Identification and characterisation of novel tubulin-binding motifs located within the C-terminus of TRPV1

Authors


Address correspondence and reprint requests to F. Hucho, Freie Universität Berlin, Institut für Chemie und Biochemie, Thielallee 63, 14195 Berlin, Germany. E-mail: hucho@chemie.fu-berlin.de

Abstract

Previously, we reported that TRPV1, the vanilloid receptor, interacts with soluble αβ-tubulin dimers as well as microtubules via its C-terminal cytoplasmic domain. The interacting region of TRPV1, however, has not been defined. We found that the TRPV1 C-terminus preferably interacts with β-tubulin and less with α-tubulin. Using a systematic deletion approach and biotinylated-peptides we identified two tubulin-binding sites present in TRPV1. These two sequence stretches are highly conserved in all known mammalian TRPV1 orthologues and partially conserved in some of the TRPV1 homologues. As these sequence stretches are not similar to any known tubulin-binding sequences, we conclude that TRPV1 interacts with tubulin and microtubule through two novel tubulin-binding motifs.

Abbreviations used:
VDAC

voltage-dependent anion channel

TRP

transient receptor potential

MBP

maltose-binding protein

MT

microtubules

DMS

dimethyl suberimidate

Tubulin, the main constituent of microtubules is a cytoplasmic protein. Nevertheless, it is often reported to be present also in membrane preparations isolated from neuronal tissues (Bhattacharyya and Wolff 1975; Walters and Matus 1975; Gozes and Littauer 1979; Zisapel et al. 1980; Babitch 1981; Strocchi et al. 1981; de Néchaud et al. 1983; Hargreaves and Avila 1985). Although it is not an integral membrane protein, it can be enriched together with the membrane proteins after solubilising the membranes with the detergent Triton X-114 (Beltramo et al. 1994). Indeed, in recent years, a number of transmembrane receptors have been shown to interact specifically with either α-tubulin and/or β-tubulin and thereby to account for the tubulin association with membranes.

The interactions of tubulin with membrane proteins often results in altered microtubule dynamics. Conversely, changes of microtubule dynamics alter receptor/channel functions. Tubulin interaction with a wide variety of membrane proteins has been documented. For example, functional significance of tubulin interaction has been shown for the isoforms of the metabotropic glutamate receptor mGluR1 and mGluR7 (Ciruela et al. 1999; Ciruela and McIlhinney 2001; Saugstad et al. 2002), the ionotropic GABAA receptor (Item and Sieghart 1994), subunits of the NMDA receptor (van Rossum et al. 1999), and for various G-proteins (Wang et al. 1990; Popova et al. 1997; Roychowdhury and Rasenick 1997; Roychowdhury et al. 1999; Chen et al. 2003; Sarma et al. 2003; Popova and Rasenick 2004). The presence of tubulin was also identified in complexes with voltage-dependent anion channel (VDAC) (Carre et al. 2002), shaker channel (Moreno et al. 2002) and with ion-pumps such as Na+-K+-ATPase (Vladimirova et al. 2002). In many instances, tubulin/transmembrane protein interactions are involved in complex signalling events such as neurite out growth, cell morphology and cell differentiation. Interaction of acetylated tubulin (a post-trsanslationally modified form of tubulin) with H+-ATPase is reported to be important for the glucose uptake regulation in yeast (Campetelli et al. 2005).

Like other transient receptor potential (TRP) channels, TRPV1 is a non-selective cation channel (Caterina et al. 1997). Both N-terminal and C-terminal sequences of TRPV1 form cytoplasmic domains. Previously, we identified αβ-tubulin as TRPV1 interacting partner (Goswami et al. 2004). We demonstrated that the C-terminus of TRPV1 is sufficient and interacts directly with microtubules (Goswami et al. 2004). It provides stability to microtubules both in vitro and in vivo (Goswami et al. 2004, 2006). Interestingly, tubulin interaction is observed also for other members of the TRP super family. Interaction of β-tubulin with TRPC1 has been reported recently (Bollimuntha et al. 2005). Two other members, namely TRPC5 and TRPC6, contain tubulin as constituent of its ‘signalplex’ (Goel et al. 2005). Very recently, it has been shown that Polycystin-2 type TRP channels are regulated by microtubular structures in primary cilia of renal epithelial cells (Li et al. 2006). This suggests that tubulin interaction might be common for many of the TRP ion channels.

In spite of the functional implication of the interaction of tubulin with several transmembrane receptors and ion channels, very little is known about the binding structure/s that underlie these interactions. Therefore, we set out to identify the exact tubulin-binding region of TRPV1 and further characterised the interacting structures.

Materials and methods

Reagents and antibodies

The microtubule stabilising drug Taxol® (paclitaxel), the cross-linker DMS and purified actin, were purchased from Sigma–Aldrich (Taufkirchen, Germany). Biotinylated-peptides (KSFLKCMRKAFRSGKLLQVGF-K-Biotin and KRTLSFSLRSGRVSGRNWKNF-K-Biotin) were synthesised at Biosynthan (Berlin, Germany). Mouse monoclonal α-tubulin antibodies (clone DM1A), mouse monoclonal β-tubulin antibodies (clone D66), mouse monoclonal tyrosinated tubulin antibodies (clone TUB1A2), mouse monoclonal polyglutamylated tubulin antibodies (clone B3), mouse monoclonal acetylated tubulin antibodies (clone 611-B-1), mouse monoclonal phosphoserine antibodies (Clone PSR-45) and mouse monoclonal anti-β-tubulin sub type III (clone SDL.3D10) were purchased from Sigma–Aldrich. Mouse monoclonal neurofilament 200 kDa antibodies (clone RT97) and rabbit polyclonal detyrosinated tubulin antibodies were purchased from Chemicon (Chandlers Ford, UK). Mouse monoclonal actin antibodies (clone JLA20) was purchased from Oncogene (Cambridge, MA, USA). Mouse monoclonal anti-maltose-binding protein (MBP) antibodies and amylose resin were purchased from New England Biolab (Beverly, MD, USA). Enriched neurofilament fraction was a kind gift from O. Bogen (Bogen et al. 2005). Subtilisin-digested tubulin and control tubulin were kindly provided by Linda Amos (Cambridge, UK). For the detection of subtilisin-digested tubulin and control tubulin by western-blot analysis, we used mouse monoclonal anti-β-tubulin (clone D10, Santa Cruz Biotechnology, Heidelberg, Germany).

