SEARCH

SEARCH BY CITATION

Keywords:

  • cholesterol;
  • neural apoptosis-regulated convertase-1;
  • proprotein convertase subtilisin-kexin like-9;
  • neurogenesis;
  • P19 cells;
  • proprotein convertase;
  • zebrafish

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Neural apoptosis-regulated convertase-1/proprotein convertase subtilisin-kexin like-9 (NARC-1/PCSK9) is a proprotein convertase recently described to play a major role in cholesterol homeostasis through enhanced degradation of the low-density lipoprotein receptor (LDLR) and possibly in neural development. Herein, we investigated the potential involvement of this proteinase in the development of the CNS using mouse embryonal pluripotent P19 cells and the zebrafish as models. Time course quantitative RT–PCR analyses were performed following retinoic acid (RA)-induced neuroectodermal differentiation of P19 cells. Accordingly, the mRNA levels of NARC-1/PCSK9 peaked at day 2 of differentiation and fell off thereafter. In contrast, the expression of the proprotein convertases subtilisin kexin isozyme 1/site 1 protease and Furin was unaffected by RA, whereas that of PC5/6 and PC2 increased within and/or after the first 4 days of the differentiation period respectively. This pattern was not affected by the cholesterogenic transcription factor sterol regulatory element-binding protein-2, which normally up-regulates NARC-1/PCSK9 mRNA levels in liver. Furthermore, in P19 cells, RA treatment did not affect the protein level of the endogenous LDLR. This agrees with the unique expression pattern of NARC-1/PCSK9 in the rodent CNS, including the cerebellum, where the LDLR is not significantly expressed. Whole-mount in situ hybridization revealed that the pattern of expression of zebrafish NARC-1/PCSK9 is similar to that of mouse both in the CNS and periphery. Specific knockdown of zebrafish NARC-1/PCSK9 mRNA resulted in a general disorganization of cerebellar neurons and loss of hindbrain–midbrain boundaries, leading to embryonic death at ∼ 96 h after fertilization. These data support a novel role for NARC-1/PCSK9 in CNS development, distinct from that in cholesterogenic organs such as liver.

Abbreviations used
α-MEM

modified minimum Eagle's medium

Ctrl

control

dpf

days post-fertilization

DRG

dorsal root ganglia

ECL

enhanced chemiluminescence

FBS

fetal bovine serum

GFAP

glial fibrillary acidic protein

HMG-CoA

3-hydroxy-3-methylglutaryl co-enzyme A

HMGCR

HMG-CoA reductase

hpf

hours post-fertilization

HRP

horseradish peroxidase

ISH

in situ hybridization

LDLR

low-density lipoprotein receptor

mAb

monoclonal antibody

mm

mismatch

MO

morpholino oligonucleotide

NARC-1/PCSK9

neural apoptosis-regulated convertase-1/proprotein convertase subtilisin-kexin like-9

NeuN

neuronal nuclei

(n)SREBP

(nuclear) sterol regulatory element-binding protein

P1

day 1 after birth

PACE

paired basic amino acid cleaving enzyme

PBS

phosphate-buffered saline

PBST

PBS containing 0.1% Tween-20

PC

proprotein convertase

QPCR

quantitative RT–PCR

RA

retinoic acid

RXR

retinoid X receptor

SDS

sodium dodecyl sulfate

SG

spinal ganglia

SKI-1/S1P

subtilisin kexin isozyme 1/site 1 protease

TBST

Tris-buffered saline containing containing 0.1% Tween-20

TN

trigeminal nerve

WT

wild type

zf

zebrafish

The mammalian proprotein convertases (PCs) constitute a family of nine serine proteinases related to bacterial subtilisin. These include the seven basic amino acid- specific convertases known as PC1/3, PC2, Furin, PC4, PACE4, PC5/6 and PC7 (Seidah and Chretien 1999; Zhou et al. 1999), and two proteinases that cleave at non-basic residues, namely subtilisin kexin isozyme 1/site 1 protease (SKI-1/S1P) (Sakai et al. 1998b; Seidah et al. 1999) and neural apoptosis-regulated convertase-1/proprotein convertase subtilisin-kexin like-9 (NARC-1/PCSK9) (Seidah et al. 2003; Benjannet et al. 2004). These proteinases are implicated in the limited proteolysis of precursors of secretory proteins that participate in several biological functions, such as development, reproduction and immune response, and in numerous pathologies, including neurological disorders, infectious diseases, cancer and dyslipidemias (Decroly et al. 1997; Mbikay et al. 1997; Roebroek et al. 1998; Denis et al. 2000; Benjannet et al. 2001; Lenz et al. 2001; Khatib et al. 2002; Seidah and Prat 2002; Thomas 2002; Abifadel et al. 2003).

The PC NARC-1 (Seidah et al. 2003; Benjannet et al. 2004), also known as PCSK9 (Abifadel et al. 2003), was recently characterized and shown to be highly expressed in liver and small intestine. Human point mutations within the NARC-1/PCSK9 coding sequence were reported to be directly associated with either familial hypercholesterolemia in many countries (Abifadel et al. 2003; Benjannet et al. 2004; Timms et al. 2004; Allard et al. 2005; Attie and Seidah 2005; Pisciotta et al. 2005) or familial hypocholesterolemia in black African and American populations (Cohen et al. 2005; Kotowski et al. 2006), probably resulting from gain and loss of function respectively (Attie and Seidah 2005). So far, the only known function of NARC-1/PCSK9 is its ability to enhance the degradation of the low density lipoprotein receptor (LDLR) within an acidic compartment (Benjannet et al. 2004; Maxwell and Breslow 2004; Park et al. 2004), through an unknown mechanism (Attie and Seidah 2005).

Two groups have independently used microarray technology to study mRNAs that are regulated by cholesterol or by the sterol regulatory element-binding proteins (SREBPs), and observed that hepatic rodent NARC-1/PCSK9 expression is up-regulated in SREBP-2 transgenic mice (Horton et al. 2003) and down-regulated by diet-induced excess circulating cholesterol (Maxwell et al. 2003). Recent data from our group demonstrated that NARC-1/PCSK9 mRNA levels are up-regulated in hepatocyte-derived human HepG2 cells and primary hepatocytes by the statins, which are 3-hydroxy-3-methylglutaryl co-enzyme (HMG-CoA) reductase inhibitors, but not by the liver X receptor agonist 22-hydroxycholesterol, nor by the retinoid X receptor agonist 9-cis-retinoic acid (Dubuc et al. 2004). This process can be reversed by mevalonate treatment, in agreement with the implied role of SREBP-2 in the up-regulation of NARC-1/PCSK9 (Dubuc et al. 2004). In contrast to that of NARC-1/PCSK9, the expression of SKI-1/S1P is not sensitive to cholesterol, even though it is a key protease, which, together with the metalloprotease site-2 protease (S2P), activates the formation of the nuclear form of SREBPs (Sakai et al. 1998a; Brown and Goldstein 1999).

During development and in adulthood, NARC-1/PCSK9 is expressed in liver and small intestine, two regenerating organs implicated in cholesterol metabolism. By comparison, NARC-1/PCSK9 is only transiently expressed in cortical cells of the kidney and in specific brain regions where active neurogenesis takes place. These include the telencephalon, rostral extension of the olfactory epithelium and the cerebellum (Seidah et al. 2003). Whether expression in the latter organs is also controlled by cholesterol is unknown. Overexpression of NARC-1/PCSK9 cDNA in primary neurons isolated from telencephalon at embryonic day 12, suggested that this enzyme can enhance neurogenesis of progenitor brain telencephalic cells (Seidah et al. 2003). In order to understand the neural function of NARC-1/PCSK9, we undertook an analysis of its expression in pluripotent mouse P19 embryonal carcinoma cells, which are well suited for studies related to neuroectodermal cell development and maturation. These cells can be efficiently induced to differentiate in culture into neurons and astroglia by combining cell aggregation and brief treatment with all trans-retinoic acid (RA) (Rudnicki et al. 1989; McBurney 1993).

