SEARCH

SEARCH BY CITATION

Keywords:

  • drug abuse;
  • gene expression;
  • heroin;
  • mesocorticolimbic targets;
  • reinstatement;
  • sucrose

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Re-exposure to drug-related cues elicits drug-seeking behaviour and relapse in both humans and laboratory animals even after months of abstinence. Identifying neural and molecular substrates underlying conditioned heroin-seeking behaviour will be helpful in understanding mechanisms behind opiate relapse. In humans and animals, brain areas activated by natural reward-related stimuli (e.g. food, sex) do not show a complete overlap with those activated by stimuli associated with drugs of abuse, suggesting the involvement of different circuitry. To that end, we investigated neural reactivity by measuring immediate early gene (IEG) expression patterns in mesocorticolimbic system target areas following cue-induced reinstatement of heroin seeking and compared those IEG expression patterns to what was measured during natural reward (sucrose)-seeking behaviour. Animals were trained to administer heroin associated with a compound audio-visual cue. Re-exposure to the cue after 3 weeks of withdrawal reinstated heroin-seeking behaviour, which resulted in IEG expression of ania-3, MKP-1, c-fos and Nr4a3 in the medial prefrontal cortex (mPFC), and of ania-3 in the orbital frontal cortex (OFC) and nucleus accumbens core (NAC). The expression patterns for heroin-seeking behaviours did not generalize to sucrose-seeking behaviours, indicating that the two behaviours involve different connectivity pathways of neuronal signalling.

Abbreviations used
BLA

basolateral amygdala

DS

dorsal striatum

ERK

extracellular signal regulated kinase

FR

fixed ratio

IEG

immediate early gene

mPFC

medial prefrontal cortex

NA

nucleus accumbens

NAC

nucleus accumbens core

NAS

nucleus accumbens shell

NF

normalization factor

OFC

orbital frontal cortex

PFC

prefrontal cortex

Repeated opiate (e.g. heroin) use may result in drug addiction where successful treatment is deterred by high incidences of relapse. Learning processes that enable drug-related stimuli (cues) to become associated with drugs (rewards) represent a contributing factor to craving, and may underlie the relapsing nature of addiction to drugs of abuse (O'Brien and McLellan 1996; Leshner 1997). Brain areas such as the prefrontal cortex (PFC), striatum and amygdala, which are targets of the mesocorticolimbic system, play a pivotal role in associative learning processes, mediating motivated behaviour towards natural rewards (e.g. food and sex; Everitt et al. 1999; Robbins and Everitt 2002), but also in craving and drug seeking. Imaging studies that measure cue-induced cocaine craving in humans have shown that prefrontal and limbic activation correlates with the degree of craving (Maas et al. 1998; Childress et al. 1999). In addition, animal studies have shown that various brain areas, such as the medial prefrontal cortex (mPFC), orbital frontal cortex (OFC), nucleus accumbens core (NAC) and basolateral amygdala (BLA) are implicated in the cue-induced reinstatement of cocaine seeking in animal models for cocaine relapse (Ciccocioppo et al. 2001; McLaughlin and See 2003; Fuchs et al. 2004a,b).

Opiates and psychostimulants alter dopaminergic transmission profoundly, which is thought to underlie the consolidation of drug memories (Di Chiara 1999), and induce various short- and long-term neural adaptations, such as changes in neuronal morphology and gene expression in cortical, striatal and amygdala areas (Nestler 2001; Jacobs et al. 2002; Robinson and Kolb 2004; Spijker et al. 2004). These persistent alterations may be different for natural rewards (Di Chiara 1999; Nestler 2001; Robinson and Kolb 2004; Van den Oever et al. 2005). It is interesting to note that, in humans, various cortical and striatal areas respond to cocaine, but not naturally rewarding (sexual) stimuli (Garavan et al. 2000). We and others have shown that exposure to conditioned cues associated with drugs of abuse (opiates, nicotine) versus natural rewards (chocolate, sucrose) elicit overlapping, but also distinct expression patterns of transcription factor immediate early genes (IEGs) in prefrontal and striatal areas (Schroeder et al. 2000, 2001; Schroeder and Kelley 2002; Schmidt et al. 2005). Therefore, it can be inferred from the aforementioned human and animal studies that neuronal substrates respond differently to drugs versus natural rewards and their related stimuli.

As a further step towards the identification of potential disease targets for the clinical management of opiate relapse, it is necessary to identify the diverse molecular responses associated with cue-induced reinstatement to heroin that do not generalize to a motivated behaviour towards natural rewards. Measuring IEGs are useful in this respect as they are rapidly induced in response to neuronal stimulation and their induction suggests alterations in genomic regulation, neuronal signalling and structure (Herdegen and Leah 1998; Lanahan and Worley 1998). Thus, they are attractive neural reactivity markers, whose simultaneous induction in a brain area can be measured sensitively by real-time quantitative PCR (qPCR). Therefore, the aim of this study was to identify a wider range of alterations in molecular reactivity patterns from mesocorticolimbic target areas underlying cue-induced heroin-seeking behaviour, and to compare them with the patterns observed in cue-induced sucrose (natural reward) seeking.

In this study, rats were trained to self-administer heroin or sucrose associated with a compound audio-visual cue. After a long (approximately 3-week) extinction period, the rats were tested for cue-induced reinstatement of heroin or sucrose seeking. Neural reactivity was measured by detecting changes in multiple IEG transcripts from different functional classes using qPCR. Heroin-seeking behaviour, but not sucrose-seeking behaviour, was associated with IEG induction in the mPFC, OFC and NAC.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Animal housing

Male Wistar rats (Harlan CPB, Zeist, the Netherlands), 275–300 g were housed two per cage in Macrolon cages under reversed light/dark conditions (lights on 19.00 to 07.00 h) at 22 ± 2°C. Standard food (Hope Farms, Woerden, the Netherlands) and water were available ad libitum. Animals were allowed to adapt to the housing facilities for at least 7 days before experiments began. All experimental procedures were conducted between 09.00 and 14.00 h, and were approved by the Animal Users Care Committee of Vrije Universiteit.

Surgery

Heroin self-administering groups and their (saline self-administering) controls were implanted with jugular vein catheters and allowed to recover from surgery for at least 1 week as described previously (De Vries et al. 1999). Sucrose self-administering rats and their controls were sham operated, incised under anaesthesia and fitted with a cannula connector on the head.