Expression and purification of TRPV1 fusion proteins

Expression and purification of MBP-TRPV1-Nt (N-terminal cytoplasmic domain of TRPV1 fused with MBP) and MBP-TRPV1-Ct (C-terminal cytoplasmic domain of TRPV1 fused with MBP) were described in Goswami et al. (2004). The cDNA fragments of TRPV1-Ct (see Fig. 1) were amplified by PCR using specific primers (Table 1). All amplified DNA fragments were subcloned into the EcoR1 and Hind III restriction sites of the pMAL-c2x vector (New England Biolabs, Beverly, MA, USA). A stop codon was introduced in each construct at the C-terminus of the coding sequences. All expression constructs were verified by automated nucleotide sequencing. Escherichia coli (E. coli) strain BL21DE3 was transformed by heat shock with the plasmid coding for the TRPV1 cytoplasmic domains and fragments fused with MBP protein. E. coli cells were induced to express the proteins by isopropyl thiogalactoside (IPTG) for 2 h. The cells were lysed by repeated freeze-thaw cycles in lysis buffer (20 mmol/L Tris–HCl, pH 7.4, 150 mmol/L NaCl, 0.1% Tween 20, lysozyme, benzonase and protease inhibitor cocktail). The lysed extracts were cleared by centrifugation (100 000 g in a TFT 45 rotor for 2 h). The cleared lysate was applied to amylose resin and washed thoroughly. Bound protein was eluted with 10 mmol/L maltose in elution buffer (50 mmol/L PIPES, pH 6.8, 100 mmol/L NaCl, 1 mmol/L EGTA and 0.2 mmol/L MgCl2). Protein concentration was determined according to method described by Bradford (1976).

Figure 1.

 Constructs and peptides used to identify the tubulin-binding site located in the C-terminus of TRPV1. Schematic representation of constructs prepared to express the deletion-proteins and fragments corresponding to the different regions of C-terminus of TRPV1. Positions of the amino acids are written in top. Different deleted and fragmented parts of the C-terminal of TRPV1 are expressed as MBP-fusion protein (MBP is at the N-terminus of each fusion constructs). Biotinylated-peptides (biotin label is at the C-terminus) are indicated. Dark background indicates the regions with higher pI (short basic stretches 1 and 2), whereas light background indicates the regions with lower pI. All theoretical isoelectric points of the deletion constructs were calculated by using available software (http://www.expasy.org/tools/pi_tool.html).

Table 1.   Primers used for making the TRPV1-Ct deletions and fragments
 PrimerConstruct
  1. F, forward primer; R, reverse primer; Underlines indicate the presence of stop codon.

1F: 5′ CCGGAATTCCTCATGGGTGAGACCGTCAAC 3′MBP-TRPV1-Ct-Δ1
R: 5′ CCCAAGCTTTTAGCTTGCATCCCTCAGAAGGGG 3′
2F: 5′ CCGGAATTCCTCATGGGTGAGACCGTCAAC 3′MBP-TRPV1-Ct-Δ2
R: 5′ CCCAAGCTTTTAGTTGATGATACCCACATTGGT 3′
3F: 5′ CCGGAATTCCTCATGGGTGAGACCGTCAAC 3′MBP-TRPV1-Ct-Δ3
R: 5′ CCCAAGCTTTTAGAACCCCACCTGCAGCAGCTT 3′
4F: 5′ CCGGAATTCCTCATGGGTGAGACCGTCAAC 3′MBP-TRPV1-Ct-F1
R: 5′ CCCAAGCTTTTACTCTGTATCCAGGATGGTGAT 3′
5F: 5′ CCGGAATTCAAGAGCTTCCTGAAGTGCATG 3′MBP-TRPV1-Ct-F2
R: 5′ CCCAAGCTTTTAGAACCCCACCTGCAGCAGCTT 3′
6F: 5′ CCGGAATTCACTCCTGACGGCAAGGATGAC 3′MBP-TRPV1-Ct-F3
R: 5′ CCCAAGCTT TTAGACGCCCTCACAGTTGCCTGG 3′
7F: 5′ CCGGAATTCAAGCGCACCCTGAGCTTCTCC 3′MBP-TRPV1-Ct-F4
R: 5′ CCCAAGCTTTTACCTCAGAAGGGGAACCAGGGC 3′
8F: 5′ CCGGAATTCACTCGAGATAGACATGCCACC 3′MBP-TRPV1-Ct-F5
R: 5′ CCCAAGCTTTTATTTCTCCCCTGGGACCATGGA 3′
9F: 5′ CCGGAATTCGAGGACCCAGGCAACTGTGAG 3′MBP-TRPV1-Ct-F6
R: 5′ CCCAAGCTTTTATTTCTCCCCTGGGACCATGGA 3′
10F: 5′ CCGGAATTCACTCCTGACGGCAAGGATGAC 3′MBP-TRPV1-Ct-F7
R: 5′ CCCAAGCTTTTATTTCTCCCCTGGGACCATGGA 3′
11F: 5′ CCGGAATTCAAGAGCTTCCTGAAGTGCATG 3′MBP-TRPV1-Ct-F8
R: 5′ CCCAAGCTTTTACCTCAGAAGGGGAACCAGGGC 3′

Purification of tubulin

αβ-tubulin dimers were purified from porcine brain according to Shelanski et al. (1973). In brief, two cycles of assembly from soluble brain extract in the presence of glycerol and GTP and disassembly by cold temperature (ice-cold) were followed by chromatography on phosphocellulose.

Pull-down assay

MBP-LacZ, MBP-TRPV1-Ct, different MBP-TRPV1-Ct fragments and deletion constructs (see Fig. 1) were expressed in E. coli, the cleared cell lysates were applied to amylose resin (NEB), and incubated for 1 h at 25°C followed by washing. The amylose resin with bound proteins were re-suspended in PEM-S buffer (50 mmol/L PIPES, pH 6.8, 100 mmol/L NaCl, 1 mmol/L EGTA and 0.2 mmol/L MgCl2). Approximately, 50 μL of amylose resin with the bound fusion protein was incubated with 50 μL of soluble tubulin (1 mg/mL protein) for 1 h at 25°C either in the presence or absence of Ca2+ (2 mmol/L). This was followed by three washes with 200 mL each time and constant buffer conditions. The proteins were eluted by 10 mmol/L maltose in 100 μL solution. Eluted samples were analysed by 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) according to Laemmli (1970).

For experiments determining the binding of subtilisin-digested tubulin with TRPV1-Ct, MBP-TRPV1-Ct immobilised on amylose resin (20 μL) in PEM-S buffer were incubated with 2 μg of subtilisin-digested tubulin or same amount of control tubulin for 1 h at 25°C. After three washes in PEM-S buffer, the bound protein complexes were eluted and analysed further.