In this study low levels of NARC-1/PCSK9 mRNA were detected in naive P19 cells. Upon neuroectodermal induction of P19 cells by RA, NARC-1/PCSK9 transcripts were induced approximately 7-fold, with a maximum at day 2 of the RA treatment, followed by repression to levels below those of naive P19 cells. These findings suggested that early, transient induction of NARC-1/PCSK9 mRNA may be needed to modulate neurogenesis/gliogenesis, reminiscent of its expression in telencephalon (Seidah et al. 2003). However, in contrast to findings in the liver, NARC-1/PCSK9 mRNA did not seem to be significantly regulated by SREBP-2 in P19 cells and its up-regulation did not affect the protein level of the endogenous LDLR.

We further extended our data into the realm of a whole animal, using the model zebrafish (Danio rerio). As in mouse, zebrafish (zf)-NARC-1/PCSK9 is well expressed in the developing liver and intestine, as well as in cortical neurons and cerebellar granules where continued neurogenesis occurs. Specific knockdown of zf-NARC-1/PCSK9 mRNA in zebrafish embryos using morpholino antisense oligonucleotide technology led to the loss of CNS structures, such as the midbrain and hindbrain, and culminated in lethality at ∼ 3–4 days after fertilization.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Cell culture and neuroectodermal differentiation

Undifferentiated P19 embryonal carcinoma cells were maintained at 37°C under a humidified atmosphere of 5% CO2 in modified minimum Eagle's medium (α-MEM) (Invitrogen-Gibco, Burlington, ON, Canada) supplemented with 10% fetal bovine serum (FBS) (Cansera, Etobicoke, ON, Canada), penicillin (50 U/mL) and streptomycin (50 μg/mL; Gibco), and passaged every 48 h. To allow aggregate formation, 1 × 106 cells were cultured in 100-mm2 bacterial-grade dishes (Fisher, Nepean, ON, Canada) in α-MEM supplemented with 5% FBS and 5% donor bovine serum (Cansera). The neuroectodermal differentiation of these cells was then induced by a 4-day treatment (in quadruplicate, n = 4) or not (control, n = 3) with 500 nm all-trans retinoic acid (RA) (Sigma-Aldrich, Oakville, ON, Canada), with renewal of the medium after 2 days. Aggregates were then dissociated into single cells with 0.025% trypsin−1 mm EDTA (Invitrogen-Gibco) and cells were replated at 1 : 4 in the absence of RA on gelatinized-coated tissues culture dishes in 10 mL Neurobasal medium containing B27 supplement, Glutamax and antibiotics (all products from Invitrogen-Gibco). The medium was replenished after 3 days and cells were maintained until day 10. On selected days, cells were washed three times in phosphate-buffered saline (PBS) and pelleted for further analysis.

Immunocytochemistry of P19 cells

For immunocytochemistry, we used monoclonal antibodies (mAb), at a dilution of 1 : 50, against either neuronal nuclei (NeuN) (Chemicon International, Temecula, CA, USA) or glial fibrillary acidic protein (GFAP) (Sigma-Aldrich), as markers of neurons and glia respectively. Accordingly, naive P19 cells or those cultivated up to day 10 with or without RA induction were successively fixed for 15 min in 4% paraformaldehyde/PBS, permeabilized with 0.1% Triton X-100/PBS, incubated with 150 mm glycine/PBS for 5 min, blocked with 1% bovine serum albumin/PBS (Sigma-Aldrich) for 30 min, and then incubated overnight with each mAb at 4°C. Immunoreactivity was revealed with goat anti-mouse Alexa Fluor®555 (Invitrogen-Molecular Probes, Burlington, ON, Canada) at 1 : 200 dilution in PBS for 45 min, increasing and then stabilizing the fluorophore with a solution of 5% Dabco by weight (Sigma-Aldrich) in 90% glycerol/10% PBS. Immunofluorescence analyses were performed with a Zeiss Axiovert S100 tv microscope (Zeiss Axiovert, Toronto, ON, Canada).

RNA preparation and cDNA synthesis

Total RNA was isolated using TRIzol reagent (Invitrogen, Burlington, ON, Canada) from undifferentiated P19, P19 aggregates and P19-derived neurons according to the recommendations of the manufacturer. Total RNA integrity was verified by 1% ethidium bromide-stained agarose gel according to predominant ribosomal RNA bands. Nucleic acid purification was measured by A260/A280 and values of 1.6–2.0 were considered to indicate pure preparations. Typically, 250 ng total RNA was used for cDNA generation in a total volume of 20 μl using SuperScript II reverse transcriptase, 25 μg/mL oligo(dT)12−18, 0.5 mm 2′-deoxynucleoside 5′-triphosphates and 40 U RNaseOUT; all products were used according to the manufacturer's instructions (Invitrogen).

Quantitative RT–PCR (QPCR)

All primers (Invitrogen) were designed using Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_http://www.cgi) to produce amplicons that overlapped exonic splicing junctions, to avoid genomic DNA amplification (Table 1). The primers were submitted to BLAST databases to verify their specificity. Optimization was evaluated using the MX4000 multiplex quantitative PCR (QPCR) instrument and software (Stratagene, La Jolla, CA, USA). Optimal primer concentrations and cDNA standard curves were obtained for each target gene. All samples were submitted to two independent PCR reactions: one for the normalizing ribosomal protein S16 and the other for the gene of interest, each in triplicate as reported by Dubuc et al. (2004). Each reaction was in a final volume of 25 μl using QuantiTec SYBR green PCR master mix from Qiagen (Mississauga, ON, Canada) in a thermal profile of an activation step (15 min at 95°C) followed by 40 cycles of 30 s at 94°C, 30 s at 58°C and 30 s at 72°C. Relative mRNA levels for each sample were quantified using the Ct approach (fluorescence threshold), normalized with respect to S16 expression as an endogenous RNA standard, and calibrated by setting the control (day 0) at 1. The data shown correspond to representative experiments, in which P19 cells were treated (n = 4) or not treated (n = 3) with RA.

Table 1.   Primers used for QPCR
mRNA assessedForward primerReverse primer
  1. Accession numbers of the chosen QPCR forward and reverse primers are included.

hs14 (NM_001025071)GGCAGACCGAGATGAATCCTCACAGGTCCAGGGGTCTTGGTCC
hPCSK9 (NM_174936)ATCCACGCTTCCTGCTGCCACGGTCACCTGCTCCTG
mS16 (NM_013647)AGGAGCGATTTGCTGGTGTGGGCTACCAGGGCCTTTGAGATG
mPCSK9 (NM_153565)TGCAAAATCAAGGAGCATGGGCAGGGAGCACATTGCATCC
mPCSK5/6AB (XM_129214)ACTCTTCAGAGGGTGGCTAGCTGGAACAGTTCTTGAATC
mPCSK2 (NM_008792)TGACAAGTGGCCTTTCATATCAGGGTCCATTCCTTC
mSKI-1 (NM_019709)GCCCTCAAGTGAGACCTTTGGTCCCACCTCCTGGTTGTAG
mFurin (NM_011046)CATGACTACTCTGCTGATGGGAACGAGAGTGAACTTGGTC
mLdlr (NM_010700)GTATGAGGTTCCTGTCCATCCCTCTGTGGTCTTCTGGTAG
mHMGCR(NM_008255)TCAGAAGTCACATGGTTCACTTGCATGTTAGTCCTTGAGA
mSREBP-2 (NM_033218)GTTCTGGAGACCATGGAGAAACAAATCAGGGAACTCTC

Western blot analysis

Cells were washed three times in PBS and lysed in RIPA buffer [50 mm Tris/HCl, pH 8.0, 1% (v/v) Nonidet P40, 0.5% sodium deoxycholate, 150 mm NaCl and 0.1% (v/v) sodium dodecyl sulfate (SDS)] with a Complete Protease Inhibitor Cocktail (Roche Applied Science, Laval, QC, Canada). Proteins were separated by SDS–polyacrylamide gel electrophoresis (8% gels) and blotted on to HyBond nitrocellulose membranes (Amersham Biosciences, Piscataway, NJ, USA). The blots were incubated for 1 h in TBS-T (50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 0.1% Tween-20) containing 10% non-fat dry milk. PC2 (C-terminal, against amino-acid (Cter) 529–637; Benjannet et al. 1993), LDLR (Abcam, Cambridge, MA, USA), neural adhesion L1 (Kalus et al. 2003) or β-actin (Sigma-Aldrich) antibodies were diluted 1 : 1000, 1 : 2500, 1 : 2000 and 1 : 1000 respectively in the same buffer. After 2 h incubation at room temperature (22°C), membranes were washed and reincubated for 1 h with either donkey anti-rabbit–horseradish peroxidase (HRP) for PC2 and β-actin detection (1 : 5000; Amersham Biosciences) or rabbit anti-chicken-HRP for LDLR detection (1 : 5000; Abcam). Blots were probed using enhanced chemiluminescence (ECL) using an ECL plus kit (Amersham Biosciences).