Operant conditioning with a drug or non-drug reward

Heroin self-administration

Rats were trained to self-administer heroin (diacetylmorphine-HcL; OPG, Utrecht, the Netherlands) in operant cages (TSE, Bad Homberg, Germany) in once-daily 2-h sessions during the lights-off period of the diurnal cycle for a total of 15 sessions. Active and inactive nose-poke holes were located on opposing walls. Responding in the active nose-poke hole resulted in the infusion of heroin (100 μg/kg). Conversely, responding in the inactive hole did not result in the infusion of heroin. A house light and a red cue light above the active nose-poke hole were turned on at the beginning of each session and indicated availability of the drug. Nose pokes in the active hole resulted in a 2-s heroin infusion simultaneously switched with a yellow cue light placed inside the active hole and an audio cue generated by a sucrose pellet dispenser. This event was followed by a time-out period of 15 s, during which nose pokes were ineffective and the house light and the red cue light were turned off. Training started with a fixed ratio-1 (FR-1) schedule of reinforcement for 10 sessions. When rats gave stable responses, the response requirement was increased to a FR-2 and then a FR-4 schedule of reinforcement for two and three sessions, respectively (every first, second or fourth response (depending on type of ratio) led to a heroin infusion and associated cue lights). The criteria for successful acquisition was defined as the amount of nose pokes in the active hole being fourfold more than in the inactive hole, and there being subsequent increases in nose pokes with each increase in the FR schedule. The control groups for heroin only received an i.v. saline infusion and associated cues upon nose poking in the active hole.

Sucrose self-administration

Separate groups of rats were subjected to the same treatment schedule as for heroin self-administration, but they responded to sucrose pellets (45 mg, maximum 100 pellets per session) from the active hole instead of heroin infusions. Stable sucrose self administation was acquired without any need for food deprivation or other manipulations. The control groups for sucrose received only the associated cues upon an active nose poke, and no sucrose pellets.

Extinction of operant responding

Extinction sessions were conducted for 90 min, once daily for 5 days per week, for a total of 14 sessions, spanning a drug withdrawal time frame of about 3 weeks. During the extinction period, heroin or sucrose were unavailable and the conditioned cues previously associated with heroin or sucrose availability (house light and red cue light), and which were associated with the actual heroin infusions or sucrose pellet taking (yellow cue light and audio cue), were not presented. The criterion for successful extinction was defined as less than 12 nose pokes per session.

Reinstatement of operant responding

On the test day, rats were placed in the operant cages. For each group (heroin, sucrose and their respective controls), one group was exposed to the discriminative cue that indicated reward availability (house light and red cue light), and nose pokes resulted in the presentation of the discrete (yellow) cue light and audio cue. Another group underwent an additional extinction session. Recordings of nose pokes in both active and inactive holes were measured until 45 min after presentation of the discriminative cue, after which animals were decapitated, the brains removed quickly and frozen in isopentane and stored at −80°C.

Tissue dissection, RNA isolation and cDNA synthesis

Similar procedures were used for tissue dissection, RNA isolation and cDNA synthesis as described previously (Koya et al. 2005). To explain briefly, coronal sections of 200 μm were made in the cryostat at −15°C and the following brain areas were removed from their respective coordinates inferred from the atlas Paxinos and Watson (1986): mPFC, consisting of Cg1, Cg3, IL; OFC (bregma 3.7–2.7 mm); dorsal striatum (DS), nucleus accumbens (NA) core and shell (NAC and NAS; bregma 2.1–1.3 mm); BLA (bregma −2.8 to −3.8 mm). The areas removed are illustrated in Fig. 1. In order to ensure reproducibility while maintaining the utmost accuracy in the dissections of the accumbens core and shell, the major landmarks of the ventral tip of the lateral ventricle and the anterior commissure were used to demarcate the dorsomedial and ventrolateral extremities of the shell (Fig. 1). Because a section thickness of 0.8 mm was sampled, the more rostral portions of the accumbens core contain a minor portion of the shell, as seen in Fig. 1.

image

Figure 1.  Brain areas analysed in this study. Pictures of 50-μm thick unstained coronal sections are shown against a white background with overlaid grid pattern indicating area of removal; (a) the mPFC and OFC, removed from bregma 3.7–2.7 mm; (b) the DS, NAC and NAS removed from 2.1 to 1.3 mm; (c) the BLA, removed from bregma −2.8 to −3.8 mm. Bregma coordinates were inferred from the brain atlas of Paxinos and Watson (1986).

Download figure to PowerPoint

Total RNA was extracted from the dissected brain regions using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's recommendations, followed by a Dnase treatment (20 U/μg RNA; Roche, Mannheim, Germany) to remove traces of genomic DNA. The integrity of the genomic DNA-free RNA was checked using the Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). This RNA was random primed with 50 pmol hexanucleotides and reverse transcribed using 200 U MMLV H-reverse transcriptase (Promega, Madison, WI, USA).

Gene expression analysis using real-time quantitative PCR (qPCR)

A detailed explanation of the analysis methods can be found in Koya et al. (2005). The qPCR reactions were performed using gene-specific primers designed with Primer Express 1.5 (Applied Biosystems, Foster City, CA, USA), and all PCR reactions were checked for specificity and optimal efficiency using the melting curve analysis SDS 2.1.1 program (Applied Biosystems) and the LinREG program (Ramakers et al. 2003), respectively. All PCR efficiencies were optimal (1.85–2.0 copies per cycle) and thus efficiencies were set at two copies per cycle. Information regarding the primer sequence and the GenBank Accession numbers are given in Table 1. All primers were checked for sequence specificity by blast searching.

Table 1.   Primers used for real-time PCR
GeneGenbankForward primerReverse primer
  1. The GenBank accession numbers and primer sequences are indicated.

arcNM_019361CCAGTCTGTGGCTTTTGTCAGCCAGTGGGTGAGAAGGTGT
homer1aAB003726CATTTTGCTGACCCCGTTGTATAGCAGTGTCTTCACAGTGAAAGTGA
ania-3AF030088GAAGACTGAGAAGCCCTTGATGAACCAGCCACTTGGATTTTTTIACTTTA
MKP-1X84004CAGTCCGTTCGGGACCAATATAAACTGGCTCAAACAGAGTCCTTT
RGS2NM053453GCCAGCAACCTAGGAGAGTCTCTTGACAGGGACGAACCCATTC
c-fosX06789GGGACAGCCTTTCCTACTACCATTTTGGCACTAGAGACGGACAGATC
egr-1NM_012551CCTACCAGTCCCAACTCATCAAACGGACTCAACAGGGCAAGCATAC
egr-2U78102CGCCTAGAAACCAGACCTTCACTAAGATGCCCGCACTCACAATAT
Nr4a3X86003CATCTCCTCCGATCTGTATGATGATCGGTGGGACAGTATCTGGAGTA
HPRTM63983ATGGGAGGCCATCACATTGTATGTAATCCAGCAGGTCAGCAA
GAPDHM17701TGCACCACCAACTGCTTAGCGGCATGGACTGTGGTCATGA
NSEX07729ACGTGGTTCCATTTCAAGATGACCGAGCTTCAGTTAGTGCACCAA
β-actinNM_03144TGACCCAGATCATGTTTGAGACCAGTGGTACGACCAGAGGCATACA

SYBR Green PCR measurements (10 μL; ABI PRISM 7900, Applied Biosystems) were performed with transcript-specific primers (300 nm) and SYBR green 2 × master mix (Applied Biosystems) on cDNA corresponding to ∼15 ng RNA, using cycle settings of 10 min 95°C, 40 cycles of 95°C for 15 s, 59°C for 1 min, followed by a dissociation step from 59°C to 95°C in 15 min.