To identify if there is a direct interaction between tubulin and short peptides carrying TRPV1 sequences, biotinylated-peptides were incubated with avidin agarose (Sigma–Aldrich) at 25°C for 1 h, washed extensively with PEM-S-T (50 mmol/L PIPES, pH 6.8, 1 mmol/L EGTA, 0.2 mmol/L MgCl2, 150 mmol/L NaCl and 0.1% Tween 20) buffer thrice, incubated with the soluble tubulin dimer (40 μg in 100 μL) for 1 h. Avidin–agarose resins were washed thrice with PEM-S-T buffer and finally taken in to Laemmli sample buffer and analysed by western-blot analysis for bound proteins.

Cross-linking of proteins

A protein mixture (1 mg/mL) of equal amounts of αβ-tubulin dimer and MBP-TRPV1-Ct, in PEM buffer was adjusted to 0.2 mol/L triethanolamine (pH 8.1) buffer for cross-linking with dimethyl suberimidate (DMS, Sigma, 1 mg/mL). The reaction was carried out at 25°C for 1 min to 1 h and stopped by adding Tris–HCl (pH 6.8) to a final concentration of 50 mmol/L. Samples were subjected to SDS-PAGE separation and western-blot analysis.

Western-blot analysis

To perform western-blot analysis, the proteins were separated by SDS-PAGE, and transferred either to a nitrocellulose membrane or PVDF (Millipore, Schwalbach, Germany) by semidry electro blotting. The membranes were blocked with 5% non-fat milk in TBS-T (20 mmol/L Tris, 150 mmol/L NaCl. 0.1% Tween-20) buffer followed by incubation with the respective primary antibody for 1 h at 25°C, washed thrice times with TBS-T buffer. Subsequently, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody for 1 h at 25°C. For the detection of biotinylated-peptides, PVDF membranes containing peptide spots were probed with HRP-conjugated avidin (Sigma–Aldrich, 1 : 1000 dilution). The membranes were washed thoroughly with TBST. The ECL detection system (Amersham Biosciences, Freiburg, Germany) was used for the visualisation of the immunoreactivity.

Co-sedimentation assay with taxol-stabilised microtubules (MT)

Approximately 100 µg of purified αβ-tubulin dimer in a total volume of 100 µL were incubated in modified PEM buffer (20 mmol/L PIPES, pH 6.8, 0.2 mmol/L MgCl2 and 1 mmol/L EGTA supplemented by 1 µmol/L taxol and 5 mmol/L GTP) for 30 min at 37°C, to form MT. After MT formation, 5 µg of purified proteins representing different MBP-fusion proteins were incubated with taxol-stabilised MT for 40 min at 37°C followed by centrifugal separation of pellet (MT) and supernatant (free dimer) at 70 000 g/30 min/37°C. In a similar manner biotinylated-peptides (approximately 1 μg each in 100 μL) were first centrifuged at 25 000 g for 5 min to remove all aggregates. Clear supernatant containing soluble peptides were further used for microtubule co-sedimentation assay. Corresponding pellet and supernatant fractions were further spotted on a PVDF membrane (Amersham) by a dot-blot apparatus (Bio-Rad, Munich, Germany) and analysed for bound peptides. For MT formation under taxol-free conditions, 100 µg of tubulin dimer were used in PEM buffer with 5 mmol/L GTP in the absence of taxol and incubated for 30 min at 37°C.

Blot overlay

To carry out overlay experiments, either native tubulin dimer were spotted directly or denatured and SDS-PAGE-separated proteins (tubulin dimer) were transferred from gels to nitrocellulose or PVDF membrane. Membranes were blocked for 1 h with 5% fat-free milk in PBST buffer. Subsequently, the membranes were washed thrice. Membranes were air-dried and incubated with MBP-TRPV1-Ct or MBP alone (protein concentration 0.2 μg/mL, with 5% fat-free milk in PBST buffer) for 1 h at 25°C. In blot overlay experiment with biotinylated-peptides, PEM-S-T (50 mmol/L PIPES; pH 6.8, 1 mmol/L EGTA, 0.2 mmol/L MgCl2, 150 mmol/L NaCl and 0.1% Tween 20) buffer was used. Peptides were used at a concentration of approximately 5 ng/mL. After incubation, the membranes were washed thrice (each time for 10 min) and incubated with 0.1% formaldehyde for 30 min to cross-link the bound proteins. Finally, the membranes were quenched with 100 mmol/L glycine in TBS buffer and processed for western-blot analysis with MBP antibodies or HRP-labelled avidin to detect the bound proteins or peptides respectively.

Results

TRPV1 interacts with soluble tubulin, but neither with soluble actin nor with soluble neurofilaments

Previously, we observed that the C-terminus of TRPV1 binds to tubulin and stabilises microtubules (Goswami et al. 2004). To understand if the C-terminus of TRPV1 can also interact with cytoskeleton components other than tubulin, we performed pull-down experiments with purified soluble actin and enriched soluble neurofilament preparations. The C-terminal cytoplasmic domain of TRPV1 fused with MBP (MBP-TRPV1-Ct) was used as bait. However, we could not observe any significant direct interaction of actin or neurofilaments with the MBP-TRPV1-Ct (Fig. 2a). As activation of TRPV1 results in influx of Ca2+, we tested if actin and neurofilaments interact with MBP-TRPV1-Ct in the presence of high Ca2+. We observed no interaction even in the presence of Ca2+. Under the same conditions a significant amount of soluble tubulin interacts with the MBP-TRPV1-Ct. In agreement with our previous results (Goswami et al. 2004), this interaction was slightly stronger in the presence of Ca2+. In similar experiments, MBP-TRPV1-Ct, but not MBP-LacZ pulls down neuron-specific beta III tubulin as well as other post-translationally modified tubulins, i.e. acetylated tubulin, polyglutamylated tubulin, phosphotubulin (phosphoserine), tyrosinated tubulin and de-tyrosinated tubulin (Fig. 2b). These results indicate that the C-terminus of TRPV1 interacts specifically with the constituents of both dynamic and stable microtubules.

Figure 2.

 The C-terminus of TRPV1 specifically interacts with constituents of microtubule cytoskeleton. (a) MBP-TRPV1-Ct (lanes 2 and 3) and MBP-LacZ (lanes 4 and 5), all immobilised on amylose resin were incubated with purified soluble tubulin dimer (left panel), or purified soluble actin (middle panel) or enriched neurofilament fraction (right panel) either in the presence (lanes 2 and 4) or absence of Ca2+ (lanes 3 and 5) to analyse the specific binding. The proteins were eluted from the amylose resin with 10 mmol/L maltose and resolved by SDS-PAGE. Lane 1 shows the input amount of soluble proteins. Proteins were stained with silver stain (upper panel) and also probed for bound tubulin, actin or neurofilaments by western-blot analysis (lower panel) of the corresponding samples. A significant amount of tubulin binds to the MBP-TRPV1-Ct but not to the MBP-LacZ. In contrast to tubulin, neither actin nor neurofilament binds to the MBP-TRPV1-Ct. (b) MBP-TRPV1-Ct (lane 1) but not MBP-LacZ (lane 2) pulls down different post-translationally modified tubulins and neuron-specific β-tubulin sub type III.