In situ hybridization (ISH) in mouse

For ISH, mouse sense and antisense cRNA probes coding for mouse NARC-1/PCSK9 (nucleotides 1197–2090) (Seidah et al. 2003) and mouse LDLR (nucleotides 1800–2565; accession no. BC019207) were labeled with [35S]UTP and [35S]CTP (1250 Ci/mmol; Amersham, Oakville, ON, Canada), to obtain high specific activities of ∼ 1000 Ci/mmol. whole C1 mouse cryosections (8–10 µm obtained at day 1 after birth (P1) from unperfused mice were fixed for 1 h in 4% formaldehyde and hybridized overnight at 55°C as described previously (Marcinkiewicz et al. 1999; Seidah et al. 2003). For autoradiography, the sections were dipped in photographic emulsion (NTB-2; Kodak Ile des Soeurs, Verdun, Quebec, Canada), exposed for 6–12 days, developed in D19 solution (Kodak), and stained with hematoxylin.

ISH in zebrafish

In order to prevent the appearance of melanin pigmentation, embryos at approximately 18–24 h post-fertilization (hpf) were grown in egg water supplemented with 0.003% of the tyrosinase inhibitor 1-phenyl-2-thiourea (phenylthiocarbamide; Sigma). Staged embryos were manually dechorionated and fixed for 2 h at room temperature or overnight at 4°C in 4% paraformaldehyde/PBS. After several washes in PBS, embryos were stored in 100% methanol until needed.

For riboprobe synthesis, a 1323-bp PCR fragment of the zf-NARC-1/PCSK9 cDNA comprising the initiator methionine (nucleotides 388–1710) was cloned into pCR 2.1-TOPO, excised with EcoRI and subcloned into pBluescript II. For antisense and sense riboprobe synthesis, T3 and T7 RNA polymerases were used after linearization of the plasmid with SmaI and HindIII respectively. At all stages examined, both sense and antisense probes were analyzed. Whole-mount ISH with digoxygenin-labeled RNA probes and antibody staining were done essentially according to Schulte-Merker et al. (1992) and Thisse et al. (1993) at a hybridization temperature of 70°C. Stained whole-mount embryos were mounted in glycerol and visualized under a Leica MZFLIII stereomicroscope (Leica Microsystems, Richmond Hill, ON, Canada). Images were taken with a Leica DC350F camera (Leica Camera AG, Solms, Germany).

Production of zf-NARC-1/PCSK9 antibody and western blotting

A 14mer peptide (S144IPWNLQRVLQNK156C) corresponding to the predicted N-terminal 144–156 sequence of mature zf-NARC-1/PCSK9 following cleavage of the propeptide (Fig. S3) was synthesized with an additional cysteine residue at the C-terminus using solid-phase chemistry (Peptide Synthesis Facility of the Sheldon Biotechnology Center, McGill University, Montreal, QC, Canada). The peptide was coupled through the C-terminal cysteine residue to keyhole limpet hemocyanin and a polyclonal antibody was raised in rabbit by immunization with the conjugate. The antiserum was purified on a peptide affinity column before use.

Single zebrafish embryos at 24 hpf were solubilized in 30 μl 2 × Laemmli buffer (125 mm Tris, pH 6.8, 20% glycerol, 4% SDS, 0.2% bromophenol blue, 0.01% 2-mercaptoethanol), heated at 96°C for 10 min, and centrifuged in a microfuge at 13 000 g for 15 min. Proteins were separated by SDS–polyacrylamide gel electrophoresis (10% gels) and blotted on to HyBond-C Extra nitrocellulose membranes (Amersham). Blots were blocked with 0.5% membrane blocking agent (Amersham) overnight at 4°C and incubated with primary antiserum against zf-NARC-1/PCSK9, which was diluted to 1 : 4000 in 0.25% membrane-blocking agent (Amersham)/PBST (0.01 m KH2PO4, 0.1 m Na2HPO4, 1.4 m NaCl, 0.03 m KCl, pH 7.4, containing 0.1% Tween-20) for 1 h at room temperature, followed by three washes in PBST. The membrane was then incubated with donkey anti-rabbit–HRP secondary antibody (Amersham) diluted to 1 : 4000 in PBST, followed by six washes with PBST. The blot was developed by ECL, with monitoring for chemiluminescence according the manufacturer's instructions, and developed using Hyperfilm (Amersham). The membrane was then stripped by incubating for 30 min at 60°C in stripping buffer (65 mm Tris pH 6.7, 2% SDS) and probed for actin using anti-actin antibody (Sigma) diluted at 1 : 500 for 1 h at room temperature. After three washes with PBST, the membrane was incubated with goat anti-mouse–HRP (Calbiochem, La Jolla, CA, USA) secondary antibody at 1 : 4000 dilution, for 1 h at RT. The blot was developed for chemiluminescence as outlined above.

Maintenance of zebrafish and morpholino oligonucleotide (MO) microinjection

Adult zebrafish were obtained from Scientific Hatcheries (Huntington Beach, CA, USA) and maintained within a controlled light–dark cycle at 28.5°C (Westerfield 2000). Embryos were developed under identical conditions in water containing 0.006% Instant Ocean salts. MOs were obtained from Gene Tools, Inc. (Philomath, OR, USA) and diluted to 5 ng/nL in Danieaux buffer [58 mm NaCl, 0.7 mm KCl, 0.4 mm MgSO4, 0.6 mm Ca(NO3)2, 5.0 mm Hepes pH 7.6] containing 0.1% phenol red (Nasevicius and Ekker 2000). Approximately 2 nL (10 ng MO) was injected into the yolk of one- to two-cell stage embryos using a PLI-100 microinjection system (Harvard Apparatus, St Laurent, QC, Canada). Phenotypic observation and documentation were accomplished using a Leica DC300F digital camera connected to a Leica MZFLIII stereomicroscope. Morpholino sequences were: MO1, 5′-GACGCTTCTCATTCTCTGTGCTTTC-3′; five base-pair mismatch (MO1-mm), 5′-GAGGCTTGTCATTGTCTCTGGTTTC-3′; and negative scramble control (Ctrl), 5′-CCTCTTACCTCAGTTACAATTTATA-3′.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Neuroectodermal differentiation of P19 cells and the neuroendocrine convertase PC2

We used the pluripotent P19 cell line as a model to study whether NARC-1/PCSK9 was associated with neuroectodermal induction and/or differentiation. Accordingly, P19 cells were induced to differentiate into neuroectodermal derivatives following aggregation in the presence of 500 nm RA (days 0–4). Upon dissociation of the aggregates, the induced cells were cultured for another 6 days (days 5–10) as adherent monolayers in the absence of RA, resulting in neurite outgrowth (already visible at day 7; not shown) extending from neuronal cells (see arrows in left panels of Fig. 1). In order to assess the extent of neuronal (NeuN positive) versus glial (GFAP positive) differentiation induced by RA, we labeled the cells with mAbs against these markers. At day 10 after RA treatment > 95% cells expressed NeuN, whereas < 5% expressed GFAP (Fig. 1), both being induced by RA treatment (Fig. 1 and Fig. S1). Therefore, we conclude that the RA-treated cell population at day 10 is mostly (> 95%) composed of neuronal cells.

image

Figure 1.  Immunocytochemistry of RA-treated P19 cells at day 10. The type of mAb used (NeuN or GFAP) is shown (right panels). The left panels show the cells under visible light. Arrows point to neural extensions.