To correct for differences in the total input material (amount of cDNA) used from sample to sample, IEG transcript levels were normalized to a normalization factor (NF). NF was calculated by obtaining the geometric mean of multiple stable reference genes using the GeNORM applet (Vandesompele et al. 2002). From 10 putative reference genes, the following combinations of stable reference genes were used. (i) Heroin reinstatement session: mPFC (β-actin, GAPDH, HPRT), OFC (β-actin, GAPDH, HPRT, NSE), DS (β-actin, GADPH, HPRT), NAC (β-actin, GAPDH, HPRT, NSE), NAS (β-actin, HPRT, NSE), BLA (β-actin, GAPDH, HPRT, NSE); (ii) sucrose reinstatement session: mPFC (GAPDH, HPRT, NSE), OFC (GAPDH, NSE), DS (β-actin, GAPDH, NSE), NAC (β-actin, GAPDH, NSE), NAS (β-actin, HPRT, NSE), BLA (β-actin, NSE). For all statistical calculations, the absolute amount of normalized transcript of interest, C × E–Ct/NF (where C = 107) was used, as described in Dijk et al. (2004). The factor C was employed to facilitate data presentation.

Statistics

All data were analysed using the NCSS statistical software program (NCSS, Kaysville, UT, USA), and subjected to anova tests and, in case of significance, followed by a Fisher's LSD test, where p < 0.05 was considered to be significant. The heroin and sucrose sessions were analysed separately. Data from the self-administration and extinction phases were analysed separately. For each of these phases, active nose pokes were analysed using a repeated-measures anova where a between-subjects (reward; heroin, no heroin or sucrose, no sucrose) and within-subjects (session) design was used. For the reinstatement test, active and inactive nose pokes were analysed separately using a two-factor anova with the between factors of reward and cue. For the gene expression analysis, the significance of the effects of heroin- and sucrose- seeking behaviour on transcript levels was tested with a two-factor anova with between-subject factors of reward and cue. Criteria for specific, cue-induced IEG regulation were: (i) a significant reward by cue effect; (ii) significant differences in transcript levels present between cue versus no-cue group within a reward group.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Acquisition and extinction of self-administration behaviour

Rats either self-administered heroin or sucrose during 2-h daily sessions for 15 sessions, followed by 14 sessions of extinction (Fig. 2). Nose pokes in the active hole resulted in the delivery of a reward (heroin infusion or sucrose pellet), whereas no reward was delivered when nose pokes were performed in the inactive hole. An increase in the number of nose pokes required to obtain heroin from fixed ratio-1, to -2 to -4 (FR-1, FR-2, FR-4) resulted in enhanced nose pokes in the active hole, ranging from 12.0 ± 1.0, 29.7 ± 1.0 and 64.4 ± 4.2 nose pokes, respectively. Repeated measures anova analysis for the active nose pokes in the acquisition phase revealed a significant effect of reward (F1,26 = 34.14, p < 0.001), session (F14,364 = 61.21, p < 0.001) and session by reward (F14,364 = 15.84, p < 0.001). The number of nose pokes in the inactive hole (Fig. 2a), not associated with heroin, remained considerably lower at three to 10 nose pokes per session, indicative of specific heroin self-administration. Unlike the heroin self-administering animals, the controls (H controls) showed no preference for the active hole (data not shown). For the extinction session, repeated measures anova analysis for the active nose pokes revealed a significant effect of reward (F1,26 = 23.62, p < 0.0001), session (F13,338 = 39.14, p < 0.0001) and session by reward (F13,338 = 12.56, p < 0.0001). Nose pokes in the active and inactive holes on the first extinction session increased slightly from what was observed in the final acquisition session. However, by the second extinction session, the nose pokes in the active and inactive holes dropped dramatically, and stabilized to less than 12 and two nose pokes per sessions in the active and inactive holes, respectively, after eight extinction sessions.

image

Figure 2.  Acquisition of self-administration, extinction, and reinstatement (R) of heroin- (a) and sucrose- (b) seeking behaviour. Data represent mean + SEM number of responses in the reward-paired (active) or unpaired (inactive) hole. During the acquisition session, nose pokes increased as the requirements for obtaining heroin or sucrose increased from FR-1 to FR-4. Compared with active nose pokes, inactive nose pokes were low during all phases (except the first extinction session). Control animals did not show any preferences for the active hole (data not shown). n = 15, 19 for heroin and sucrose group, respectively.

Download figure to PowerPoint

Sucrose self-administration was similar to heroin self-administration, in that changing the administration schedule from FR-1 to FR-2 to FR-4 increased the number of nose pokes in the active hole from 54.1 ± 3.5, 126.6 ± 0.1 and 241.0 ± 2.4 (Fig. 2a), respectively, whereas the inactive pokes (Fig. 2b) remained low at 4–16 pokes throughout the entire acquisition session. Repeated measures anova analysis of active nose pokes for the acquisition phase revealed a significant effect of reward (F1,29 = 9.84, p < 0.01), session (F14,406 = 40.45, p < 0.0001) and session by reward (F14,406 = 5.12, p < 0.0001). The higher number of responses in the active hole compared with the inactive hole indicated specific sucrose-taking behaviour. Sucrose controls (S controls) showed no preference for the active hole (data not shown). For the extinction phase, repeated measures anova analysis for active nose pokes revealed a significant effect of reward (F1,29 = 6.43, p < 0.05), session (F13,377 = 27.58, p < 0.0001) and session by reward (F13,377 = 3.27, p < 0.0001). During the extinction phase, nose pokes in the active hole decreased to levels similarly observed in heroin-experienced animals. Stable responses were seen after eight extinction sessions, in which less than 12 and five nose pokes were made in the active and inactive holes, respectively.

Cue-induced reinstatement after heroin self-administration

Presentation of the stimulus light that signalled the availability of heroin during the acquisition phase, together with the ability to respond to the compound (light–tone) stimulus combination associated previously with heroin infusions reinstated responding on the active hole in Fig. 3(a). A two-factor anova analysis for the number of active pokes revealed significant effects of reward (F1,24 = 50.05, p < 0.0001), cue (F1,24 = 56.44, p < 0.0001) and reward by cue (F1,24 = 44.61, p < 0.0001). Post-hoc analysis revealed that the number of active nose pokes was significantly higher in the heroin-experienced animals re-exposed to the cue (heroin cue; 70.5 ± 6.5), compared with their counterparts who were unexposed to the cue (heroin no cue; 5.0 ± 1.6). No significant differences were observed for heroin control groups re-exposed (H control cue; 7.0 ± 3.4) and unexposed (H control no cue; 3.2 ± 1.6) to the cue. A two-factor anova analysis revealed no significant effects of reward, cue, or reward by cue interaction for the inactive pokes.

image

Figure 3.  Reinstatement of heroin- and sucrose-seeking behaviour. Re-exposure to the discriminative cue and the ability to respond to the discrete cue for 45 min was measured. Only rats with a reward self-administration experience exhibited robust nose pokes in the active nose-poke hole. Inactive nose pokes did not increase significantly for both heroin- and sucrose-experienced animals. (a) Heroin reinstatement session. Heroin-experienced animals showed significantly increased active nose-poke behaviour as a result of re-exposure to a heroin cue. (b) Sucrose reinstatement session. Sucrose-experienced animals exhibited significantly increased active nose pokes as a result of re-exposure to the sucrose cue. Bars represent mean number of nose pokes + SEM. n = 9, 8, 6 and 5 for heroin+, heroin–, H control+ and H control–, respectively, and n = 9, 10, 6 and 6 for sucrose+, sucrose–, S control+ and S control–, respectively. H/S control, heroin/sucrose control; + or –, cue or no cue. **p < 0.001 versus all other groups (active pokes).

