Anxiety induced by prenatal stress is associated with suppression of hippocampal genes involved in synaptic function

Authors


Address correspondence and reprint requests to Marta Weinstock, Department of Pharmacology, School of Pharmacy, Hebrew University, Ein Kerem, Jerusalem 91120, Israel. E-mail: martar@md.huji.ac.il

Abstract

Exposure of pregnant women or animals to stress during a critical period of foetal brain development increases the likelihood of anxiety, depression and learning deficits that are associated with structural alterations in the offspring hippocampus. In this study, we report the effect of gestational stress in rats on anxiogenic behaviour and hippocampal gene expression of their 23-day-old female offspring. As the rat brain continues to develop after birth, we also used the procedure of handling (H) during the first 10 days of life to reverse the anxiogenic behaviour of prenatally stressed (PS) rats. By means of micro-array analysis on hippocampal extracts, we found that the expression of about 6.1% of 9505 valid genes was significantly altered by prenatal stress (p < 0.05). Of these, 48% were over-expressed and 52% under-expressed. The latter included ∼300 genes that participate in axonal growth, regulation of ion channels and transporters, trafficking of synaptic vesicles and neurotransmitter release. About 30% of the genes that were down-regulated in PS rats were restored to control levels by H. These include genes that play a role in pre-synaptic organization and function. Our results provide a possible relationship between hippocampal gene expression and changes in behaviour resulting from prenatal stress.

Abbreviations used
CH

Control handled

CNH

Control non-handled

cRNA

complementary RNA

EPM

elevated plus maze

GO

gene ontology

H

Handling

PS

prenatally stressed

PSH

prenatally stressed handled

PSNH

prenatally stressed non-handled

RT-PCR

reverse transcriptase PCR

SNARE

soluble N-ethylmaleimide-sensitive factor receptor

Several reports have linked prenatal stress to a greater incidence of anxiety, affective disorders, attention deficits and schizophrenia (Weinstock 1997; van Os and Selten 1998; Geddes 1999; Linnet et al. 2003; Maccari et al. 2003). In rodents and non-human primates, prenatal stress also increases the incidence of attention deficits (Schneider 1992) and induces anxiogenic and depressive-like behaviour, characterized by increased fear of novelty and impaired coping under adversity (Fride et al. 1986; Fride and Weinstock 1988) and learned helplessness and anhedonia, respectively (Fride et al. 1986; Alonso et al. 1991; Schneider 1992; Keshet and Weinstock 1995; Milberger et al. 1997). A chronic anxiety state in association with excessive fear of novelty has been linked to alterations in the size of the lateral amygdaloid nucleus in humans (De Bellis et al. 2000) and prenatally stressed (PS) rats (Salm et al. 2004) and also in the size of the synaptic area of the mossy fibres in the dentate gyrus (Belzung 1992). PS non-human primates and rats also show a number of structural changes in the hippocampus, including a decrease in hippocampal synapses (Hayashi et al. 1998), the number of granule cells in the dentate gyrus (Schmitz et al. 2002) and in neurogenesis (Lemaire et al. 2000; Coe et al. 2003).

Because a considerable amount of brain development occurs after birth in the rat, it is possible to influence the plasticity of the nervous system and behaviour by an early environmental manipulation known as handling (H). This procedure, first described by Levine et al. (1967), involves removal of the pups from the maternal nest for periods of 3–15 min during the first 10–14 days of life. Its effect on behaviour was detected when compared with that of rats from which all contact with humans had been withheld during the pre-weaning period (Levine et al. 1967; Ader 1970). In later studies, H was found to prevent the hyperactivity induced by isolation stress in adult rats (Gentsch et al. 1988) and the increased fear of novelty in PS rats (Wakshlak and Weinstock 1990).

The aim of the present study was to identify the molecular processes in the hippocampus underlying anxiety induced by prenatal stress. As the incidence of anxiety and depression and alterations in hippocampal structure are more prevalent in females (Alonso et al. 1991; Kuehner 1999; Schmitz et al. 2002; Guéet al. 2004; Zhu et al. 2004), we looked for changes induced by prenatal stress in genes and proteins in rats of this gender. To enable us identify the gene changes that could be linked to anxiogenic behaviour, we determined whether any of them were reversed by H.

