of the ERSE-like element, was also found near the ERSE-like sequence.

Download figure to PowerPoint

Search for ERSE and its variants in other regulated genes

We examined whether other genes altered by XBP1 contain ERSE and its variants. Although 18 of 204 genes had ERSEs in their genomic region spanning from the − 9-kb upstream region of exon 1 to the − 2-kb downstream region of the last exon (Table 2), only two genes (WFS1 and GCSH) had ERSE-like sequences in their upstream region near the first exon. GCSH was one of the genes down-regulated by XBP1. Thus, WFS1 seems to be the only gene that is both induced by XBP1 and contains ERSE-like sequence in its upstream region.

Table 2.  ERSE and its variants found in the genes altered by overexpression of XBP1
MotifProbe IDSymbolSequenceLocation
212041_atATP6V0D1 CCAATATGGCAAAACCTCG5′-Flankingfrom -7210 to -7192
202908_atWFS1 CGAGGCGCACCGTGATTGG5′-Flankingfrom -140 to -122
213129_s_atGCSH CGAGGCAGGGTCTGATTGG5′-Flankingfrom -106 to -88
215321_atRPIB9 CGTGGATATAGTAAATTGG5′-Flankingfrom -8530 to -8512
219200_atMGC5297 CGTGGAGCCTTTGGATTGG5′-Flankingfrom -6727 to -6709
205176_s_atITGB3BP CGTGCCTTATTGACATTGG5′-Flankingfrom -7763 to -7745

ERSE-like sequence is critical for activation by XBP1

We characterized experimentally the promoter of WFS1. We used a luciferase assay system with or without the NSRE-1-, NSRE-2- and ERSE-like sequences, as well as the 11-bp repeated sequence. We transfected SH-SY5Y cells with reporter constructs containing the promoter fragment of interest, a reference vector, and an sXBP1-expressing vector or control vector. Co-transfection of sXBP1-expressing vector significantly enhanced the promoter activity only when an ERSE-like sequence was contained in the reporter plasmid (Fig. 3). The results clearly demonstrate that an ERSE-like sequence is critical for the response to sXBP1 overexpression. The 11-bp sequence did not seem to have a major role in XBP1-dependent induction of WFS1.


Figure 3. Promoter assay. (a) Mean ± SEM basal relative activities (ratio of firefly luciferase to that of Renilla) with or without sXBP1-expressing vector co-transfection. (b) The ratio (XBP1 Overexpression/Control) of the relative promoter activities of the upper data. The effect of co-transfection of the sXBP1-expressing vector was lost when the ERSE-like sequence was missing. Each of these experiments was repeated three times.

Download figure to PowerPoint

XBP1 does not bind to the ERSE-like sequence directly

We then examined, using EMSA, whether or not XBP1 protein binds directly to the ERSE-like sequence of the WFS1 promoter region. We incubated a biotin-labeled, double-stranded oligonucleotide probe containing nucleotides − 147 to − 96 (which includes an ERSE-like sequence) with a nuclear extract of cells transfected with c-myc-tagged sXBP1-expressing vector. When electrophoresed, a band shift appeared (Fig. 4a, lane 2). This band shift was almost completely inhibited by competition with a 200-fold excess of unlabeled oligonucleotides (lane 3). The supershift was not observed when anti-c-myc antibody was added (lane 4), although an immunoprecipitation assay showed a reaction of the antibody to myc-tagged XBP1 under the same condition. Thus, XBP1 may not bind directly to the ERSE-like sequence. We further performed an EMSA using XBP1–/– MEFs. A band shift was also observed in XBP1–/– MEFs (Fig. 4b, lane 4). However, the amount of shifted band from XBP1–/– MEFs was less than that from XBP1+/+ MEFs. This suggests that some transcription factor regulated by XBP1 binds to the ERSE-like sequence in the WFS1 promoter.