Download figure to PowerPoint

Cue-induced reinstatement after sucrose self-administration

Similar to heroin reinstatement, presentation of the stimulus light that signalled the availability of sucrose delivery during the acquisition phase, together with the ability to respond for the compound (light–tone) stimulus combination previously associated with sucrose delivery reinstated responding on the active hole in sucrose-experienced animals (Fig. 3b). When the active nose pokes were analysed, a two-factor anova revealed an effect of reward (F1,27 = 46.24, p < 0.0001), cue (F1,27 = 49.64, p < 0.0001), and reward by cue (F1,27 =51.47, p < 0.0001). Post-hoc analysis revealed that the number of active pokes was significantly higher in sucrose-experienced animals re-exposed to the cue (sucrose cue; 95.3 ± 31.3), in contrast to their counterparts unexposed to the cue (sucrose no cue; 3.1 ± 1.1). No significant differences were observed for the control groups re-exposed (S control cue; 16.5 ± 7) and unexposed to the cue (S control no cue; 5.3 ± 1.9). For the inactive nose pokes, two-factor anova analysis revealed a significant effect of reward (F1,27 = 6.48, p < 0.05), but not cue, or reward by cue.

Regional IEG expression after exposure to a heroin- or sucrose-related cue

In order to gain more insight into ongoing neuroadaptive responses during conditioned heroin- and sucrose-seeking behaviour, we selected different functional classes of IEGs whose products play a proposed role in modulating synaptic structure, i.e. (arc; Sheng and Lee 2000), modulating glutamate signalling (homer1a, ania-3; Bottai et al. 2002), extracellular regulating kinase (ERK) signaling (MKP-1; Sgambato et al. 1998) and G-protein signalling (RGS2; Ingi et al. 1998), as well as gene regulation (c-fos, egr-1/2, Nr4a3; Herdegen and Leah 1998; Maira et al. 1999). Analysis of mRNA levels for the 10 IEG transcripts, measured 45 min after cue re-exposure, revealed distinct patterns of IEG expression associated with conditioned heroin- but not sucrose-seeking behaviour. The results are summarized in Table 2.

Table 2.   A summary of the fold regulation-values of examined IEGs for various brain areas in heroin (H), sucrose (S) and their respective controls (HC, SC), for cue (+) versus no cue (–)
 archomer1aania-3MKP-1RGS2c-fosegr-1egr-2Nr4a3
  • **

    p < 0.01,

  • *

    p < 0.05 for cue versus no cue;

  • p < 0.05 for reward–cue interaction.

mPFC
 SC+/SC−0.911.041.251.091.001.180.880.830.90
 S+/S−0.971.160.860.900.981.120.891.000.97
 HC+/HC−1.231.49**1.39**1.001.001.201.191.201.15
 H+/H−1.79**1.85**1.69**1.36*1.071.92**1.41**2.12**1.63**
OFC
 SC+/SC−1.191.231.261.011.131.450.901.271.15
 S+/S−1.101.231.301.211.051.110.971.300.96
 HC+/HC−1.071.36*1.100.941.100.941.041.421.18
 H+/H−1.251.49*1.40*1.081.071.111.191.311.17
DS
 SC+/SC−1.001.281.221.291.111.481.271.251.25
 S+/S−1.00l.05†0.951.001.111.241.141.061.12
 HC+/HC−1.001.100.891.000.971.101.001.151.17
 H+/H−1.251.291.32**1.201.091.65**1.131.181.43**
NAS
 SC+/SC−1.181.241.461.181.031.481.271.010.87
 S+/S−1.150.781.181.181.091.241.141.301.23
 HC+/HC−1.001.201.141.000.971.001.310.991.09
 H+/H−1.371.221.001.201.031.53*1.001.62*1.70*
NAC
 SC+/SC−1.091.021.171.011.071.031.020.991.10
 S+/S−1.051.041.041.111.001.131.051.000.98
 HC+/HC−1.161.201.271.181.101.141.111.241.25
 H+/H−1.291.141.64**1.371.221.41**1.181.261.21
BLA
 SC+/SC−1.221.171.051.271.081.34*1.211.121.07
 S+/S−1.251.431.131.041.151.69*0.841.48*1.36
 HC+/HC−0.921.231.000.701.121.240.961.371.12
 H+/H−1.251.271.350.981.001.241.011.62*1.11

Prefrontal and frontal areas

Heroin reinstatement session

Gene expression analysis of the mPFC revealed significant interactions of reward by cue for ania-3 (F1,24 = 5.58, p < 0.05; Fig. 4a), c-fos (F1,24 = 4.53, p < 0.05; Fig. 4b), MKP-1 (F1,24 = 9.23, p < 0.01), and Nr4a3 (F1,24 = 13.35, p < 0.01). Post-hoc analysis revealed significantly higher levels of ania-3, MKP-1, c-fos and Nr4a3 for the heroin-cue group compared with the heroin no-cue group. The fold induction of ania-3, MKP-1, c-fos, and Nr4a3 as a result of cue exposure in heroin-experienced animals ranged from between 1.4- and 1.9-fold. For ania-3, a minor (1.4-fold), but significant, increase was seen in the control group after cue exposure. In addition to the significant reward by cue interactions, for ania-3 a significant effect of reward (F1,24 = 7.43, p < 0.05) and cue (F1,24 = 39.01, p < 0.001), and for c-fos a significant effect of reward (F1,24 = 9.58, p < 0.01) and cue (F1,24 = 14.8, p < 0.001) were observed. In addition, for Nr4a3, a significant effect of cue was observed (F1,24 = 40.65, p < 0.001). A significant effect of reward for arc, egr-1, egr-2 (F1,24 = 4.73, p < 0.05, F1,24 = 7.62, p < 0.05, F1,24 = 8.73, p < 0.01) and cue for arc and egr-1 (F1,24 = 12.48, p < 0.01, F1,24 =9.03, p < 0.01) was observed.

image

Figure 4.  Potentiated IEG responses are observed in the mPFC, OFC and NAC for heroin-, and not sucrose-, seeking behaviours. Data are indicated as mean levels of normalized transcript amounts + SEM and are standardized to the control groups that did not receive the cue. In the mPFC (a, b), cue re-exposure resulted in a robust significant increase of ania-3 and c -fos in animals with heroin, but not sucrose experience. Mild increases were seen in ania-3 levels in both control groups as a result of cue re-exposure, and a significant increase was observed for the heroin control group. In the OFC (c) and NAC (d), a significant increase in ania-3 levels was observed after cue re-exposure only in heroin-, but not sucrose-, experienced animals. n = 9, 8, 6 and 5 for heroin cue, heroin no cue, H control cue and H control no cue, respectively, and n = 9, 10, 6 and 6 for sucrose cue, sucrose no cue, S control cue and S control no cue, respectively. H/S control, heroin and sucrose control. **p < 0.01, *p < 0.05.