Materials and methods

Animals and treatments

All experiments were carried out according to the guidelines of the University Committee for Institutional Animal Care, based on those of the National Institutes of Health, USA. Female pathogen-free (SPF) Wistar rats weighing 280–300 g (Harlan Biotech, Jerusalem, Israel) on day 1 of pregnancy (detected by the presence of a vaginal plug) were randomly allocated to stress and control (10 rats each) groups, as previously described (Poltyrev and Weinstock 2004).

Maternal treatment

From day 17 to day 22 of gestation, rats were stressed daily in a random order by three different stressors, restraint, forced swim and saline injections once on each of 2 of 6 days, to prevent the rats from adapting to them. Stress was applied to the rats during this period because it is when key areas of the limbic system develop (Bayer et al. 1993). Control pregnant females were left undisturbed in their home cages. The length of gestation was 22.5 days.

Postnatal treatment

After birth, all litters were culled to eight pups (no more than three of one sex and five of the other). From day 1 to day 10 of age, the pups from half the control and half the stressed litters were handled by removing them from the maternal cage for only 3 min as described in Wakshlak and Weinstock (1990). As shown in our earlier study, this manoeuvre does not significantly affect the behaviour of controls, if they are handled in the usual manner by experimenters. The pups were weaned at the age of 21 days and housed in groups of two to three, according to sex and prenatal treatment. All subsequent experiments described in the following paragraphs were performed on the female offspring shortly after weaning in order to avoid the effect of additional environmental factors on gene expression.

Anxiogenic behaviour

Anxiogenic behaviour was tested in the elevated plus maze (EPM) at the age of 12 weeks in 11–12 females of each group of control non-handled (CNH), PS non-handled (PSNH), control handled (CH) and PS handled (PSH) rats, as previously described (Poltyrev and Weinstock 2004). The EPM has two open and two closed arms presenting the rat with a conflict between the desire to explore a novel situation and its fear of height and open spaces (Handley and Mithani 1984). Anxiolytic agents like diazepam increase, and anxiogenic agents decrease the time spent in the open arms of the maze (Pellow and File 1986). It has been shown that PS rats make fewer entries into, and spend less time in the open arms of the maze than controls (Fride and Weinstock 1988; Vallee et al. 1997). This behaviour is consistent with increased anxiety, can be detected more readily in females at the age of 23–30 days (Fig. 1) and persists into adulthood (Zagron and Weinstock, unpublished data).

Figure 1.

 Time spent by young PS and control male and female rats in the open arms of the EPM. Open bars: control; Grey bars: PS group. *Significantly different from control, p < 0.01. Each experimental group comprises eight rats.

Gene expression in hippocampus

At the age of 23 days, three rats were chosen randomly from each group of CNH, PSNH, CH and PSH litters. They were decapitated and the whole hippocampi rapidly dissected out, snap frozen in liquid nitrogen and then stored at –70 C until RNA isolation. Total RNA of hippocampus was prepared with Triazol and subsequently cleaned by the Rneasy Mini Kit (Qiagen, Valencia, CA, USA). RNA quality and quantity were measured by spectrophotometer with A260/A280 of 1.85–2.1. The RNA was prepared for hybridization using the protocol recommended by Affymetrix (Santa Clara, CA, USA). Briefly, total RNA (10 μg) was first reverse transcribed using a T7-Oligo (O’Donovan et al. 1999). Following Rnase H-mediated second-strand cDNA synthesis, double-stranded cDNA was purified to serve as a template in the subsequent in vitro transcription reaction. The reaction was carried out in the presence of T7 RNA polymerase and a biotinylated nucleotide analogue and ribonucleotide mix for complementary RNA (cRNA) amplification and biotin labelling (BioArray Labeling Kit; Enzoi Diagnostics, Farmingdale, NY, USA). The biotinylated cRNA targets were cleaned up, fragmented and hybridized to GeneChip expression arrays (Affymetrix) RAE 230A. After washing, the chips were stained with a streptavidin–phycoerythrin conjugate for fluorescence detection. Hybridization on a test chip and analysis for the quality of the labelled cRNA were performed for each of the cRNA samples prior to the hybridization experiment. Ratios of 3′/5′ for glyceraldehyde-3-phosphate dehydrogenase and ß-actin, used as a measure of the quality of the RNA and not as a standard, were confirmed to be within acceptable limits as recommended by Affymetrix. BioB spike controls were found to be present on all the arrays. When scaled to a target intensity of 150 (using Affymetrix Microarray Suite 5.0 array analysis software), scaling factors for all arrays were found to be within acceptable limits (1.5–2.8), as were the background, Q values and mean intensities.