Figure 4. XBP1 does not bind to the ERSE-like sequence directly. (a) In an EMSA, a band shift was observed when probes and nuclear extracts were incubated together (lane 2) and this band shift was inhibited when a 200-fold excess of unlabeled probes was used (lane 3). We did not observe a supershift when using anti-c-myc antibody (lane 4). (b) In XBP1–/– MEFs, a band shift was observed (lane 4), although the amount of shifted band was less than that seen in XBP1+/+ MEFs (lane 2).

Download figure to PowerPoint


  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We demonstrated in this report that WFS1 expression is regulated by XBP1 through an ERSE-like sequence, not by binding directly.

The ERSE is observed in ER chaperones (GRP78, GRP94, calreticulin), as well as CHOP and XBP1 (Yoshida et al. 1998, 2001; Ubeda and Habener 2000). Although the consensus sequence of ERSE is CCAAT-N9-CCACG, its variant, CCAAT-N9-GCACG, is also reported to be functional in the CHOP gene. The ERSE-like sequence of WFS1 may also be another variant of ERSE. Recently, WFS1 was reported to be induced by ER stressors such as thapsigargin and dithiothreitol in pancreatic islets (Yamaguchi et al. 2004; Ueda et al. 2005). This previously reported induction via transcriptional activation might be through this ERSE sequence.

In addition to the ERSE of WFS1, a 11-bp sequence including CCAAT near the ERSE is also highly conserved in mammals. Although we could not observe the effect of sXBP1-dependent promoter activity, it cannot be ruled out that this element enhances the promoter activity of the ERSE-like sequence.

Several ERSE-binding proteins have been reported, such as ATF6, NF-Y, YY1 and TFII-I (Yoshida et al. 1998, 2000; Li et al. 2000; Parker et al. 2001). Of these, expression of the gene for YY1 was significantly altered, but it was down-regulated. None of these was found to be up-regulated by XBP1. XBP1 itself is also known to bind to ERSE in the presence of NF-Y (Yoshida et al. 1998; Yamamoto et al. 2004). However, anti-c-myc antibody did not cause a supershift in the EMSA, and nuclear extracts from XBP1–/– MEFs could also cause a band shift. These findings suggest that XBP1 does not directly bind to the ERSE-like sequence of WFS1. The amount of shifted band was smaller in XBP1–/– MEFs, suggesting that some transcription factor regulated by XBP1 binds to the ERSE-like sequence on the WFS1 promoter.

WFS1 was initially identified as a causative gene for Wolfram disease (Inoue et al. 1998; Strom et al. 1998; Hardy et al. 1999). Wolfram disease (OMIM in NCBI website 222300) is a rare autosomal-recessive disorder characterized by diabetes insipidus, diabetes mellitus, optic atrophy and deafness. Swift and colleagues reported that about 60% of altered individuals have some mental disturbance, such as severe depression, psychosis or organic brain syndrome, as well as impulsive verbal and physical aggression (Swift et al. 1990). They further reported that even the heterozygotes who do not have Wolfram disease are 26 times more likely than non-carriers to have a psychiatric hospitalization, mainly because of severe depression (Swift and Swift 2000). WFS1 protein predominantly localizes to ER (Takeda et al. 2001), and induces cation channel activity on the ER membrane (Osman et al. 2003). However, its molecular function is still not well characterized. Our results, as well as those in two other recent reports (Yamaguchi et al. 2004; Ueda et al. 2005), clearly indicate that WFS1 is involved in the UPR pathway.

In addition to WFS1, we suggest that the gene encoding GCSH is another candidate for XBP1-mediated regulation through an ERSE-like sequence. GCSH has an ERSE-like sequence in its upstream region near the first exon, where the known ERSEs, as well as the ERSE-like sequence of WFS1, are typically found. However, GCSH expression was down-regulated when XBP1 was overexpressed. GCSH is a component of the enzyme system for cleavage of glycine (OMIM 238330), and a defect in GCSH is implicated in glycine encephalopathy (OMIM 605899). A link between this gene and the ER stress response has not yet been reported. Further studies are required to clarify the functional role of this motif.