Download figure to PowerPoint

To follow the neural differentiation process, we also used the neuroendocrine PC2 (Seidah et al. 1990; Scopsi et al. 1995; Jeannotte et al. 1997) as a marker. This convertase is responsible for the processing of numerous precursors of polypeptide hormones within secretory granules, such as pro-opiomelanocortin (Benjannet et al. 1991), proenkephalin (Breslin et al. 1993), prosomatostatin (Galanopoulou et al. 1995) and prodynorphin (Berman et al. 2000). Its precursor proPC2 (∼74 kDa) is autocatalytically processed within secretory granules into mature PC2 (∼67 kDa) (Benjannet et al. 1993). Thus, both the mRNA expression level of PC2 (QPCR; Fig. 2a) and the extent of its zymogen processing (western blotting; Fig. 2b) were expected to increase upon neuroectodermal differentiation. Indeed, treatment with RA resulted in a ∼ 350-fold up-regulation of PC2 mRNA at day 10 (compared with the control at day 0), whereas in the absence of RA only a ∼ 30-fold increase was observed (Fig. 2a). Western blot analysis confirmed these data; both proPC2 and PC2 were up-regulated and the PC2/proPC2 ratio reached a maximum (≥ 0.55) at days 8–10 (Fig. 2b), which is in accord with a more favorable neuroendocrine environment for the autocatalytic zymogen processing of proPC2 into PC2 at these late stages. A similar up-regulation of neurofilament M protein was observed (not shown).

image

Figure 2.  PC2 as a neuronal marker. Undifferentiated P19 cells (day 0), RA-treated P19 aggregates (days 1–4) and P19 derived-neurons (days 5–10) were collected every 24 h. (a) Relative PC2 mRNA expression analyzed by QPCR. PC2 expression was normalized with respect to that of ribosomal protein S16 and calibrated with that found in undifferentiated cells (day 0). The histogram shown is representative of three and four independent differentiations on untreated and treated cells respectively. Each QPCR experiment was done in triplicate; values are mean ± SEM. (b) Immunoblot analyses of PC2 protein and β-actin marker during neuroectodermal differentiation of P19 cells. (c) Results of the ImageQuant quantitation of the PC2 and proPC2 arbitrary protein levels.

Download figure to PowerPoint

Uniqueness of the NARC-1/PCSK9 expression profile during neuroectodermal differentiation of P19 cells

The mRNA expression profile of NARC-1/PCSK9 was very different from that of PC2 (Fig. 3). A maximum expression level (∼ 7-fold) was attained at day 2 during RA exposure, and then abruptly decreased to reach levels ∼ 3–5-fold below those of undifferentiated P19 cells from day 3 onwards up to day 10. This repression after the aggregation period was also observed in the absence of RA treatment, suggesting that it may be related to P19 cell handling and/or culture conditions. RA and not cell aggregation caused the transient up-regulation of NARC-1/PCSK9 because aggregation in the absence of RA coincided with the convertase down-regulation at day 2 (Fig. 3).

image

Figure 3.  QPCR profiles of NARC-1/PCSK9, PC5/6, Furin and SKI-1/S1P during neuroectodermal differentiation of P19 cells. Each sample was normalized with respect to ribosomal protein S16 expression and calibrated with undifferentiated cells (day 0). Values are mean ± SEM.

Download figure to PowerPoint

Neuroectodermal cell derivatives are also obtained when a 4-day RA treatment is applied to cell monolayers instead of aggregates, but the proportion of neurons in the differentiated populations is decreased, whereas fibroblast-like cells are abundant (Laplante et al. 2004). For comparison, RA was incubated with either adherent or suspended P19 cells for 4 days, and then the cells were replated at the end of day 4 and cultured until day 10. Morphological analysis at day 10 revealed ∼ 50% less neuritic extensions in the adherent cell protocol compared with the suspension/aggregate one. Furthermore, PC2 mRNA up-regulation was less pronounced with the adherent P19 cells (∼150-fold increase; not shown). Nevertheless, when the 4-day RA treatment was applied to adherent P19 cells, the peak of NARC-1/PCSK9 mRNA expression was observed at day 2 (not shown), similar to that noted during RA treatment of suspended P19 aggregates. Thus, RA can induce the expression of NARC-1/PCSK9 in both adherent and suspended P19 cells. Unfortunately, when a polyclonal antibody raised against mouse NARC-1/PCSK9 was used (N. Nassouri and N. G. Seidah, unpublished data), western blots or biosynthetic analyses were not sensitive enough for the detection of endogenous NARC-1/PCSK9 protein expression in P19 cells before and after RA treatment (not shown). Therefore, it was not possible to define the fate of NARC-1/PCSK9-positive cells that were induced by RA treatment, or to determine whether they would differentiate into glia or neurons at days 6–10. In contrast to observations in P19 cells, the up-regulation of NARC-1/PCSK9 by RA treatment was not detected in adherent HepG2 cells (Fig. S2), indicating either that the RA effect is indirect or that P19 cells contain an extra factor(s) that is absent from HepG2 cells.

In a similar fashion, we analyzed the mRNA profile of the regulated PC, PC5/6, and those of the constitutively expressed ubiquitous convertases Furin and SKI-1/S1P (Seidah et al. 2003). Furin and SKI-1/S1P did not exhibit significant quantitative variations in their profiles throughout the differentiation programme, whereas PC5/6 showed a similar profile to that of PC2, increasing gradually and reaching a maximum at day 10 (∼ 14-fold). Interestingly, we consistently observed the presence of a peak of PC5/6 expression (∼ 4-fold increase) at day 2.

Analysis of the cholesterogenic genes encoding HMG-CoA reductase and LDLR

Because NARC-1/PCSK9 was shown to be down-regulated by cholesterol in the liver (Maxwell et al. 2003), probably through the decreased activation of SREBP-2, it was of interest to test whether the observed NARC-1/PCSK9 up-regulation in P19 cells following RA treatment (Fig. 3) was concomitant with that of cholesterogenic genes. However, mRNA levels of SREBP-2 were not significantly affected by the RA treatment (not shown). Furthermore, the expression profile of HMG-CoA reductase, a key limiting enzyme involved in cholesterol synthesis that is strongly up-regulated by active SREBP-2 (Horton et al. 2002), was very different from that of NARC-1/PCSK9 (Fig. 4a). It reached a plateau at days 9–10, but did not significantly peak at day 2, the time at which NARC-1/PCSK9 mRNA levels were maximal (Fig. 3). This indicated that in P19 cells the RA-induced up-regulation of NARC-1/PCSK9 mRNA at day 2 most probably involves another regulatory mechanism.

image

Figure 4.  Cholesterol-independent role of NARC-1/PCSK9 in P19 cells. (a) QPCR analysis of the relative HMG-CoA reductase (HMGCR) mRNA levels. (b) Immunoblot analysis of LDLR levels on days 0–4 in RA-treated P19 cells. The migration positions of the LDLR (∼ 160 kDa) and the internal standard β-actin (∼ 42 kDa) are shown. (c) Comparative ISH of mouse NARC-1/PCSK9 and LDLR at P1. SG, spinal ganglia; DRG, dorsal root ganglia; TN, trigeminal nerve.

Download figure to PowerPoint

NARC-1/PCSK9 is known to enhance the degradation of the LDLR (Maxwell and Breslow 2004), via an indirect mechanism (Benjannet et al. 2004) and in a cell- and tissue-specific manner (Park et al. 2004). As expected from the data obtained for HMG-CoA reductase, QPCR analysis revealed that mRNA levels of the LDLR were not significantly altered by RA treatment (not shown). In addition, the peak of NARC-1/PCSK9 expression at day 2 did not affect LDLR protein levels, as analyzed by western blotting (done in triplicate at days 0–4; Fig. 4b). NARC-1/PCSK9 may thus fulfill other function(s) in these cells. Accordingly, comparative ISH analysis of NARC-1/PCSK9 and LDLR mRNAs in a whole mouse at P1 (Fig. 4c) revealed that, apart from liver and intestine where both mRNAs were abundant and co-localized, their expression was unique. Thus, the LDLR was widely distributed, with notable hotspots of expression in the thymus, teeth, spinal and dorsal root ganglia and trigeminal nerve. In contrast, NARC-1/PCSK9 was detected in few tissues other than liver and intestine, including cerebellar neurons (Seidah et al. 2003) where LDLR expression was not prominent (Fig. 4c).