β-tubulin, but not α-tubulin preferentially interacts with TRPV1

Tubulin preparations from brain tissue consist predominantly of αβ-tubulin heterodimers. In order to analyse, which subunit of the tubulin dimer interacts with the C-terminal domain of TRPV1, we performed a cross-linking experiment (Fig. 3a). A mixture of αβ-tubulin dimer and MBP-TRPV1-Ct was cross-linked by using dimethyl suberimidate (DMS), a homobifunctional cross-linking agent, which reacts with amino groups. The cross-linked products of tubulin dimers and MBP-TRPV1-Ct were subsequently analysed by gel electrophoresis and western-blot analysis with the appropriate antibodies. We observed that cross-linking occurred fast and the entire amount of MBP-TRPV1-Ct appeared on the gel as a high-molecular weight complex after only 1 min of cross-linking. All β-tubulin in the reaction mixture also appeared in the same high-molecular weight complex. Also the α-tubulin was found in that complex, but approximately 50% of the α-tubulin did not react. Even after 60 min of reaction, the non-cross-linked α-tubulin population remained at its monomeric molecular weight on the SDS-PAGE. The high-molecular weight complex was not observed when we used purified MBP instead of MBP-TRPV1-Ct for cross-linking experiments with αβ-tubulin dimer (data not shown). From these data we conclude that the MBP-TRPV1-Ct interacts with the tubulin dimer predominantly via β-tubulin.

Figure 3.

 MBP-TRPV1-Ct interacts directly with β-tubulin. (a) MBP-TRPV1-Ct and αβ-tubulin dimer mixture was cross-linked with DMS cross-linker. Protein mixtures before cross-linking (lane 1), 1 min after cross-linking (lane 2) and 60 min after cross-linking (lane 3) were separated by SDS-PAGE (4–10% gradient) and transferred to a nitrocellulose membrane. Blots were probed with the anti-α-tubulin antibody (left), the anti-β-tubulin antibody (middle) and the anti-MBP antibody (right). The arrow indicates the high-molecular-weight cross-link product. After cross-linking, all the MBP-TRPV1-Ct and all the β-tubulin shows up in a high-molecular weight complex, whereas a significant amount of the α-tubulin failed to react and remains in the monomeric state. (b) MBP-TRPV1-Ct but not MBP alone detects purified tubulin dimers in blot overlay experiment. Equal amount of purified tubulin dimer separated by SDS-PAGE and transferred into the nitrocellulose membrane were overlayed with MBP-TRPV1-Ct (lane 1) and with MBP only (lane 2). Stripes were probed with anti-MBP antibody. Anti-MBP immunoreactivity appeared in the position of tubulin at lane 1 (indicated by arrow).

The C-terminus of TRPV1 interacts with blotted denatured tubulin

Three-dimensional crystal structures and EM pictures reveal that the C-terminal tail of the tubulin dimer does not integrate into the core of the microtubule filaments, but remains outside (Nogales et al. 1999; Lowe et al. 2001). These exposed C-terminal over-hanging regions of both α-tubulin and β-tubulin are strongly negatively charged and unstructured too (Lowe et al. 2001; Nogales 2001). Most of the known microtubule-binding proteins interact with microtubules and tubulins through these regions (see Fig. 4a, see also Discussion).

Figure 4.

 Positively charged amino acids of stretch sequence 1 and 2 are clustered in one side of the helix. (a) C-terminal tail of α-tubulin and β-tubulin contain highly negatively charged amino acids. These negatively charged amino acids (indicated in bold letter) are conserved in almost all species, and most of the microtubule-binding proteins interact via these sequences. (b) Amino acids of stretch sequences 1 and stretch sequence 2 (in each case 17 amino acid-long, indicated in top) of the C-terminus of TRPV1 (rat) are plotted for helical distribution. Top-view of the helix is shown. Programme available at http://kael.net/helical.htm site is used to draw the helical wheel. Positively charged amino acids (bold letter) are marked with asterisk sign. Note the distribution of positively charged residues (asterisk) in one side of the wheel.

To analyse if the TRPV1 C-terminus also interacts with tubulin via this acidic unstructured region, we separated purified αβ-tubulin dimer on SDS-PAGE and performed a blot overlay on the denatured tubulin with purified MBP-TRPV1-Ct. We subsequently probed for bound protein by western-blot analysis with MBP antibodies. MBP immunoreactivity was detected at 55 kDa (the position of tubulin) on the membrane, but only if the blot overlay was performed with MBP-TRPV1-Ct and not with MBP alone (Fig. 3b). This suggests that the C-terminus of TRPV1 interacts even with unstructured tubulin polypeptides, possibly at the C-terminal negatively charged overhanging region.

AA 681-730 is sufficient for tubulin binding

To identify the tubulin-binding region in the C-terminus of TRPV1, we undertook a systematic deletion approach. We designed three MBP-fused C-terminal deletion constructs along with the complete C-terminus, namely MBP-TRPV1-Ct-Δ1 (aa 681–800) and MBP-TRPV1-Ct-Δ2 (aa 681–760) as well as MBP-TRPV1-Ct-Δ3 (aa 681–730), each shorter by few amino acids at the C-terminal end respectively (Fig. 1). All these fusion proteins were expressed in E.coli, purified and confirmed by western-blot analysis (data not shown). MBP-pull-down experiments were performed with these deletion-proteins. Pulled-down eluate samples were first analysed by SDS-PAGE and silver staining and then probed for bound tubulin by western-blot analysis.

We observed that all three MBP-TRPV1-Ct deletion proteins pulled down tubulin when used as baits (Fig. 5). As expected, no tubulin was observed in pull-down samples where an unrelated construct (MBP-LacZ) was used as bait (data not shown, a similar experiment is shown in Fig. 2). However, the amount of tubulin pulled down by different deletion-proteins varies, indicating that different regions of the C-terminus of TRPV1 influence the tubulin interaction to a different extent (Fig. 5). Tubulin binding with MBP-TRPV1-Δ1 was slightly higher when compared with MBP-TRPV1-Ct. This indicates that the amino acid sequence 800–838 is less important for the interaction. Deletion of this region may even enhance the tubulin interaction. Similarly, a stronger amount of tubulin binding was observed with MBP-TRPV1-Δ3, which contains amino acids 681–730 of TRPV1. Significantly less tubulin binding was observed with MBP-TRPV1-CtΔ2 (amino acid residues 681–760).