In summary, we screened for target genes of XBP1 in neuroblastoma cells and identified WFS1 as a strong candidate. An as-yet-unknown transcription factor is thought to mediate this induction. Further studies are needed to clarify further details of ER stress signaling in neuronal cells.


  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We would like to thank for Dr Laurie H. Glimcher for kindly providing us with XBP1 knockout mice.


  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • Bruning J. C., Winnay J., Cheatham B. and Kahn C. R. (1997) Differential signaling by insulin receptor substrate 1 (IRS-1) and IRS-2 in IRS-1-deficient cells. Mol. Cell. Biol. 17, 15131521.
  • Hardy C., Khanim F., Torres R., Scott-Brown M., Seller A., Poulton J., Collier D., Kirk J., Polymeropoulos M., Latif F. and Barrett T. (1999) Clinical and molecular genetic analysis of 19 Wolfram syndrome kindreds demonstrating a wide spectrum of mutations in WFS1. Am. J. Hum. Genet. 65, 12791290.
  • Inoue H., Tanizawa Y., Wasson J. et al. (1998) A gene encoding a transmembrane protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram syndrome). Nat. Genet. 20, 143148.
  • Irizarry R. A., Hobbs B., Collin F., Beazer-Barclay Y. D., Antonellis K. J., Scherf U. and Speed T. P. (2003) Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4, 249264.
  • Iwamoto K., Kakiuchi C., Bundo M., Ikeda K. and Kato T. (2004) Molecular characterization of bipolar disorder by comparing gene expression profiles of postmortem brains of major mental disorders. Mol. Psychiatry 9, 406416.
  • Kakiuchi C., Iwamoto K., Ishiwata M. et al. (2003) Impaired feedback regulation of XBP1 as a genetic risk factor for bipolar disorder. Nat. Genet. 35, 171175.
  • Kakiuchi C., Ishiwata M., Kametani M., Nelson C., Iwamoto K. and Kato T. (2005) Quantitative analysis of mitochondrial DNA deletions in the brains of patients with bipolar disorder and schizophrenia. Int. J. Neuropsychopharmacol. 8, 515522.
  • Kanemoto S., Kondo S., Ogata M., Murakami T., Urano F. and Imaizumi K. (2005) XBP1 activates the transcription of its target genes via an ACGT core sequence under ER stress. Biochem. Biophys. Res. Commun. 331, 11461153.
  • Lee A. H., Iwakoshi N. N. and Glimcher L. H. (2003) XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol. Cell. Biol. 23, 74487459.
  • Li M., Baumeister P., Roy B., Phan T., Foti D., Luo S. and Lee A. S. (2000) ATF6 as a transcription activator of the endoplasmic reticulum stress element: thapsigargin stress-induced changes and synergistic interactions with NF-Y and YY1. Mol. Cell. Biol. 20, 50965106.
  • Osman A. A., Saito M., Makepeace C., Permutt M. A., Schlesinger P. and Mueckler M. (2003) Wolframin expression induces novel ion channel activity in endoplasmic reticulum membranes and increases intracellular calcium. J. Biol. Chem. 278, 52 75552 762.
  • Parker R., Phan T., Baumeister P., Roy B., Cheriyath V., Roy A. L. and Lee A. S. (2001) Identification of TFII-I as the endoplasmic reticulum stress response element binding factor ERSF: its autoregulation by stress and interaction with ATF6. Mol. Cell. Biol. 21, 32203233.
  • Reimold A. M., Etkin A., Clauss I. et al. (2000) An essential role in liver development for transcription factor XBP-1. Genes Dev. 14, 152157.
  • Schroder M. and Kaufman R. J. (2005) ER stress and the unfolded protein response. Mutat. Res. 569, 2963.