Cloning and developmental expression of NARC-1/PCSK9 in zebrafish

Several attempts to knockdown the NARC-1/PCSK9 mRNA in P19 cells using various short interfering RNAs and transfection conditions failed to decrease efficiently the level of endogenous NARC-1/PCSK9 mRNA at day 2, the time of maximal expression, even though we obtained a ∼ 60% reduction at day 0 (not shown). Accordingly, we decided to test the implications of NARC-1/PCSK9 in the development of the nervous system in vivo using antisense MO knockdown approaches in the zebrafish. Alignment of human and rodent NARC-1/PCSK9 cDNAs with the zebrafish genome allowed us to identify a zebrafish ortholog using a combination of Ensembl and University of California, Santa Cruz (UCSC) annotations. The Ensembl gene from nucleotides 162 004–191 952 coding for zf-NARC-1/PCSK9 can be found at http://www.ensembl.org/Danio_rerio/geneview?gene=ENSDARG00000037996;db=core. The UCSC zebrafish 5606-bp annotation was found on chromosome 7 (http://genome.ucsc.edu/cgi-bin/hgTracks?hgsid=60551137&hgt.right1=+%3E+&position=chr7%3A14772303-14775302). Thus, a single NARC-1/PCSK9 gene was detected in the zebrafish genome, which exhibited 68% protein identity within the catalytic subunit of its mouse ortholog. The complete assembled sequence of zf-NARC-1/PCSK9, together with its predicted signal peptide and post-translational modifications, are shown in Fig. S3.

Based on this sequence information, we analyzed by RT–PCR the developmental expression of zf-NARC-1/PCSK9 (Fig. 5a). The data showed that zf-NARC-1/PCSK9 transcripts were detectable at the three-somite stage, coinciding with the onset of cell fate acquisition within proneural domains (neurogenesis occurs in the three-to-five somite stage) (Westerfield 2000; Korzh et al. 2001; Lossi and Merighi 2003). Using ISH with a 1323-base zf-NARC-1/PCSK9-specific cRNA probe (Fig. S3), we analyzed the expression of this convertase at the six-somite stage (Fig. 5b) and 4–5 days post-fertilization (dpf) periods (Fig. 5c). At 12 hpf (six somites) zf-NARC-1/PCSK9 was ubiquitously expressed throughout the epiblast, with higher levels within the presumptive notochord. At 4–5 dpf the enzyme was highly expressed in liver and intestine, as in mouse and rat (Seidah et al. 2003). Within the neural network, it was found in centers of continued neurogenesis such as cortical and intracranial neurons and cerebellar granule cell precursors (Fig. 5c). Thus, NARC-1/PCSK9 is expressed in specialized neurogenic centers in both zebrafish and mammals.

image

Figure 5.  Developmental expression of zf-NARC-1/PCSK9. (a) RT–PCR analysis of NARC-1/PCSK9 expression in zebrafish during gastrulation/segmentation. Actin was used as an internal standard. In situ hybridization of zf-NARC-1/PCSK9 (b) 12 hpf at the six-somite stage, and (c) at 4 and 5 dpf.

Download figure to PowerPoint

Knockdown of NARC-1/PCSK9 in zebrafish

We next used the technology of MO-based translation inhibition of NARC-1/PCSK9 using the zebrafish as a model of vertebrate development. From the deduced assembled sequence of zf-NARC-1/PCSK9 mRNA, we identified a unique sequence comprising the initiator methionine which was used to synthesize an antisense MO (MO1) (Fig. S3). In order to avoid non-specific gene targeting, we performed Blast analyses of zebrafish genomic sequences and confirmed the uniqueness of the chosen MO1. Furthermore, to test the specificity of the MOs we generated an affinity-purified polyclonal antibody against the N-terminal 144–156 peptide sequence of the catalytic subunit of zf-NARC-1/PCSK9 (sequence S144IPWNLQRVLQNK156; Fig. S3). Using this antibody we performed western blots of single embryos and showed that injection of MO1 reduced the protein level of endogenous zf-NARC-1/PCSK9 by ∼ 60%, whereas the other two control MOs, including an MO1 5-bp mismatch (MO1-mm) and a standard scramble control (Scramble Ctrl), had no effect (Fig. 6a). Injection of MO1 in zebrafish eggs resulted in CNS degeneration with high penetrance (Fig. 6b), compared with findings for the MO1-mm and Scramble control MOs, which yielded much decreased phenotypic penetrance or normal CNS development respectively (Fig. 6b). At 24 hpf a small cleft, presumed to be the hindbrain, represented the only discernable CNS architecture within morphant embryos (Figs 6c and d). By 48 hpf abnormal neurogenesis continued, creating multiple neural chambers in an anterior–posterior orientation (Figs 6e and f). These defects culminated in lethality between 48 and 96 hpf (Figs 6g and h). These data suggest that NARC-1/PCSK9 is an essential gene in zebrafish.

image

Figure 6.  Validation of morpholino-based translation inhibition and phenotypic consequences of zf-NARC-1/PCSK9 knockdown. MOs directed against the starter methionine of zf-NARC-1/PCSK9 (MO1), its 5-bp mismatch (MO1-mm) and scramble control (Scramble Ctrl) at 10 ng each were injected into one- to two-cell stage embryos and overall morphology assessed at 24 hpf. (a) Knockdown of zf-NARC-1/PCSK9 protein following morpholino injection in vivo. Western blot analysis of embryos injected with 10 ng zf-NARC-1/PCSK9 or control morpholinos using rabbit zf-NARC-1/PCSK9 polyclonal antibody (upper panel) and anti-mouse actin monoclonal antibody as a loading control (lower panel). Protein extracted from single 24 hpf embryo was loaded on to each lane. WT, uninjected. (b) CNS degeneration was observed with the following frequencies: 50 of 54 (MO1), eight of 48 (MO1-mm) and none of 50 (Scramble Ctrl), expressed as percentages in the histogram. (c) WT and (d) MO1-injected embryos at 24 hpf displayed defective neurogenesis including absence of tectum (red arrow), midbrain–hindbrain boundary (arrowhead) and decreased hindbrain architecture (black arrow and asterisk). Comparison of (e) WT and (f) MO1-injected embryos at 48 hpf indicated the presence of further abnormalities in neural development. (e–h) These defects culminated in lethality between 48 and 96 hpf.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Initial studies showed that NARC-1/PCSK9 is transiently expressed during embryonic development in neurogenic centers such as those in the telencephalon and cerebellum, and that it is no longer expressed in mature CNS neurons of rodents (Seidah et al. 2003). We undertook a study of the possible role of this convertase in neuroectodermal differentiation using P19 cells and zebrafish as models. The data revealed that upon RA induction of P19 cells leading to neurons and glial cells, NARC-1/PCSK9 mRNA levels peak at day 2 and fall off thereafter, a profile quite different from that of the other convertases (Fig. 3). This suggests that NARC-1/PCSK9 may have a unique role at the onset of the neuronal/neuroectodermal differentiation process. Interestingly, a minor but statistically significant peak of PC5/6 mRNA at day 2 was also observed, reminiscent of the up-regulation of both NARC-1/PCSK9 and PC5/6 during liver regeneration following partial hepatectomy in rat (Seidah et al. 2003). Thus, it may well be that NARC-1/PCSK9 and PC5/6 have complementary and/or additive roles in the predifferentiation period.

We next attempted to elucidate the mechanism behind the up-regulation of NARC-1/PCSK9 at day 2 in P19 cells. This effect was only observed following RA treatment of either adherent cells or aggregated cells in suspension, but not in untreated controls. Accordingly, we deduced that the aggregation step is not responsible for the observed up-regulation, but rather that RA is the inducing agent. In the nucleus, the RA signal is transduced by binding to a heterodimeric pair of retinoid receptors, retinoic acid receptor/retinoid X receptor (Means and Gudas 1995). Because HepG2 cells, which express both receptors (Denson et al. 2000), do not up-regulate the NARC-1/PCSK9 transcripts when treated with RA (Fig. S2), it is likely that the effect of RA in P19 cells is indirect, possibly involving activation of intervening proteins or transcription factors (Wei et al. 2002), which may then up-regulate NARC-1/PCSK9 mRNA levels. Furthermore, no apparent RA-responsive element could be identified in the proximal ∼ 2 kb of the mouse and human PCSK9 promoters (not shown).