Figure 5.

 AA 681–730 is sufficient for tubulin binding. MBP-TRPV1-Ct, MBP-TRPV1-Ct-Δ1, MBP-TRPV1-Ct-Δ2 and MBP-TRPV1-Ct-Δ3, all immobilised on amylose resin (lane 1), were incubated with purified tubulin dimer either in the presence (lane 2) or absence of Ca2+ (lane 3) to analyse the relative affinity of the deletion fragments for tubulin. The proteins were eluted from the amylose resin with 10 mmol/L maltose and resolved by SDS-PAGE. Proteins were stained with silver stain (upper panel). Western-blot analysis (lower panel) of corresponding samples with anti-tubulin antibody shows the differential presence of tubulin (arrow) in the different pull-down elutes. A significant amount of tubulin binds to the MBP-TRPV1-Ct, MBP-TRPV1-Ct-Δ1 and MBP-TRPV1-Ct-Δ3. MBP-TRPV1-Ct-Δ2 in contrast binds much less tubulin. The input amount of tubulin is shown by silver stained SDS-PAGE (left, upper panel) and by western-blot analysis (left, lower panel).

These results indicate that a stretch of 50 amino acids (position 681–730) is sufficient for the interaction with tubulin. This also suggests that the sequences amino acids 731–760 and 800–838 of TRPV1 reduce tubulin binding, while the sequence residues 760–800 enhance it.

Two small basic sequences located in the C-terminal cytoplasmic domain of TRPV1 have potentiality to modulate the interaction

Many tubulin-binding proteins and microtubule-binding proteins contain more than one short basic-repeat sequences which mediates the interaction with tubulin and/or microtubules (see Discussion). To explore, if the C-terminal cytoplasmic domain of TRPV1 also contains basic-sequence stretches for tubulin binding, the theoretical pI values of the entire C-terminus of TRPV1 as well as of short sequence stretches were calculated (see Fig. 1). Two short sequence stretches that contain basic amino-acid residues and thus have a higher pI were identified at residues 710–730 (calculated pI; 11.17) and 770–797 (calculated pI; 12.6). These two sequences contain a number of positively charged amino acids, but are devoid of any negative charges. However, the two sequences are flanked by sequence stretches that consist of negatively charged amino acids. Therefore, these motifs (short basic sequences flanked by acidic amino acids) may act as tubulin-binding structures.

Interestingly, a helical plot of these two short sequences shows that all the basic amino acids are located on one side of the α-helix (discussed later, see Fig. 4b). This may indicate that these basic amino acids are engaged in the interaction with negatively charged sequences, either of neighbouring sequences of the same polypeptide (with negatively charged residues) or of sequences from other interacting proteins, like the C-terminal overhanging acidic region of tubulin. The latter explanation is supported by our tubulin pull-down experiments. Beside the MBP-TRPV1-Ct, only MBP-TRPV1-CtΔ1 and MBP-TRPV1-CtΔ3, but not MBP-TRPV1-CtΔ2 binds tubulin.

TRPV1-Ct amino acid sequences 710–730 and 770–797 influence TRPV1/tubulin interaction

To further narrow down the interacting regions, which mediate the tubulin interaction, the C-terminus of TRPV1 was subdivided into five short segments. These short fragments expressed as N-terminal MBP fusion proteins and referred as MBP-TRPV1-Ct-fr1 to MBP-TRPV1-Ct-fr5 (see Fig. 1). Fragments 1, 3 and 5 contain negatively charged amino acids (with low pI), while fragments 2 and 4 represent basic stretch 1 and basic stretch 2 respectively. Two more fragments were prepared, in which the basic stretch 2 has an acidic stretch to its right side (named MBP-TRPV1-Ct-Fr6, see Fig. 1) or with acidic sequences on both sides (referred to as MBP-TRPV1-Ct-Fr7, see Fig. 1). One further fragment was prepared which contained both the basic sequence stretches connected by the acidic stretch in between. This fragment is referred to as MBP-TRPV1-Ctfr8 (see Fig. 1).

All these deletion constructs and fragments of the C-terminus of TRPV1 were created as fusion proteins with an N-terminal MBP and expressed in E.coli. The whole set covers most of all possible combinations, i.e. either two short basic sequences are present in combination, or alone, or are excluded completely. The expressed fusion proteins were used for pull-down assays and also for microtubule-binding assays. These fusion proteins were additionally tested for their binding to SDS-PAGE-separated denatured tubulin dimer or to native tubulin dimers spotted on membranes in a blot-overlay experiment (data not shown).

In the MBP-pull-down assay, it was observed that MBP-TRPV1-Ct-fr 2 and MBP-TRPV1-Ct-fr 4 bind tubulin strongly (Fig. 6). Notably, these two fragments represent basic stretch sequence 1 and 2 respectively. In contrast, MBP-TRPV1-Ct-fr1 and MBP-TRPV1-Ct-fr 5 reveal no binding (Fig. 6). We observed some weak binding for MBP-TRPV1-Ct-fr3. Comparison of tubulin-binding and microtubule-binding to MBP-TRPV1-Ct-fr6, MBP-TRPV1-Ct-fr7 and MBP-TRPV1-Ct-fr8 reveals that MBP-TRPV1-Ct-fr7 has the lowest affinity to both soluble tubulin and polymerised microtubules while MBP-TRPV1-Ct-fr8 showed the strongest binding for both. MBP-TRPV1-Ct-fr6 also reveals significant binding to both tubulin and microtubules (Fig. 7). Similar results were obtained, when these fragments were used in a blot-overlay experiment with SDS-PAGE-separated tubulin (data not show). These results support a positive modulation of tubulin binding by the presence of the two short basic amino acid stretches.

Figure 6.

 Differential binding of tubulin to different fragments of TRPV1-Ct. MBP-TRPV1-Ct-Fr1, MBP-TRPV1-Ct- Fr2, MBP-TRPV1-Ct- Fr3, MBP-TRPV1-Ct-Fr4 and MBP-TRPV1-Ct- Fr5, all immobilised on amylose resin (lane 1) were incubated with purified tubulin dimer (lane 2) to analyse the relative affinity of the deletion fragments for tubulin. The fusion proteins along with the bound tubulin were eluted from the amylose resin with 10 mmol/L maltose and resolved by SDS-PAGE. Western-blot analysis (upper panel) of corresponding samples with anti-tubulin antibody shows the differential presence of tubulin (indicated by arrow) in the different pull-down elutes. A significant amount of tubulin binds to the MBP-TRPV1-Ct-Fr2 and MBP-TRPV1-Ct-Fr4. The lower panel reveal the presence of equal amount of fusion proteins in each lane as visualised by silver staining.