Download figure to PowerPoint

In the OFC, a significant effect of reward by cue (F1,24 =4.70, p < 0.05) and cue (F1,24 = 4.34, p < 0.05) was observed for ania-3 (Fig. 4c). Post-hoc analysis revealed that transcript levels were significantly higher (1.4-fold) in the heroin-cue group compared with the no-cue group. RGS2 (F1,24 = 5.51, p < 0.05) and homer1a (F1,24 = 16.8, p < 0.001) only exhibited a significant effect of cue and egr-2 (F1,24 = 7.18, p < 0.05) only exhibited a significant effect of reward.

Sucrose reinstatement session

None of the IEGs that exhibited a significant interaction of reward by cue in the heroin reinstatement session exhibited a significant effect of reward by cue, except for ania-3 (F1,27 = 4.29, p < 0.05) in the mPFC (Fig. 4a). Post-hoc analysis did not reveal any significant group differences. Only opposing trends were observed in ania-3 transcript levels such that a non-significant mild increase (1.2-fold) and decrease (−1.2-fold) were present for the sucrose and their control groups after cue presentation, respectively. A significant effect of cue was observed for egr-1 (F1,27 = 6.42, p < 0.05). In the OFC, ania-3 (F1,27 = 5.26, p < 0.05), and egr-2 (F1,27 = 4.61, p < 0.05) exhibited only a significant effect of cue, while, for Nr4a3 (F1,27 = 4.70, p < 0.05), only a significant effect of reward was observed.

Dorsal striatum

Heroin reinstatement session

No significant effects of reward by cue were observed in the DS, unlike in the PFC areas. Nr4a3 transcript levels displayed a significant effect of reward (F1,24 = 8.21, p < 0.01) and cue (F1,24 = 10.68, p < 0.01). Transcript levels for ania-3 (F1,24 = 12.65, p < 0.01), MKP-1 (F1,24 = 7.85, p < 0.01), c-fos (F1,24 = 8.95, p < 0.01), egr-1 (F1,24 = 5.50, p < 0.05) and egr-2 (F1,24 = 5.20, p < 0.05) displayed a significant effect of reward only. A significant effect of cue only was observed for homer1a (F1,24 = 11.04, p < 0.001).

Sucrose reinstatement session

In the DS, there was a significant effect of reward by cue for homer1a (F1,27 = 4.61, p < 0.05). Post-hoc analysis revealed that there was a small, significant 1.3-fold increase in the control groups that received the cue, whereas no such increase was observed in the sucrose group after cue exposure. Also, a significant effect of reward (F1,27 = 10.29, p < 0.01) and cue (F1,27 = 9.75, p < 0.01) was observed. Only a significant effect of cue was observed for c-fos (F1,27 = 10.29, p < 0.01) and reward for egr-1 (F1,27 = 17.27, p < 0.01) and egr-2 (F1,27 = 5.23, p < 0.05).

Nucleus accumbens

Heroin reinstatement session

In the NAC, a significant effect of reward by cue was observed for levels of ania-3 (F1,24 = 4.25, p < 0.05) as well as significant reward (F1,24 = 10.61, p < 0.01) and cue (F1,24 = 21.36, p < 0.001) effects (Fig. 4d). Post-hoc analysis revealed that transcript levels were 1.64-fold higher in the heroin-cue group compared with the no-cue group. A slight but significant increase was observed in the control groups after cue exposure of 1.27-fold. A significant effect of reward, cue were observed for arc (F1,24 = 10.61, p < 0.01; F1,24 = 5.58, p < 0.05), c-fos (F1,24 = 5.84, p < 0.01; F1,24 = 4.50, p < 0.05), egr-2 (F1,24 = 6.24, p < 0.05; F1,24 = 7.56, p < 0.05), and Nr4a3 (F1,24 = 6.09, p < 0.05; F1,24 = 9.46, p < 0.01). Only a significant effect of cue for homer1a (F1,24 = 6.05, p < 0.05) was observed. In the NAS, significant effects of reward was observed for arc (F1,24 = 6.76, p < 0.05), c-fos (F1,24 = 8.57, p < 0.01), MKP-1 (F1,24 = 5.34, p < 0.05) and cue for homer1a (F1,24 = 4.83, p < 0.05) and Nr4a3 (F1,24 = 7.45, p < 0.05).

Sucrose reinstatement session

No significant effects of reward, cue were observed in the NAC for the sucrose session. For the NAS, a significant effect of reward for ania-3 (F1,27 = 8.87, p < 0.01) and a significant effect of cue for c-fos (F1,27 = 8.08, p < 0.01) was observed.

Basolateral amygdala

Heroin reinstatement session

Only a significant effect of cue was observed for c-fos (F1,24 = 5.32, p < 0.05) and egr-2 (F1,24 = 5.06, p < 0.05).

Sucrose reinstatement session

A significant effect of reward was observed for egr-1 (F1,27 = 21.71, p < 0.001) and for egr-2, significant effects of reward (F1,27 = 10.00, p < 0.01) and cue (F1,27 = 6.08, p < 0.05) were observed.

In summary, these findings demonstrate that, in the mPFC, OFC and NAC, a potentiated IEG response (1.6–2.1-fold) was present in heroin- but not in sucrose-seeking animals. For every brain area examined in the control groups, there were IEGs whose levels increased mildly (1.2–1.5-fold) as a result of cue exposure. In an overwhelming majority of cases, those IEGs displayed similar trends or significant increases in both control groups.

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Re-exposure to drug-related cues can elicit craving in abstinent addicts, and in laboratory animals it can reinstate drug-seeking behaviour. In the past few years, research has shown that brain areas involved in processing motivational components of natural rewards are reactive during conditioned drug-seeking behaviour. Our findings indicate that the cortical and accumbal areas studied show enhanced molecular reactivity during conditioned heroin-seeking behaviour. When a comparison was made with reinstatement of non-drug reward (sucrose)-seeking behaviour, we failed to observe IEG induction despite the inclusion of multiple brain areas involved in reinforcement learning and IEG markers in our study. The level of reward-seeking behaviour was similar between heroin and sucrose groups, with the sucrose groups exhibiting even slightly higher levels. This finding implies that (i) it is unlikely that the potentiated IEG induction, as a result of cue exposure in heroin-experienced animals, occurred as a result of enhanced motor processing, and (ii) conditioned heroin-seeking may involve activation of different neural circuits and molecular pathways compared with sucrose seeking.