Because NARC-1/PCSK9 transcription is highly up-regulated by SREBP-2 (Horton et al. 2003; Dubuc et al. 2004), we next turned our attention to the effect of RA on SREBP-2 transcription, and found that it was unchanged during the differentiation programme (not shown). However, because it is mostly the nuclear nSREBP-2 protein that is the active ingredient, it is plausible that the activation of the Golgi form of SREBP-2 into its nuclear form nSREBP-2 by the concerted action of SKI-1/S1P and S2P (Brown et al. 2000) may be limiting. Our data revealed that the transcription of SKI-1/S1P was not regulated by RA in P19 cells (Fig. 3). Furthermore, the mRNA levels of the limiting HMG-CoA reductase, which critically depends on nSREBP-2 activity, only increased from days 5–10, indicating that nSREBP-2 is not the key NARC-1/PCSK9 transcription factor at day 2 (Fig. 3). We cannot at the present time eliminate the possibility that the peak observed at day 2 may be due to an enhanced specific stabilization of NARC-1/PCSK9 mRNA, possibly via specific interactions with its 5′ untranslated region, as was the case for insulin, PC1 and PC2 mRNAs at high glucose levels (Schuppin and Rhodes 1996), rather than direct transcriptional activation. However, this mechanism would have to be quite restrictive because mRNA levels of the cholesterogenic genes encoding HMG-CoA reductase, LDLR, SKI-1/S1P and SREBP-2 did not peak at day 2.

The only attributable function of NARC-1/PCSK9 is enhancement of degradation of the LDLR in liver and hepatocyte-derived cell lines (Benjannet et al. 2004; Maxwell and Breslow 2004; Park et al. 2004; Rashid et al. 2005). However, the mechanism behind this effect is not understood, as it does not seem to result from direct cleavage of the LDLR by NARC-1/PCSK9 in an acidic compartment (Attie and Seidah 2005). This suggests that in liver NARC-1/PCSK9 may activate and/or change the trafficking of another protein(s) that is responsible for the degradation of the LDLR. Because the protein level of the LDLR in P19 cells treated with RA did not change from days 0–4 (Fig. 4b), even though NARC-1/PCSK9 was up-regulated at day 2, this indicates that the cellular conditions in P19 cells may not be appropriate for LDLR-enhanced degradation by NARC-1/PCSK9. This led us to conclude that, similar to findings in Chinese hamster ovary cells (Park et al. 2004), the NARC-1/PCSK9-induced enhanced degradation of the LDLR is not efficient in P19 cells, and that NARC-1/PCSK9 may have other function(s) in these cells. Indeed, comparative ISH of NARC-1/PCSK9 and LDLR in consecutive sections of a whole mouse on the first day after birth (P1) revealed both distinct and overlapping expression patterns (Fig. 4c). Thus, both mRNAs were co-localized in liver, intestine and kidney, whereas the high level of expression of NARC-1/PCSK9 in cerebellum did not coincide with that of the LDLR, which is generally not abundant in the CNS. Therefore, NARC-1/PCSK9 may have new functions in the nervous system, possibly related to neurogenesis, among others (Seidah et al. 2003). This may involve the NARC-1/PCSK9-enhanced degradation of other receptor types or proteins during development of the cerebellum and telencephalon.

We decided to study such function(s) within the realm of a whole animal such as the zebrafish, which represents a well studied experimental model as it develops externally with visual clarity. These qualities, together with antisense-based translation inhibition techniques, allow visual phenotypic assessment of targeted gene knockdown. Mining of zebrafish genomic databases allowed us to put together a complete primary structure of zf-NARC-1/PCSK9 (Fig. S3). The deduced sequence predicts a 667-amino acid proprotein with a 22-amino acid signal peptide (amino acids 1–22), and a 121-amino acid prosegment (amino acids 23–143), resulting in a 525-amino acid mature protein. The zymogen activation site predicted at SSIFAQ143[DOWNWARDS ARROW]SIPWN is very similar to that found in human and mouse, with the only conservative variation of zebrafish Ile140 to Val in mammals. Notably, we also deduced the possible presence of an extra N-glycosylation site within the prosegment of zf-NARC-1/PCSK9 (Asn75) that is not found in mammalian orthologs. Finally, the C-terminal Cys/His-rich domain of zf-NARC-1/PCSK9 is similar to that found in the human and mouse sequences, with the presence of two CysCys-X6-Cys motifs.

We used MOs selectively to inhibit zf-NARC-1/PCSK9 translation (Fig. 6), to create morphant phenotypes and to document the resulting visible morphological defects. Based on murine NARC-1/PCSK9 gene expression patterns (Seidah et al. 2003), it was predicted that defects would be associated with neural and/or hepatic/intestinal/renal organogenesis. In the zebrafish, neurogenesis begins postgastrulation (approximately 10 hpf) with the formation of the neural plate, a conserved vertebrate structure. The neural plate then undergoes anterior–posterior patterning during segmentation, creating visible regionalized structures by 24 hpf (Schier et al. 1996). Hepatic cell fate specification from the presumptive anterior endoderm begins at approximately 16–18 hpf before primitive gut tube formation (Korzh et al. 2001). However, the liver only acquires a histologically distinct architecture at 34 hpf (Wallace and Pack 2003). At 24 hpf, embryos injected with MO1 displayed defective neurogenesis (Fig. 6d) as compared with wild type (WT) (Fig. 6c). This included absence of tectum (red arrow), midbrain–hindbrain boundary (arrow head), as well as decreased hindbrain architecture (black arrow and asterisk) (Figs 6c and d). Comparison of WT (Fig. 6e) and MO1-injected (Fig. 6f) embryos at 48 hpf indicated the presence of further abnormalities in neural development. The observed overall neural degeneration was followed by regionalization at 48 hpf into several chambers of unknown identity (Fig. 6f). The knockdown of zf-NARC-1/PCSK9 expression resulted in an ∼ 60% decreased in protein levels, but not complete loss of protein (Fig. 6a). The specific phenotypes observed suggest that in zebrafish neurogenesis is highly sensitive to altered NARC-1/PCSK9 expression. This is reminiscent of the effects observed in human NARC-1/PCSK9 heterozygote missense mutations (50% loss of function), resulting in familial hypocholesterolemia (Cohen et al. 2005; Kotowski et al. 2006). It remains unclear at this time whether hepatic specification or liver organogenesis is affected in the zf-NARC-1/PCSK9 morphants. Further investigation by marker gene in situ and histological analysis is required.

The refractile (as opposed to transparent) appearance of neural tissue in morphants is a hallmark of cell death, particularly associated with neural degeneration, and was used initially to identify neuron survival mutants in large-scale zebrafish chemical mutagenesis screens (Furutani-Seiki et al. 1996). Although not visibly evident, apoptosis is an essential component of normal neurogenesis, whereby neuronal pathways form via axonal extension in a ‘first-come-first-served’ basis, requiring redundant projections to undergo programmed cell death (Lossi and Merighi 2003). The close association between differentiation and apoptosis during neurogenesis may confer increased sensitivity to cellular alterations, particularly those affecting the cell cycle and metabolism (Furutani-Seiki et al. 1996). Interestingly, the known autosomal dominant natural human NARC-1/PCSK9 mutations resulting in hypercholesterolemia place this gene within such a metabolic context (Abifadel et al. 2003; Benjannet et al. 2004; Timms et al. 2004; Attie and Seidah 2005).

While this work was in progress, the complete knockout of NARC-1/PCSK9 in mouse was reported (Rashid et al. 2005). The latter work confirmed earlier studies, showing that NARC-1/PCSK9 enhances degradation of the LDLR; its loss would therefore result in higher hepatic LDLR levels (Benjannet et al. 2004; Maxwell and Breslow 2004; Park et al. 2004). Nevertheless, it was astonishing to discover that in mouse the loss of NARC-1/PCSK9 expression does not result in a lethal phenotype (Rashid et al. 2005), as is the case in zebrafish (this work).