Figure 7.

 The presence of short basic sequence stretches influences the interaction of TRPV1 with tubulin dimers and with microtubules. (a) MBP-TRPV1-Ct-fr6 (lane 1), MBP-TRPV1-Ct-fr7 (lane 2) and MBP-TRPV1-Ct-fr8 (lane 3), all immobilised on amylose resin, were incubated with purified tubulin to analyse the relative affinity of the deletion fragments for tubulin. Bound proteins were eluted from the amylose resin with 10 mmol/L maltose and resolved by SDS-PAGE. Proteins were visualised by silver stain (upper panel). Western-blot analysis (lower panel) of corresponding samples with anti-tubulin antibody shows the differential presence of tubulin in the pull-down elutes. A significant amount of tubulin binds to MBP-TRPV1-Ct-fr6 and MBP-TRPV1-Ct-fr8. Much less tubulin binds to MBP-TRPV1-Ct-fr7 (Note the excess amount of MBP-TRPV1-Ct-Fr7 in the silver stain). Arrows indicate the position of tubulin. (b) MBP-TRPV1-Ct-fr8 co-sediments with polymerised microtubules. Purified αβ-tubulin dimers were incubated with taxol and GTP to form microtubules. Taxol-stabilised MTs were incubated with 6 μg of purified MBP-TRPV1-Ct-fr6, MBP-TRPV1-Ct-fr7 and MBP-TRPV1-Ct-fr8 respectively. Microtubules and bound proteins were separated by centrifugation and analysed by 10% SDS-PAGE. The distribution of the proteins between microtubule pellet (P) and supernatant (S) fractions was visualised by silver staining of the proteins (upper panel) and western-blot analysis of the same samples with anti-MBP antibody (lower panel). A significant amount of MBP-TRPV1-Ct-fr8 and a small amount of MBP-TRPV1-Ct-fr6 co-sediment with microtubules. The majority of MBP-TRPV1-Ct-fr6 and MBP-TRPV1-Ct-fr7 remain in the supernatant.

Biotinylated-peptides corresponding to these two short basic stretches bind to soluble tubulin and co-sediment with the polymerised microtubules

To confirm these findings by a different method, we synthesised biotinylated-peptides (each peptides containing 21 amino acid, amino acid 710–730 and 770–790). Therefore, these two peptides represent the basic amino acid stretches. We observed that the two peptides co-sediment with taxol-stabilised microtubules (Fig. 8a). Avidin–agarose coupled to either of these two peptides pulled down a significant part of the purified soluble tubulin (Fig. 8b). In contrast, avidin–agarose beads alone did not pull down any tubulin. We observed that these two peptides can detect SDS-PAGE-separated denatured tubulin on membranes in the blot overlay assay in nanomolar concentration (Fig. 8c). This not only confirms that these two peptides can interact with tubulin and microtubules specifically, but also shows that the interaction does not need a native tubulin structure.

Figure 8.

 Two 21-mer amino acid sequences are sufficient for interaction with polymerised microtubules and tubulins. (a) Two short peptides co-sediment with taxol-stabilised microtubules. Taxol-stabilised polymerised microtubules (Cont) were incubated with peptide-1 (PT-1) or peptide-2 (PT-2) at 37°C for 30 min. Polymerised microtubules and associated peptides were subsequently separated from soluble unbound tubulin/peptide by centrifugal separation of pellet fractions (P) from supernatant (S). Corresponding pellets and supernatants were further analysed by SDS-PAGE (Coomassie staining) and also by dot-blot analysis with HRP-avidin. A significant portion of both peptides is observed to be present in pellet fraction. Total amount of peptide is indicated by (T). (b) Two short peptides pull-down soluble tubulin. Purified soluble tubulin dimer (lane 1, 1/4th amount of input is shown) were added to avidin–agarose coupled with peptide-1 (PT-1, lane 2), or peptide-2 (PT-2, lane 3) or to avidin–agarose beads only (lane 4), incubated for 1 h at 25°C, and washed subsequently. Bound proteins were eluted from the avidin–agarose beads with Laemmli buffer and resolved by SDS-PAGE. Proteins were visualised by Coomassie stain (upper panel). Western-blot analysis (lower panel) of corresponding samples with anti-α-tubulin antibody and anti-β-tubulin antibody reveal the specific presence of tubulin in the pull-down elutes from peptide-coupled beads, but not in only beads control. (c) Two short peptides interact and thus detect SDS-PAGE-separated tubulin on membrane. Equal amounts of soluble tubulin dimer were separated by SDS-PAGE and transferred on PVDF membrane. Membrane strips were incubated with (approximately 5 ng/mL) biotinylated-peptide-1 (PT-1, lane 1), biotinylated-peptide-2 (PT-2 lane 2), or only with buffer for 1 h. Subsequently, the membrane strips were washed and cross-linked with formaldehyde, and probed with HRP-labelled avidin. Significant reactivity was detected at around 55 kDa (at the position of tubulin, indicated by arrow) in the lane 1 and lane 2, but not in lane 3.

The C-terminal overhanging region of tubulin is important for TRPV1-Ct binding

As the C-terminal overhanging regions of both α-tubulin and β-tubulin are very acidic and involved in the interaction with most of the microtubule-binding proteins (see Discussion), we tested if this is the region where the C-terminal cytoplasmic domain of TRPV1 binds. To test this, we analysed if subtilisin-digested tubulin (see Fig. S1) binds with MBP-TRPV1-Ct. We performed MBP-pull-down assay with control tubulin and subtilisin-digested tubulin using MBP-TRPV1-Ct, and analysed the eluates by SDS-PAGE. Although undigested control tubulin binds significantly to the MBP-TRPV1-Ct, we could not detect any binding of subtilisin-digested tubulin with MBP-TRPV1-Ct (Fig. 9a). To confirm this result by a more sensitive method, we used mouse monoclonal anti-β-tubulin antibody, clone D10 (Santa Cruz). This antibody detects control tubulin as well as subtilisin-digested tubulin, both in SDS-PAGE-separated denatured and in native form (Fig. 9b). By western-blot analysis, we could detect a significant binding of control tubulin, but we failed to find any binding of subtilisin-digested tubulin (Fig. 9a). This indicates that the C-terminal acidic region of tubulin is important for TRPV1-Ct binding.