Potentiated IEG reactivity associated with heroin-seeking behaviours

We selected various neural reactivity markers in order to increase the likelihood of gaining a more detailed view of ongoing neuroplastic responses during reward-seeking behaviour. As a result, gene expression patterns never before associated with drug seeking were observed. Assuming to a degree that changes in mRNA levels reflect changes in protein levels, and based on the proposed function of the proteins for which the IEGs code, some of the molecular changes in the neurons can be discussed. In the mPFC, the induction of transcription factor genes such as c-fos and Nr4a3 may suggest induction of gene expression at a time point downstream of the cue. Two other IEGs induced here have a function related to altering neuronal signalling. MKP-1 is induced in response to ERK stimulation, and is thought to serve as a negative feedback mechanism for ERK signalling, as its function is to de-activate ERK (Davis et al. 2000). Thus, the induction of this IEG is suggestive of alterations in the ERK pathway in the mPFC. Recently, it was shown that the activation of the ERK pathway in the central nucleus of amygdala plays a pivotal role in the incubation of cocaine-seeking behaviour (Lu et al. 2005). Future studies should address whether intervention of the ERK pathway in the mPFC also affects heroin-seeking behaviours.

Ania-3, a short form of the Homer family of proteins which interacts with both metabotropic and ionotropic glutamate receptor complexes (Xiao et al. 2000), is an IEG that was induced in multiple areas of the mPFC, oFC and NAC. The short forms miss the interaction domains and compete with the long forms of Homer proteins and can disrupt the glutamate receptor complexes. Following cocaine self-administration, basal glutamatergic levels are decreased in the NA (Baker et al. 2003), as well as the expression levels of the long Homer proteins (Szumlinski et al. 2004). Mice that do not express the genes for Homer 1 and 2 resemble a cocaine withdrawn state at the level of behaviour and neurochemistry (Szumlinski et al. 2004). The induction of ania-3 may represent disrupted glutamatergic signalling in heroin-seeking behaviour and adds to the growing body of evidence which points towards the role of altered glutamate signalling in drug relapse behaviours (Kalivas 2004).

Many IEGs are known to be induced via the action of glutamate and/or dopamine (Kelley 2004). Indeed, PFC-mediated increases in glutamate release in the NAC and D1-dependent IEG reactivity in the mPFC have been observed during the reinstatement of cocaine-seeking behaviour (Ciccocioppo et al. 2001; McFarland et al. 2003). Different patterns of neuronal stimulation, such as increased frequency of stimulation and increased combined inputs from different presynaptic sources, can enhance IEG induction (Arnauld et al. 1996; Pearse et al. 2001). Therefore, the altered patterns of dopaminergic and/or glutamatergic signalling from input-providing areas may have triggered the enhanced IEG response in heroin-seeking behaviour.

Interestingly, the IEG expression patterns for heroin seeking did not generalize to sucrose seeking. One explanation for this may be that drug history can influence IEG responses. For instance, it is known that a stronger IEG response is seen upon glutamatergic stimulation in rats with chronic cocaine history compared with controls (Canales et al. 2002). It is well documented that repeated exposure to drugs of abuse can elicit profound long-lasting changes at the molecular, morphological and behavioural levels. Repeated opiate and psychostimulant administration have both shown to alter transcription factor levels persistently, including ΔFosB (Hope et al. 1994), and genomic regulation (Jacobs et al. 2002, 2004; Spijker et al. 2004) in mesocorticolimbic target areas. In addition, how neurons may respond to signals and subsequently to intracellular signalling and gene expression may be altered, as expression levels of select glutamatergic receptor subunits are known to increase after repeated drug administration (Lu et al. 2003). Self-administration of psychostimulants and opiates have been shown to result in long-term changes in the reorganization of synaptic connectivity patterns in the mPFC and NA, namely in opposing changes in spine density and dendritic branching in the aforementioned areas (Robinson and Kolb 2004). In contrast, the aforementioned changes are not observed in self-administration of natural rewards (Robinson and Kolb 2004).

On a network scale, the persistent drug-induced changes in transcriptional machinery and patterns of synaptic connectivity may influence how brain areas communicate, which may eventually influence motivationally related processes such as conditioned reward seeking. Indeed, time-dependent increases in reinstatement of cue-induced drug seeking have been observed and, in contrast to natural reward seeking, drug seeking is more resistant to decay (Lu et al. 2004). Taken together, the specific effects that drugs of abuse, compared with natural rewards, have on neurons may alter input–output characteristics of various brain areas, exemplified here by the differential neural reactivity to the cue.

Relevance to reward-seeking behaviours

In agreement with our studies, many studies have shown that cue-induced reinstatement of ethanol and cocaine seeking is accompanied by increases in IEG reactivity in the mPFC (Ciccocioppo et al. 2001; Wedzony et al. 2003; Schmidt et al. 2005). Also, inactivation of the mPFC, OFC and NAC attenuates reinstatement of cocaine-seeking behaviours after presentation of a cocaine cue (McLaughlin and See 2003; Fuchs et al. 2004b,c). In our studies, we did not detect specific induction of IEGs in the BLA during heroin-seeking behaviour, although it is reported that its inactivation attenuates cocaine- and heroin-seeking behaviours (Fuchs and See 2002; McLaughlin and See 2003). However, the lack of IEG reactivity does not necessarily imply an absence of activity, and this area may still be involved in conditioned heroin-seeking behaviour. The same reasoning may also hold true for sucrose-seeking behaviour where, in agreement with the study of Wedzony et al. (2003), we detected an absence of IEG induction. Our findings, combined with the aforementioned findings from IEG/inactivation studies, suggest that the mPFC may be a common denominator in cue-induced drug-seeking behaviours. Moreover, the differential reactivity patterns observed here between heroin- and sucrose-seeking behaviours imply that different neural mechanisms are at play for the two behaviours. Indeed, inactivation of the mPFC and NAC reduced cocaine-seeking, but not food-seeking, behaviour (McFarland and Kalivas 2001), and amphetamine can reinstate heroin, but not sucrose, -seeking behaviour (De Vries et al. unpublished observations).

Conditioned reward-seeking behaviour includes components of learning and memory recall processes. During the reinforcement learning (acquisition phase), the repeated pairing of the reward and its cues is consolidated to memory traces encoding the incentive motivational value. It is interesting to note here that rats which trained to self-administer sucrose established more stimulus–reward associations during the acquisition phase compared with heroin, yet on the reinstatement test day, the incentive value of the cue was similar between heroin and sucrose rats. It cannot be excluded that this factor contributes to some extent in the neural reactivity differences observed between heroin and sucrose seeking.