Reverse transcriptase PCR

Reverse transcriptase (RT)-PCR was performed to validate the changes in a number of genes from the micro-array using RNA that was identical to that used for the GeneChip experiment and RNA prepared from animals taken from the same groups. All reactions were performed on the same cDNA preparation. For each reaction, the number of PCR cycles was optimized to match the dynamic range of the reaction (22–32 cycles). All reaction products were designed to range between 190 and 270 nucleotides. Pairs of oligonucleotides for two genes with a difference in amplimer length larger than 50 nucleotides were included in each reaction to reduce experimental variation. Each set of oligonucleotides was tested at least twice. Samples were treated for 15 min with 10 U of Rnase-free Dnase (Qiagen) at 25 °C prior to the RT reaction. The relative amounts of mRNA were normalized to L19 (housekeeping gene of the large subunit of the ribosome). Oligonucleotide primers used are for forward (F) and reverse (R) for the following genes: Stathmin like-2 F: cggaagctccacgaactcta, R: tagcctcacggttttcctta; SV2b F: aactcccaagcaaatggatg, R: atcctggaaataccggatca, Rim1 F: cgtcgtcggacacctaagag, R: tgccctggtaagacttgtg; Synaptotagmin 5 F: gtctgaagaaacggaagacct, R: cccttggtaaagctgcttag; L19 F: ctgaaggtcaaagggaatgtg, R: ggacagagtcttgatgatctc; Rab3a F: cgccagcttgtctcagtttag, R: ggctgtggtgatggttcggta; Staufen F: tgctgcagaagctatgctgt, R: gcctagagttgtgccagagg.

Western blot

Following separation by sodium dodecyl sulfate (SDS) – polyacrylamide gel electrophoresis, extracts of the whole hippocampus from 23-day-old littermates of the rats used for the gene array were prepared for western analyses. Cell lysates were homogenized in solubilization buffer [Tris 50 mmol/L, NaCl 150 mmol/L, 1% (v/v) NP-40] supplemented with protease inhibitors (1 mmol/L phenyl methyl sulphonyl fluoride, 5 μmol/L leupeptin, 10 μg/mL aprotinin and 10 mmol/L EDTA) on ice. The extracts (1 mL/g tissue) were centrifuged (14 000 g, 20 min, 4°C) and used for separation on 12.5% SDS gels. Protein concentrations were determined by BCA (Pierce, Rockford, IL, USA) and blotted on nitrocellulose membranes.

Major synaptic proteins were detected by means of a set of antibodies to synaptophysin (Sigma, St Louis, MO, USA), synaptojanin (Chemicon, Temecula, CA, USA), synapsin (Chemicon), synaptotagmin 1 (Alomone Labs, Jerusalem, Israel) and SNAP-25 (kindly contributed by N. Takahashi, Japan). Secondary antibodies used to detect monoclonal and polyclonal antibodies were Goat α mouse and Goat α rabbit coupled to HRP (Jackson, West Grove, PA, USA). β-tubulin (Sigma) was used for normalization, as it was unchanged in all three experimental groups. Each experiment was repeated at least twice. Western blots were quantified and normalized according to controls. Detection method used was enhanced chemiluminescence based and quantification was performed by means of ImageGauge.

Data analysis

Differences in behavioural parameters in the EPM between the four groups of rats were analysed by anova for factors MATERNAL (stress or control) and NEONATAL treatment (handled or non-handled). Duncan’s post hoc test was applied when appropriate, and a difference of p < 0.05 was considered to be statistically significant.