Figure 9.

 The C-terminal acidic region of tubulins are important for TRPV1-Ct binding. (a) Subtilisin-digested tubulin does not bind to TRPV1-Ct. MBP-TRPV1-Ct immobilised on amylose resin (lane 1) was incubated with an equal amount of control tubulin (αβ) (lane 2) or subtilisin-digested tubulin (αsβs) (lane 3). Bound proteins were eluted with maltose and analysed by 10% SDS-PAGE. Proteins were visualised by Coomassie (left side) and also by western-blot analysis for bound tubulin (right side). The arrow and the arrowhead indicate the position of αβ tubulin and αsβs tubulin respectively. (b) SDS-PAGE and western-blot analysis of the control tubulin and subtilisin-digested tubulin. Control αβ-tubulin (lane 1) and subtilisin-digested αsβs-tubulin (lane 2) were separated by 10% SDS-PAGE and stained by Coomassie (left side) or visualised by western-blot analysis with anti-β-tubulin antibody. Note that the antibody detects both control tubulin and subtilisin-digested tubulin in native form too (right side bottom). For more information, see Fig. S1.

Discussion

Recently, we demonstrated that the C-terminus of TRPV1 not only interacts but also stabilises microtubules in vitro (Goswami et al. 2004), and when over-expressed, this results in the formation of more stable and bundled microtubules in vivo (Goswami et al. 2006). In a reverse manner, activation of TRPV1 results in rapid disassembly of dynamic microtubules (Goswami et al. 2006). This demonstrates that TRPV1 is physically linked to microtbules, and also suggests that the microtubule cytoskeleton is a downstream effector of TRPV1 activation. However, the exact tubulin-binding sequence was not determined. In this study, we characterised the TRPV1/tubulin interaction and also demonstrate that the C-terminus of TRPV1 neither interacts with soluble actin nor with soluble neurofilaments, but specifically interacts with the components of microtubule cytoskeleton.

We demonstrate that the C-terminus of TRPV1 preferably interacts with β-tubulin rather than α-tubulin. In a similar manner, two groups independently reported that β-tubulin interacts with members of TRPC channels (Bollimuntha et al. 2005; Goel et al. 2005). Microtubule plus ends terminate their protofilaments with a β-tubulin at the end. The higher preference of the TRPV1-Ct for β-tubulin and the ability to stabilise microtubules therefore indicates that the observed interaction may exert its effect at the microtubule plus end rather than at the minus end. This accords well with a recent observation that Xenopus TRPN1, another member of the TRP channel super family is localised at the plus ends of the microtubule-based cilia structures (Shin et al. 2005).

In contrast to the C-terminus, the N-terminus of TRPV1 neither interacts with soluble tubulin nor with polymerised microtubules (Goswami et al. 2004). Similarly, the N-terminus of TRPV1 fails to modify the properties of microtubules in vitro (Goswami et al. 2004). The N-terminal domain of TRPV1 does not form any specific high-molecular weight complex when cross-linked with tubulin dimers (data not shown). From all these observations it seems that the N-terminus of TRPV1 is not involved with the tubulin interaction.

Because of the fact that both α-tubulin and β-tubulin are coded by several genes, and are subjected to different post-translational modifications, much heterogeneity among the tubulin monomers as well as dimers exists. The C-terminal sequence of both α-tubulin and β-tubulin is unstructured and contains highly negatively charged residues (Nogales et al. 1998; Lowe et al. 2001). Despite great heterogeneity within the C-terminal tails of different tubulins, the negatively charged residues are highly conserved in both α-tubulin and β-tubulin (Fig. 4a). Due to the presence of these highly negatively charged residues, the calculated and measured isoelectric points of different α-tubulin and β-tubulin monomers are very low and range from 4.8 to 5.2 (Towbin et al. 2001; Stracke et al. 2002; Verdier-Pinard et al. 2003). The measured pI around 4.2 for the αβ-tubulin dimer (the predominant form in which both monomers exist) is even lower than the pI of the monomers alone (Stracke et al. 2002).

The majority of the microtubule-binding proteins interact with microtubules and tubulin via these acidic C-terminal tail sequences. Our study points at two small sequence stretches within the C-terminus of TRPV1 (amino acid 710–730 for stretch 1 and amino acid 770–797 for stretch 2, respectively), each of which can modulate the tubulin interaction. These sequences have a basic pI value of 11.17 and 12.6, respectively. The binding capability of smaller- and deletion-fragments of TRPV1-Ct correlates well with two factors: the presence or absence of these two short basic stretches and the overall pI of the protein. This is in agreement with many observations showing that the majority of tubulin interacting proteins contain short imperfect repeat sequences composed of basic amino acids. For example, isoforms of microtubule-binding protein tau contain three to four 18-amino acid long imperfect repeats separated by 13–14-amino acid inter-repeat sequences (Himmler et al. 1989; Goode et al. 2000). Doublecortin (Dcx), another microtubule-binding protein, contains two repeat sequences with high pI (9.7 and 9.9) by which the microtubule interaction is mediated (Taylor et al. 2000). Several microtubule-associated proteins (MAPs) also contain repeat sequences with basic pI important for microtubule binding (Lewis et al. 1988; Noble et al. 1989; Al-Bassam et al. 2002). Microtubule interaction of the kinesin motor domains is attributed to the basic amino acids located at the surface (Woehlke et al. 1997). A monomeric kinesin (KIF1A) has much higher affinity for microtubules and an enhanced processivity along the microtubules due to the presence of six extra lysine residues within the ‘K-loop’ of the motor domain (Okada and Hirokawa 1999). The microtubule-binding domain of Stu2p contains highly basic amino acids with a predicted pI of 10.7 (Wang and Huffaker 1997). Notably, the microtubule-binding domain of Stu2p contains two imperfect repeat sequences. A short peptide (KKKKKSKTKCVIM) with multiple lysine residues representing the C-terminus of K-Ras has been reported to interact with microtubules (Thissen et al. 1997; Chen et al. 2000).

Our conclusion that these two short basic sequences are important for tubulin binding is furter strengthened by the fact that positively charged amino acids located within these two stretches are distributed on one side of a putative helix (Fig. 4). More interestingly, the stretch 1 contains several hydrophobic amino acids distributed on this putative helix just opposite to the charged basic amino acids (Fig. 4). Therefore, it is possible that this portion of the C-terminus is partially embedded in the plasma membrane while the other exposed surface is involved in tubulin binding. It is important to mention that the α-tubulin-binding site of mGluR7 also forms a putative helix with positively charged residues located towards one direction (Saugstad et al. 2002).