Enhanced cortical and accumbal reactivity: implications for addictive behaviours

In human addicts, cue-elicited cocaine and heroin craving is associated with increased metabolic activity or blood flow in prefrontal and frontal cortices, and NA is involved in salience attribution and motivation, closely paralleling our results (Childress et al. 1999; Sell et al. 2000; Kilts et al. 2004). In humans, such abnormal brain reactivity may contribute to the perceived differences in incentive salience for drug versus natural reward-related stimuli. In support of this view, addicts show decreased incentive for naturally rewarding substances (Goldstein and Volkow 2002) and exhibit decreased cingulate cortex activation in response to naturally rewarding stimuli (e.g. erotic stimuli), when compared with non-addicts (Garavan et al. 2000).

Summary

Re-exposure to drug-related cues is associated with craving and, subsequently, compulsive drug-seeking/-taking behaviour. We found that conditioned heroin-seeking, but not sucrose-seeking, behaviour, is associated with potentiated reactivity in areas that mediate inhibitory control and encode the incentive motivational value of the reward cues. Considering the results of the present study, one may hypothesize that, in these brain areas, IEGs and/or pathways leading to the induction of IEGs may play an important role in the processing of drug, but not natural reward stimuli. Future studies need to establish the functional relationships of the brain areas and IEG responses specifically to heroin-seeking behaviour by selective inactivation of brain areas and/or molecular pathways.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