Changes in gene expression were analysed by means of Microarray Suite 5.0. We included genes that showed a differential expression in intensity of >500. We considered genes to be valid for analysis, if the gene probe was defined as Present (P) according to Microarray Suite 5.0 for at least two of three samples in each experimental group. Most (86%) of the genes were assigned P for all three samples. Genes that did not have a signal intensity of at least 20 in all of the samples were disregarded. Significance of the difference between CNH and PSNH, PSNH and PSH, and CNH and CH was tested by Student’s t-test. Only genes that showed a difference in expression greater than 1.25-fold and statistical difference of p < 0.05 between groups were considered.

Functional annotation was performed by means of the statistical model implemented in DAVID (Dennis et al. 2003) and GOTM (Zhang et al. 2004). DAVID is a web-based application that translates the list of probes to functional annotations that integrate data from the Gene Ontology (GO) Consortium (Camon et al. 2004). These tools apply a statistical model based on annotation sources (i.e. GO) to rank the coregulated functional categories among the differentially expressed genes. Ranking was performed according to a modified Fisher’s exact test referred to as ‘enrichment score’ (Dennis et al. 2003). The p-value for the ‘enrichment score’ is the probability of finding a certain number of genes that have a specific annotation by chance (given the number of genes in the set with this annotation, the total number of genes in the database and the number of genes in the database with this annotation). Changes in gene expression between any pair of the experimental groups were tested for enrichment in functional annotations. No such functional enrichment was found among genes in the CH group compared with CNH. Although all gene changes resulting from prenatal stress were analysed, the major focus was on those that showed a significantly reduced expression which was restored by H.

Significance of the difference among the various groups in the levels of the proteins from the western blots of hippocampal extracts was analysed by anova.

Results

Effect of prenatal stress and handling on behaviour in the EPM

Adult PSNH displayed greater fear than CNH rats in the EPM. This was indicated by the shorter amount of time spent in the open arms and the smaller ratios of the number of open/total arms entries (Fig. 2). There was a significant interaction between maternal and neonatal treatment (F(1,43) = 4.61, p < 0.05), as H had a greater effect on PS than on control rats. A post hoc analysis showed that the ratio of open/total arms entries was significantly lower in PSNH rats than in either CNH or PSH (p < 0.05), and that there was no significant difference between these ratios in CNH, PSH or CH rats.

Figure 2.

 Behaviour of adult handled and non-handled control and PS female rats in the EPM. Open bars: control; Grey bars: PS group. *Significantly different from all other groups, p < 0.05. Each experimental group comprises 11–12 rats.

General gene analysis

DNA GeneChip technology (Affymetrix) was used to compare transcriptional profiles of PSNH and CNH and the effect of H on them. The RAE 230A micro-array includes 16 000 probes (representing ∼12 000 genes). Of 9505 valid genes (see Materials and methods section), 6.1% showed a significant difference between the CNH and PSNH groups (p < 0.05). Of these genes, 48% were over-expressed and 52% under-expressed in PSNH relative to CNH (total of 582 genes). These gene sets were derived from a merger of the top lists of independent analysis tools and included the overlap between the lists (see Materials and methods section). An unsupervised classification algorithm for two groups completely separated CNH from PSNH rats. No such separation was achieved between CNH and CH, indicating that H did not cause similar significant gene changes in control offspring.

Functional characterization of genes with reduced expression in prenatally stressed rats

While the difference in behaviour between PS and control offspring is more readily detected in intimidating situations like the EPM (Fride and Weinstock 1988; Vallee et al. 1997) and in the defensive withdrawal test (Ward et al. 2000), it should be pointed out that the analysis of genes was made in naïve rats. In addition, about 4 weeks had elapsed between the exposure of the foetus to the consequences of maternal stress and the measurement of changes in gene expression at 23 days of age. It can therefore be expected that the absolute fold change in gene expression under resting conditions would be relatively small. A common practice in such instances is to search for statistically sound coherence in cellular processes and pathways that accentuate such small changes. This was accomplished by means of functional categorization by GO (Camon et al. 2004), which allowed the unification of genes by their cellular biochemical process and cellular localization. Functional categorization by GO is available for about 40% of the genes and enabled us to reveal the cellular and biochemical functions of the genes that showed a significantly decreased expression as a result of prenatal stress. Most of these genes are involved in the following processes: (i) neuronal growth and structural plasticity; (ii) regulation of membrane potential, mainly ion channels and transporters; (iii) trafficking of synaptic vesicle and the neurotransmitter release machinery. Table 1 shows the degree of statistical enrichment according to GO annotations (p < 0.05) for genes that were decreased or increased, respectively, by prenatal stress compare with control.