In absence of X-ray or NMR data, the structure of the C-terminal cytoplasmic domain of TRPV1 has been modelled by two groups (Vlachováet al. 2003; García-Sanz et al. 2004). According to the model proposed by García-Sanz et al., the first stretch sequence is exposed and therefore easily accessible to interact (García-Sanz et al. 2004). In this study, we did not measure the ‘Kd’ value of the interaction, but the binding of two different biotinylated-peptides to the tubulin at nanomolar concentration and observed interaction between MBP-TRPV1-Ct with tubulin even at the high salt condition (0.5 mol/L, data not shown) indicates for a stable and strong binding. Though our results strongly suggest that the C-terminal cytoplasmic domain of TRPV1 contains two tubulin-binding sites, from our study, it is not clear how many tubulin (dimer/monomer?) binds per receptor. It is possible that these two sequences bind tubulin independent of each other and there is a cooperative binding. It is also possible that in native condition, the tubulin binding by the two short stretches are masked by the presence of short neighbouring sequences or other interacting proteins that contain negative charges. From our study it is also not clear whether all the positively charged residues present within each stretch are important for tubulin binding. But our experiments show that subtilisin-digested tubulin does not bind to the MBP-TRPV1-Ct. As subtilisin-digested tubulin retain its core structure but loose the C-terminal over-hanging acidic region (see Fig. S1), it indicates that the TRPV1-Ct-binding ability of tubulin is most likely located within the C-terminal overhanging regions.

The C-terminal sequence of TRPV1 is shown to be involved in several other interactions and functions and may represent a ‘hot spot’ for TRPV1 regulation (Fig. 10). For example, the region comprising amino acid residues 684–721 has been shown to be important for tetramerisation (García-Sanz et al. 2004). Amino acid 761 has been shown to be important for the capsaicin-sensitivity (Jung et al. 2002). Vlachováet al. demonstrated that the C-terminal tail of TRPV1 carries structural determinants rendering the receptor sensitive to heat and capsaicin. They could demonstrate that deletion of the distal 72 amino acids results in a decline of the capsaicin-, pH-, and heat-sensitivity of the receptor (Vlachováet al. 2003). Moreover, the C-terminal tail contains phosphorylation sites used by protein kinase C (Numazaki et al. 2002) and Ca2+/calmodulin-dependent protein kinase II. Phosphorylation of these sites affects the TRPV1 desensitisation in the presence of Ca2+ (Jung et al. 2004). Two serine residues (at position 774 and 820) located within the C-terminus of TRPV1 are phosphorylated by PKA in vitro (Bhave et al. 2003; Mohapatra and Nau 2003). Furthermore, Numazaki et al. detected a short sequence within the C-terminal tail that is critical for receptor desensitisation (Numazaki et al. 2003). They could also prove that this sequence contains a binding site for calmodulin. Eferin, an EF-hands-containing Rab11/25-interacting protein was reported to bind at the C-terminal cytoplasmic domain of TRPV1 (Lee 2005). Furthermore, the C-terminal sequence of TRPV1 contains a PIP2 binding site, which negatively regulates the ion channel activity (Prescott and Julius 2003). Remarkably tubulin-binding sites detected in this study are located close to the regions that are important for receptor tetramerisation, PIP2 binding or PKC phosphorylation (Fig. 10). Hence it is possible that tubulin binding to the C-terminus of TRPV1 may alters these interactions.

Figure 10.

 The C-terminus of TRPV1 contains structurally and functionally important residues. Arrows and brackets indicate different important domains and residues located within the C-terminus. Numbers of amino acids are written in green. Blue areas indicate regions of tubulin binding. The exact binding site for Eferin is not known. Putative PKA and PKC phosphorylation sites (S774 and S820) are indicated by asterisk (*) sign. The drawing is not exactly to scale.

The two short basic stretches present in TRPV1 are highly conserved in most of the reported mammalian orthologous sequences (Fig. 11). Among the members of the TRPV subfamily, similar sequences including positively charged amino-acids within the first sequence stretch are conserved to a certain extent, especially among TRPV1, TRPV2, TRPV4, and TRPV3 (not so much in TRPV5 and TRPV6) (Fig. 11). The second sequence stretch described above is much less conserved (Fig. 11). In agreement with the significance of these short sequences, a small sequence of the C-terminal cytoplasmic domain of TRPV4 has been shown to interact with MAP7, a microtubule binding protein (Suzuki et al. 2003). Additionally, TRPV4 has been shown to be important in mechanical hyperalgesia induced by taxol, a microtubule cytoskeleton-regulating drug (Alessandri-Haber et al. 2004). In agreement with that notion, the involvement of an intact microtubule cytoskeleton in the second messenger signalling for inflammatory pain has also been reported (Bhave and Gereau 2003; Dina et al. 2003).

Figure 11.

 Two short sequence stretches located within the C-terminus of TRPV1 are conserved. (a) Shown is the sequence alignment based on TRPV1 sequences from different species. NCBI accession numbers are indicated. Rat (AF029310), Mice (CAF05661), Dog (AAT71314), Human (NP_542437), Rhesus monkey of Indian origin (XP_001117609), Guinea pig (AAU43730), Rabbit (AAR34458), Chicken (NP_989903). Porcine TRPV1 sequence is described in Ohta et al. (2005). Identical amino acids are shown in blue colour. Basic amino acids are indicated by asterisk (*). (b) The distribution of basic amino acids within the first stretch is conserved to certain extent in few other TRPV family members. Shown is the sequence alignment of different TRPV members (based on sequences from rat species only). Using clustlaw software available in the expasy site does alignment. NCBI accession numbers are indicated. TRPV1 (AF029310), TRPV2 (AAH89215), TRPV3 (NP-001020928), TRPV4 (NP-076460), TRPV5 (AAV31121) and TRPV6 (Q9R186). Basic amino acids are written in blue colour.

In summary, our work identifies two short basic-amino acid stretches within the C-terminus of TRPV1 that interacts with tubulin. These stretches represent novel tubulin-binding motifs that are also conserved to a certain extent in some other members of the TRPV subfamily.

Acknowledgements

We thank Mark Hartman, Linda Stewani and Shu Liu for preparing the TRPV1 constructs. We thank Oliver Bogen for providing enriched neurofilament preparation. We are thankful to Dr Linda Amos (Cambridge, UK) for providing subtilisin-digested tubulin and related control reagents. We acknowledge the kind support provided by Prof H.H. Ropers. Financial support by Max Plank Institute of Molecular Genetics (Berlin), BMBF, Deutsche Forschungsgemeinschaft, Sfb 515, and Fonds der Chemischen Industrie is acknowledged.

Ancillary