The association of NARC-1/PCSK9 with LDLR degradation is insufficient to explain the zebrafish morphant defects because LDLR–/– mice are viable (Ishibashi et al. 1993), suggesting that this PC embodies biological activities beyond LDLR homeostasis, as also suggested by its expression in brain areas lacking the LDLR (Fig. 4c). Nevertheless, differences do exist between the mouse and zebrafish, including the absence of placenta and external embryonic growth in the fish. In this context, a recent study on Veph showed that the knockdown of this transiently expressed CNS protein in neurogenesis centers results in a lethal phenotype in zebrafish but not in Veph–/– mice (Muto et al. 2004). Death in developing zebrafish lacking Veph transcripts seems to follow defects in the midbrain–hindbrain boundary and otic vesicle formation. A similar phenotype was observed upon knockdown of zf-NARC-1/PCSK9, with defective neurogenesis including loss of the tectum and midbrain–hindbrain boundary, as well as disorganized hindbrain architecture (Figs 6c and d). It remains to be seen whether NARC-1/PCSK9 has different functions in mammals and fish. Alternatively, the CNS of mammals may have developed mechanisms to compensate for the lack of NARC-1/PCSK9 that are absent in teleosts. Detailed mapping of the functional domains of NARC-1/PCSK9 in zebrafish and mouse may lead to a better understanding of the various functions of this fascinating convertase.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We would especially like to thank Johanne Duhaime for excellent assistance in identifying and concatenation of the zf-NARC-1/PCSK9 cDNA sequences. We also wish to thank Ann Chamberland for QPCR analyses, Marie-Claude Asselin for cell culture and Josée Hamelin for cDNA cloning of mouse LDLR. The authors are also indebted to all the members of Dr Seidah's laboratory for their constant advice and help. The secretarial assistance of Mrs Brigitte Mary is greatly appreciated. This work was supported in part by the Canadian Institutes of Health Research grants: MOP-36496, a Canadian Chair no. 201652, MGP-44363, and by a group grant MGC-64518.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • Abifadel M., Varret M., Rabes J. P. et al. (2003) Mutations in PCSK9 cause autosomal dominant hypercholesterolemia. Nat. Genet. 34, 154156.
  • Allard D., Amsellem S., Abifadel M. et al. (2005) Novel mutations of the PCSK9 gene cause variable phenotype of autosomal dominant hypercholesterolemia. Hum. Mutat. 26, 497.
    Direct Link:
  • Attie A. D. and Seidah N. G. (2005) Dual regulation of the LDL receptor – some clarity and new questions. Cell Metab. 1, 290292.
  • Benjannet S., Rondeau N., Day R., Chretien M. and Seidah N. G. (1991) PC1 and PC2 are proprotein convertases capable of cleaving proopiomelanocortin at distinct pairs of basic residues. Proc. Natl Acad. Sci. USA 88, 35643568.
  • Benjannet S., Rondeau N., Paquet L., Boudreault A., Lazure C., Chretien M. and Seidah N. G. (1993) Comparative biosynthesis, covalent post-translational modifications and efficiency of prosegment cleavage of the prohormone convertases PC1 and PC2: glycosylation, sulphation and identification of the intracellular site of prosegment cleavage of PC1 and PC2. Biochem. J. 294, 735743.
  • Benjannet S., Elagoz A., Wickham L. et al. (2001) Post-translational processing of beta-secretase (beta-amyloid-converting enzyme) and its ectodomain shedding. The pro- and transmembrane/cytosolic domains affect its cellular activity and amyloid-beta production. J. Biol. Chem. 276, 10 87910 887.
  • Benjannet S., Rhainds D., Essalmani R. et al. (2004) NARC-1/PCSK9 and its natural mutants: zymogen cleavage and effects on the low density lipoprotein (LDL) receptor and LDL cholesterol. J. Biol. Chem. 279, 48 86548 875.
  • Berman Y., Mzhavia N., Polonskaia A., Furuta M., Steiner D. F., Pintar J. E. and Devi L. A. (2000) Defective prodynorphin processing in mice lacking prohormone convertase PC2. J. Neurochem. 75, 17631770.
  • Breslin M. B., Lindberg I., Benjannet S., Mathis J. P., Lazure C. and Seidah N. G. (1993) Differential processing of proenkephalin by prohormone convertases 1(3) and 2 and furin. J. Biol. Chem. 268, 27 08427 093.
  • Brown M. S. and Goldstein J. L. (1999) A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood. Proc. Natl Acad. Sci. USA 96, 11 04111 048.
  • Brown M. S., Ye J., Rawson R. B. and Goldstein J. L. (2000) Regulated intramembrane proteolysis: a control mechanism conserved from bacteria to humans. Cell 100, 391398.
  • Cohen J., Pertsemlidis A., Kotowski I. K., Graham R., Garcia C. K. and Hobbs H. H. (2005) Low LDL cholesterol in individuals of African descent resulting from frequent nonsense mutations in PCSK9. Nat. Genet. 37, 161165.
  • Decroly E., Benjannet S., Savaria D. and Seidah N. G. (1997) Comparative functional role of PC7 and furin in the processing of the HIV envelope glycoprotein gp160. FEBS Lett. 405, 6872.
  • Denis F., Shoukry N. H., Delcourt M., Thibodeau J., Labrecque N., McGrath H., Munzer J. S., Seidah N. G. and Sekaly R. P. (2000) Alternative proteolytic processing of mouse mammary tumor virus superantigens. J. Virol. 74, 30673073.
  • Denson L. A., Auld K. L., Schiek D. S., McClure M. H., Mangelsdorf D. J. and Karpen S. J. (2000) Interleukin-1beta suppresses retinoid transactivation of two hepatic transporter genes involved in bile formation. J. Biol. Chem. 275, 88358843.
  • Dubuc G., Chamberland A., Wassef H., Davignon J., Seidah N. G., Bernier L. and Prat A. (2004) Statins upregulate PCSK9, the gene encoding the proprotein convertase neural apoptosis-regulated convertase-1 implicated in familial hypercholesterolemia. Arterioscler. Thromb. Vasc. Biol. 24, 14541459.
  • Furutani-Seiki M., Jiang Y. J., Brand M. et al. (1996) Neural degeneration mutants in the zebrafish, Danio rerio. Development 123, 229239.
  • Galanopoulou A. S., Seidah N. G. and Patel Y. C. (1995) Heterologous processing of rat prosomatostatin to somatostatin-14 by PC2: requirement for secretory cell but not the secretion granule. Biochem. J. 311, 111118.
  • Horton J. D., Goldstein J. L. and Brown M. S. (2002) SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 109, 11251131.
  • Horton J. D., Shah N. A., Warrington J. A., Anderson N. N., Park S. W., Brown M. S. and Goldstein J. L. (2003) Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc. Natl Acad. Sci. USA 100, 12 02712 032.
  • Ishibashi S., Brown M. S., Goldstein J. L., Gerard R. D., Hammer R. E. and Herz J. (1993) Hypercholesterolemia in low density lipoprotein receptor knockout mice and its reversal by adenovirus-mediated gene delivery. J. Clin. Invest. 92, 883893.
  • Jeannotte R., Paquin J., Petit-Turcotte C. and Day R. (1997) Convertase PC2 and the neuroendocrine polypeptide 7B2 are co-induced and processed during neuronal differentiation of P19 embryonal carcinoma cells. DNA Cell Biol. 16, 11751187.
  • Kalus I., Schnegelsberg B., Seidah N. G., Kleene R. and Schachner M. (2003) The proprotein convertase PC5A and a metalloprotease are involved in the proteolytic processing of the neural adhesion molecule L1. J. Biol. Chem. 278, 10 38110 388.