This work was supported by N.W.O. grant 985-10-007. The authors would like to thank Wendy de Vries for technical assistance and Mary Pfeiffer for critical reading of the manuscript.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • Arnauld E., Jeantet Y., Arsaut J. and Demotes-Mainard J. (1996) Involvement of the caudal striatum in auditory processing: c-fos response to cortical application of picrotoxin and to auditory stimulation. Brain Res. Mol Brain Res. 41, 2735.
  • Baker D. A., McFarland K., Lake R. W., Shen H., Tang X. C., Toda S. and Kalivas P. W. (2003) Neuroadaptations in cystine–glutamate exchange underlie cocaine relapse. Nat. Neurosci. 6, 743749.
  • Bottai D., Guzowski J. F., Schwarz M. K., Kang S. H., Xiao B., Lanahan A., Worley P. F. and Seeburg P. H. (2002) Synaptic activity-induced conversion of intronic to exonic sequence in Homer 1 immediate early gene expression. J. Neurosci. 22, 167175.
  • Canales J. J., Capper-Loup C., Hu D., Choe E. S., Upadhyay U. and Graybiel A. M. (2002) Shifts in striatal responsivity evoked by chronic stimulation of dopamine and glutamate systems. Brain 125, 23532363.
  • Childress A. R., Mozley P. D., McElgin W., Fitzgerald J., Reivich M. and O'Brien C. P. (1999) Limbic activation during cue-induced cocaine craving. Am. J. Psychiatry 156, 1118.
  • Ciccocioppo R., Sanna P. P. and Weiss F. (2001) Cocaine-predictive stimulus induces drug-seeking behavior and neural activation in limbic brain regions after multiple months of abstinence: reversal by D1 antagonists. Proc. Natl Acad. Sci. USA 98, 19761981.
  • Davis S., Vanhoutte P., Pages C., Caboche J. and Laroche S. (2000) The MAPK/ERK cascade targets both Elk-1 and cAMP response element-binding protein to control long-term potentiation-dependent gene expression in the dentate gyrus in vivo. J. Neurosci. 20, 45634572.
  • De Vries T. J., Schoffelmeer A. N., Binnekade R. and Vanderschuren L. J. (1999) Dopaminergic mechanisms mediating the incentive to seek cocaine and heroin following long-term withdrawal of IV drug self-administration. Psychopharmacology (Berl.) 143, 254260.
  • Di Chiara G. (1999) Drug addiction as dopamine-dependent associative learning disorder. Eur. J. Pharmacol. 375, 1330.
  • Dijk F., Kraal-Muller E. and Kamphuis W. (2004) Ischemia-induced changes of AMPA-type glutamate receptor subunit expression pattern in the rat retina: a real-time quantitative PCR study. Invest. Ophthalmol. Vis. Sci. 45, 330341.
  • Everitt B. J., Parkinson J. A., Olmstead M. C., Arroyo M., Robledo P. and Robbins T. W. (1999) Associative processes in addiction and reward. The role of amygdala-ventral striatal subsystems. Ann. NY Acad. Sciaccumb 877, 412438.
  • Fuchs R. A. and See R. E. (2002) Basolateral amygdala inactivation abolishes conditioned stimulus- and heroin-induced reinstatement of extinguished heroin-seeking behaviour in rats. Psychopharmacology (Berl.) 160, 425433.
  • Fuchs R. A., Evans K. A., Parker M. C. and See R. E. (2004a) Differential involvement of the core and shell subregions of the nucleus accumbens in conditioned cue-induced reinstatement of cocaine-seeking in rats. Psychopharmacology (Berl.) 176, 459465.
  • Fuchs R. A., Evans K. A., Parker M. P. and See R. E. (2004b) Differential involvement of orbitofrontal cortex subregions in conditioned cue-induced and cocaine-primed reinstatement of cocaine-seeking in rats. J. Neurosci. 24, 66006610.
  • Fuchs R. A., Evans K. A., Parker M. C. and See R. E. (2004c) Differential involvement of the core and shell subregions of the nucleus accumbens in conditioned cue-induced reinstatement of cocaine-seeking in rats. Psychopharmacology (Berl.) 176, 459465.
  • Garavan H., Pankiewicz J., Bloom A., Cho J. K., Sperry L., Ross T. J., Salmeron B. J., Risinger R., Kelley D. and Stein E. A. (2000) Cue-induced cocaine craving: neuroanatomical specificity for drug users and drug stimuli. Am. J. Psychiatry 157, 17891798.
  • Goldstein R. Z. and Volkow N. D. (2002) Drug addiction and its underlying neurobiological basis: neuroimaging evidence for the involvement of the frontal cortex. Am. J. Psychiatry 159, 16421652.
  • Herdegen T. and Leah J. D. (1998) Inducible and constitutive transcription factors in the mammalian nervous system: control of gene expression by Jun, Fos and Krox, and CREB/ATF proteins. Brain Res. Brain Res. Rev. 28, 370490.
  • Hope B. T., Nye H. E., Kelz M. B., Self D. W., Iadarola M. J., Nakabeppu Y., Duman R. S. and Nestler E. J. (1994) Induction of a long-lasting AP-1 complex composed of altered Fos-like proteins in brain by chronic cocaine and other chronic treatments. Neuron 13, 12351244.
  • Ingi T., Krumins A. M., Chidiac P. et al. (1998) Dynamic regulation of RGS2 suggests a novel mechanism in G-protein signaling and neuronal plasticity. J. Neurosci. 18, 71787188.
  • Jacobs E. H., Spijker S., Verhoog C. W., Kamprath K., De Vries T. J., Smit A. B. and Schoffelmeer A. N. (2002) Active heroin administration induces specific genomic responses in the nucleus accumbens shell. FASEB J. 16, 19611963.
  • Jacobs E. H., De Vries T. J., Smit A. B. and Schoffelmeer A. N. (2004) Gene transcripts selectively down-regulated in the shell of the nucleus accumbens long after heroin self-administration are up-regulated in the core independent of response contingency. FASEB J. 18, 200202.
  • Kalivas P. W. (2004) Glutamate systems in cocaine addiction. Curr. Opin. Pharmacol. 4, 2329.
  • Kelley A. E. (2004) Memory and addiction: shared neural circuitry and molecular mechanisms. Neuron 44, 161179.
  • Kilts C. D., Gross R. E., Ely T. D. and Drexler K. P. (2004) The neural correlates of cue-induced craving in cocaine-dependent women. Am. J. Psychiatry 161, 233241.
  • Koya E., Spijker S., Homberg J. R., Voorn P., Schoffelmeer A. N., De Vries T. J. and Smit A. B. (2005) Molecular reactivity of mesocorticolimbic brain areas of high and low grooming rats after elevated plus maze exposure. Mol. Brain Res. 137, 184192.
  • Lanahan A. and Worley P. (1998) Immediate-early genes and synaptic function. Neurobiol. Learn. Mem. 70, 3743.
  • Leshner A. I. (1997) Addiction is a brain disease, and it matters. Science 278, 4547.
  • Lu L., Grimm J. W., Shaham Y. and Hope B. T. (2003) Molecular neuroadaptations in the accumbens and ventral tegmental area during the first 90 days of forced abstinence from cocaine self-administration in rats. J. Neurochem. 85, 16041613.
  • Lu L., Grimm J. W., Hope B. T. and Shaham Y. (2004) Incubation of cocaine craving after withdrawal: a review of pre-clinical data. Neuropharmacology 47, 214226.
  • Lu L., Hope B. T., Dempsey J., Liu S. Y., Bossert J. M. and Shaham Y. (2005) Central amygdala ERK signaling pathway is critical to incubation of cocaine craving. Nat. Neurosci. 8, 212219.
  • Maas L. C., Lukas S. E., Kaufman M. J., Weiss R. D., Daniels S. L., Rogers V. W., Kukes T. J. and Renshaw P. F. (1998) Functional magnetic resonance imaging of human brain activation during cue-induced cocaine craving. Am. J. Psychiatry 155, 124126.
  • Maira M., Martens C., Philips A. and Drouin J. (1999) Heterodimerization between members of the Nur subfamily of orphan nuclear receptors as a novel mechanism for gene activation. Mol. Cell Biol. 19, 75497557.
  • McFarland K. and Kalivas P. W. (2001) The circuitry mediating cocaine-induced reinstatement of drug-seeking behavior. J. Neurosci. 21, 86558663.
  • McFarland K., Lapish C. C. and Kalivas P. W. (2003) Prefrontal glutamate release into the core of the nucleus accumbens mediates cocaine-induced reinstatement of drug-seeking behavior. J. Neurosci. 23, 35313537.
  • McLaughlin J. and See R. E. (2003) Selective inactivation of the dorsomedial prefrontal cortex and the basolateral amygdala attenuates conditioned-cued reinstatement of extinguished cocaine-seeking behavior in rats. Psychopharmacology (Berl.) 168, 5765.
  • Nestler E. J. (2001) Molecular basis of long-term plasticity underlying addiction. Nat. Rev. Neurosci. 2, 119128.
  • O'Brien C. P. and McLellan A. T. (1996) Myths about the treatment of addiction. Lancet 347, 237240.
  • Paxinos G. and Watson C. (1986) The Rat Brain in Stereotaxic Coordinates, 2nd edn. Academic Press, Sydney.
  • Pearse D. D., Bushell G. and Leah J. D. (2001) Jun, Fos and Krox in the thalamus after C-fiber stimulation: coincident-input-dependent expression, expression across somatotopic boundaries, and nucleolar translocation. Neuroscience 107, 143159.
  • Ramakers C., Ruijter J. M., Deprez R. H. and Moorman A. F. (2003) Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 339, 6266.
  • Robbins T. W. and Everitt B. J. (2002) Limbic-striatal memory systems and drug addiction. Neurobiol. Learn. Mem. 78, 625636.
  • Robinson T. E. and Kolb B. (2004) Structural plasticity associated with exposure to drugs of abuse. Neuropharmacology 47, 3346.
  • Schmidt E. D., Voorn P., Binnekade R., Schoffelmeer A. N. and De Vries T. J. (2005) Differential involvement of the prelimbic cortex and striatum in conditioned heroin and sucrose seeking following long-term extinction. Eur. J. Neurosci. 22, 23472356.
  • Schroeder B. E. and Kelley A. E. (2002) Conditioned Fos expression following morphine-paired contextual cue exposure is environment specific. Behav. Neurosci. 116, 727732.
  • Schroeder B. E., Holahan M. R., Landry C. F. and Kelley A. E. (2000) Morphine-associated environmental cues elicit conditioned gene expression. Synapse 37, 146158.
  • Schroeder B. E., Binzak J. M. and Kelley A. E. (2001) A common profile of prefrontal cortical activation following exposure to nicotine- or chocolate-associated contextual cues. Neuroscience 105, 535545.
  • Sell L. A., Morris J. S., Bearn J., Frackowiak R. S., Friston K. J. and Dolan R. J. (2000) Neural responses associated with cue evoked emotional states and heroin in opiate addicts. Drug Alcohol Depend. 60, 207216.
  • Sgambato V., Pages C., Rogard M., Besson M. J. and Caboche J. (1998) Extracellular signal-regulated kinase (ERK) controls immediate early gene induction on corticostriatal stimulation. J. Neurosci. 18, 88148825.
  • Sheng M. and Lee S. H. (2000) Growth of the NMDA receptor industrial complex. Nat. Neurosci. 3, 633635.
  • Spijker S., Houtzager S. W., De Gunst M. C., De Boer W. P., Schoffelmeer A. N. and Smit A. B. (2004) Morphine exposure and abstinence define specific stages of gene expression in the rat nucleus accumbens. FASEB J. 18, 848850.
  • Szumlinski K. K., Dehoff M. H., Kang S. H. et al. (2004) Homer proteins regulate sensitivity to cocaine. Neuron 43, 401413.
  • Van den Oever M. C., Spijker S., Li K. W. et al. (2005) A proteomics approach to identify long-term molecular changes in rat medial prefrontal cortex resulting from sucrose self-administration. J. Prot. Res. 5, 147154.
  • Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A. and Speleman F. (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3, RESEARCH0034.
  • Wedzony K., Koros E., Czyrak A., Chocyk A., Czepiel K., Fijal K., Mackowiak M., Rogowski A., Kostowski W. and Bienkowski P. (2003) Different pattern of brain c-Fos expression following re-exposure to ethanol or sucrose self-administration environment. Naunyn Schmiedebergs Arch. Pharmacol. 368, 331341.
  • Xiao B., Tu J. C. and Worley P. F. (2000) Homer: a link between neural activity and glutamate receptor function. Curr. Opin. Neurobiol. 10, 370374.