  • Sevinsky J. R., Whalen A. M. and Ahn N. G. (2004) Extracellular signal-regulated kinase induces the megakaryocyte GPIIb/CD41 gene through MafB/Kreisler. Mol. Cell. Biol. 24, 45344545.
  • Shim J., Umemura T., Nothstein E. and Rongo C. (2004) The unfolded protein response regulates glutamate receptor export from the endoplasmic reticulum. Mol. Biol. Cell 15, 48184828.
  • Strom T. M., Hortnagel K., Hofmann S., Gekeler F., Scharfe C., Rabl W., Gerbitz K. D. and Meitinger T. (1998) Diabetes insipidus, diabetes mellitus, optic atrophy and deafness (DIDMOAD) caused by mutations in a novel gene (wolframin) coding for a predicted transmembrane protein. Hum. Mol. Genet. 7, 20212028.
  • Swift M. and Swift R. G. (2000) Psychiatric disorders and mutations at the Wolfram syndrome locus. Biol. Psychiatry 47, 787793.
  • Swift R. G., Sadler D. B. and Swift M. (1990) Psychiatric findings in Wolfram syndrome homozygotes. Lancet 336, 667669.
  • Takeda K., Inoue H., Tanizawa Y., Matsuzaki Y., Oba J., Watanabe Y., Shinoda K. and Oka Y. (2001) WFS1 (Wolfram syndrome 1) gene product: predominant subcellular localization to endoplasmic reticulum in cultured cells and neuronal expression in rat brain. Hum. Mol. Genet. 10, 477484.
  • Todaro G. J. and Green H. (1963) Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines. J. Cell Biol. 17, 299313.
  • Ubeda M. and Habener J. F. (2000) CHOP gene expression in response to endoplasmic-reticular stress requires NFY interaction with different domains of a conserved DNA-binding element. Nucleic Acids Res. 28, 49874997.
  • Ueda K., Kawano J., Takeda K. et al. (2005) Endoplasmic reticulum stress induces Wfs1 gene expression in pancreatic beta-cells via transcriptional activation. Eur. J. Endocrinol. 153, 167176.
  • Vandenberghe W., Nicoll R. A. and Bredt D. S. (2005) Interaction with the unfolded protein response reveals a role for stargazin in biosynthetic AMPA receptor transport. J. Neurosci. 25, 10951102.
  • Yamaguchi S., Ishihara H., Tamura A., Yamada T., Takahashi R., Takei D., Katagiri H. and Oka Y. (2004) Endoplasmic reticulum stress and N-glycosylation modulate expression of WFS1 protein. Biochem. Biophys. Res. Commun. 325, 250256.
  • Yamamoto K., Yoshida H., Kokame K., Kaufman R. J. and Mori K. (2004) Differential contributions of ATF6 and XBP1 to the activation of endoplasmic reticulum stress-responsive cis-acting elements ERSE, UPRE and ERSE-II. J. Biochem. (Tokyo) 136, 343350.
  • Yoshida H. (2004) Molecular biology of the ER stress response. Seikagaku 76, 617630.
  • Yoshida H., Haze K., Yanagi H., Yura T. and Mori K. (1998) Identification of the cis-acting endoplasmic reticulum stress response element responsible for transcriptional induction of mammalian glucose-regulated proteins. Involvement of basic leucine zipper transcription factors. J. Biol. Chem. 273, 33 74133 749.
  • Yoshida H., Okada T., Haze K., Yanagi H., Yura T., Negishi M. and Mori K. (2000) ATF6 activated by proteolysis binds in the presence of NF-Y (CBF) directly to the cis-acting element responsible for the mammalian unfolded protein response. Mol. Cell. Biol. 20, 67556767.
  • Yoshida H., Okada T., Haze K., Yanagi H., Yura T., Negishi M. and Mori K. (2001) Endoplasmic reticulum stress-induced formation of transcription factor complex ERSF including NF-Y (CBF) and activating transcription factors 6alpha and 6beta that activates the mammalian unfolded protein response. Mol. Cell. Biol. 21, 12391248.