  • Khatib A. M., Siegfried G., Chretien M., Metrakos P. and Seidah N. G. (2002) Proprotein convertases in tumor progression and malignancy: novel targets in cancer therapy. Am. J. Pathol. 160, 19211935.
  • Korzh S., Emelyanov A. and Korzh V. (2001) Developmental analysis of ceruloplasmin gene and liver formation in zebrafish. Mech. Dev. 103, 137139.
  • Kotowski I. K., Pertsemlidis A., Luke A., Cooper R. S., Vega G. L., Cohen J. C. and Hobbs H. H. (2006) A spectrum of PCSK9 alleles contributes to plasma levels of low-density lipoprotein cholesterol. Am. J. Hum. Genet. 78, 410422.
  • Laplante I., Beliveau R. and Paquin J. (2004) RhoA/ROCK and Cdc42 regulate cell-cell contact and N-cadherin protein level during neurodetermination of P19 embryonal stem cells. J. Neurobiol. 60, 289307.
  • Lenz O., Ter Meulen J., Klenk H. D., Seidah N. G. and Garten W. (2001) The Lassa virus glycoprotein precursor GP-C is proteolytically processed by subtilase SKI-1/S1P. Proc. Natl Acad. Sci. USA 98, 12 70112 705.
  • Lossi L. and Merighi A. (2003) In vivo cellular and molecular mechanisms of neuronal apoptosis in the mammalian CNS. Prog. Neurobiol. 69, 287312.
  • Marcinkiewicz M., Marcinkiewicz J., Chen A., Leclaire F., Chretien M. and Richardson P. (1999) Nerve growth factor and proprotein convertases furin and PC7 in transected sciatic nerves and in nerve segments cultured in conditioned media: their presence in Schwann cells, macrophages, and smooth muscle cells. J. Comp. Neurol. 403, 471485.
  • Maxwell K. N. and Breslow J. L. (2004) Adenoviral-mediated expression of Pcsk9 in mice results in a low-density lipoprotein receptor knockout phenotype. Proc. Natl Acad. Sci. USA 101, 71007105.
  • Maxwell K. N., Soccio R. E., Duncan E. M., Sehayek E. and Breslow J. L. (2003) Novel putative SREBP and LXR target genes identified by microarray analysis in liver of cholesterol-fed mice. J. Lipid Res. 44, 21092119.
  • Mbikay M., Tadros H., Ishida N. et al. (1997) Impaired fertility in mice deficient for the testicular germ-cell protease PC4. Proc. Natl Acad. Sci. USA 94, 68426846.
  • McBurney M. W. (1993) P19 embryonal carcinoma cells. Int. J. Dev. Biol. 37, 135140.
  • Means A. L. and Gudas L. J. (1995) The roles of retinoids in vertebrate development. Annu. Rev. Biochem. 64, 201233.
  • Muto E., Tabata Y., Taneda T., Aoki Y., Muto A., Arai K. and Watanabe S. (2004) Identification and characterization of Veph, a novel gene encoding a PH domain-containing protein expressed in the developing central nervous system of vertebrates. Biochimie 86, 523531.
  • Nasevicius A. and Ekker S. C. (2000) Effective targeted gene ‘knockdown’ in zebrafish. Nat. Genet. 26, 216220.
  • Park S. W., Moon Y. A. and Horton J. D. (2004) Post-transcriptional regulation of low density lipoprotein receptor protein by proprotein convertase subtilisin/kexin type 9a in mouse liver. J. Biol. Chem. 279, 50 63050 638.
  • Pisciotta L., Oliva C. P., Cefalu A. B. et al. (2005) Additive effect of mutations in LDLR and PCSK9 genes on the phenotype of familial hypercholesterolemia. Atherosclerosis 186, 443450.
  • Rashid S., Curtis D. E., Garuti R., Anderson N. N., Bashmakov Y., Ho Y. K., Hammer R. E., Moon Y. A. and Horton J. D. (2005) Decreased plasma cholesterol and hypersensitivity to statins in mice lacking Pcsk9. Proc. Natl Acad. Sci. USA 102, 53745379.
  • Roebroek A. J., Umans L., Pauli I. G., Robertson E. J., Van Leuven F., Van de Ven W. J. and Constam D. B. (1998) Failure of ventral closure and axial rotation in embryos lacking the proprotein convertase Furin. Development 125, 48634876.
  • Rudnicki M. A., Reuhl K. R. and McBurney M. W. (1989) Cell lines with developmental potential restricted to mesodermal lineages isolated from differentiating cultures of pluripotential P19 embryonal carcinoma cells. Development 107, 361372.
  • Sakai J., Nohturfft A., Goldstein J. L. and Brown M. S. (1998a) Cleavage of sterol regulatory element-binding proteins (SREBPs) at site-1 requires interaction with SREBP cleavage-activating protein. Evidence from in vivo competition studies. J. Biol. Chem. 273, 57855793.
  • Sakai J., Rawson R. B., Espenshade P. J., Cheng D., Seegmiller A. C., Goldstein J. L. and Brown M. S. (1998b) Molecular identification of the sterol-regulated luminal protease that cleaves SREBPs and controls lipid composition of animal cells. Mol. Cell 2, 505514.
  • Schier A. F., Neuhauss S. C., Harvey M. et al. (1996) Mutations affecting the development of the embryonic zebrafish brain. Development 123, 165178.
  • Schulte-Merker S., Ho R. K., Herrmann B. G. and Nusslein-Volhard C. (1992) The protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of the early embryo. Development 116, 10211032.
  • Schuppin G. T. and Rhodes C. J. (1996) Specific co-ordinated regulation of PC3 and PC2 gene expression with that of preproinsulin in insulin-producing beta TC3 cells. Biochem. J. 313, 259268.
  • Scopsi L., Gullo M., Rilke F., Martin S. and Steiner D. F. (1995) Proprotein convertases (PC1/PC3 and PC2) in normal and neoplastic human tissues: their use as markers of neuroendocrine differentiation. J. Clin. Endocrinol. Metab. 80, 294301.
  • Seidah N. G. and Chretien M. (1999) Proprotein and prohormone convertases: a family of subtilases generating diverse bioactive polypeptides. Brain Res. 848, 4562.
  • Seidah N. G. and Prat A. (2002) Precursor convertases in the secretory pathway, cytosol and extracellular milieu. Essays Biochem. 38, 7994.
  • Seidah N. G., Gaspar L., Mion P., Marcinkiewicz M., Mbikay M. and Chretien M. (1990) cDNA sequence of two distinct pituitary proteins homologous to Kex2 and furin gene products: tissue-specific mRNAs encoding candidates for pro- hormone processing proteinases. DNA Cell Biol. 9, 789.
  • Seidah N. G., Mowla S. J., Hamelin J. et al. (1999) Mammalian subtilisin/kexin isozyme SKI-1: a widely expressed proprotein convertase with a unique cleavage specificity and cellular localization. Proc. Natl Acad. Sci. USA 96, 13211326.
  • Seidah N. G., Benjannet S., Wickham L., Marcinkiewicz J., Jasmin S. B., Stifani S., Basak A., Prat A. and Chretien M. (2003) The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation. Proc. Natl Acad. Sci. USA 100, 928933.
  • Thisse C., Thisse B., Schilling T. F. and Postlethwait J. H. (1993) Structure of the zebrafish snail 1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119, 12031215.
  • Thomas G. (2002) Furin at the cutting edge: from protein traffic to embryogenesis and disease. Nat. Rev. Mol. Cell Biol. 3, 753766.
  • Timms K. M., Wagner S., Samuels M. E., Forbey K., Goldfine H., Jammulapati S., Skolnick M. H., Hopkins P. N., Hunt S. C. and Shattuck D. M. (2004) A mutation in PCSK9 causing autosomal-dominant hypercholesterolemia in a Utah pedigree. Hum. Genet. 114, 349353.
  • Wallace K. N. and Pack M. (2003) Unique and conserved aspects of gut development in zebrafish. Dev. Biol. 255, 1229.
  • Wei Y., Harris T. and Childs G. (2002) Global gene expression patterns during neural differentiation of P19 embryonic carcinoma cells. Differentiation 70, 204219.
  • Westerfield M. (2000) The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio Rerio). University of Oregon Press, Eugene.
  • Zhou A., Webb G., Zhu X. and Steiner D. F. (1999) Proteolytic processing in the secretory pathway. J. Biol. Chem. 274, 20 74520 748.