Table 1.   Enrichment of molecular function categories based on GO annotation for the genes that are significantly changed in PSNH compared with CNH
Gene ontology termsGroupDown (%)Down p-valueaUp (%)Up p-valuea
  1. aFisher’s test p-value implemented in enrichment score according to DAVID software with a threshold of 0.05 (see Methods section). The functional groups are A, maintenance of growth; B, trafficking of the secretory organelles and regulation of neurotransmitter release; C, membrane potential and physiology of the neurons. Down and Up refer to down- and up-regulated genes in PSNH relative to CNH, respectively.

TransportA15.00.0000915.10.0017
Vesicle-mediated transportB4.00.00174.30.0083
Cell physiological processA20.40.002242.70.045
Cell growth and maintenanceA18.10.0035  
Calcium ion transportC2.70.0067  
Cation transportC5.30.01253.60.07
Cell–cell signallingA4.40.0125  
Synaptic transmissionB4.00.0130  
Synaptic vesicle transportB1.80.0131  
Neuromuscular physiologyA4.00.0165  
Transmission nerve impulseA4.00.0165  
Inorganic cation transportC2.70.0216  
Ion transportC6.60.02345.70.0049
Metal ion transportC4.40.02623.20.04
Organismal movementB4.00.0297  
Intracellular transportB3.50.03635.40.007
EndocytosisB1.80.04551.80.0455
Actin cytoskeletonA  3.230.001
Calmodulin bindingB  2.510.0016
Actin bindingA  2.510.024

Functional characterization of genes that showed recovery of their levels of expression following handling

The expression of about 30% of the genes (total of 93 genes), which were down-regulated by prenatal stress (Table 2) and were significantly up-regulated by H satisfied the statistical criteria (p < 0.05). By contrast, these same genes remained unchanged in the CNH group.

Table 2.   Genes showing reduced expression following PS that was reversed by H
IDaGene name
  1. aID, the Affymetrix GeneChip ID. The list is sorted alphabetically. The following probes showed a similar trend in their relative expression, but are associated with un-annotated ESTs supported sequences: 1371321_at, 1371465_at, 1371512_at, 1371954_at, 1372623_at, 1375108_at, 1379073_at, 1372313_at, 1372901_at, 1371472_at, 1372719_at, 1374968_at, 1375192_at, 1376400_at, 1384204_at, 1390132_at, 1391437_at, 1367508_at.

1372847_atACN9 homolog (Saccharomyces cerevisiae) (predicted)
1368587_atApolipoprotein C-I
1369122_atBcl2-associated X protein
1373081_atBrain-specific angiogenesis inhibitor 1-associated protein 2
1368437_atCarbonic anhydrase 4
1374252_atCentrosomal protein 1 (predicted)
1371395_atChromobox homolog 3 (HP1 gamma homolog, Drosophila)
1373256_atChromodomain helicase DNA-binding protein 3 (predicted)
1372132_atCNDP dipeptidase 2 (metallopeptidase M20 family) (predicted)
1368584_a_atComplexin 2
1370123_a_atCortactin isoform B
1372514_s_atDynein, axonemal, light chain 4 (predicted)
1374016_atEndothelial differentiation, lysophosphatidic acid GPCR, 2
1370503_s_atErythrocyte protein band 4.1-like 3
1376578_atEuchromatic histone methyltransferase 1 (predicted)
1367766_atExpressed in non-metastatic cells 2
1372662_atF-box protein 34 (predicted)
1374103_atFrequenin homolog (Drosophila)
1373170_atG protein pathway suppressor 2 (predicted)
1367954_atGlial cell line-derived neurotrophic factor family receptor alpha 1
1371392_atGlucose phosphate isomerase
1370240_x_atHaemoglobin alpha, adult chain 1
1369868_atImplantation-associated protein
1388240_a_atIntegrin alpha 7
1373500_atLeucine-rich PPR-motif containing (predicted)
1375726_atLIM domain only protein 7
1367923_atLipidosin
1390827_atMAD homolog 3 (Drosophila)
1371607_atMicrotubule-associated protein 4
1374468_atMyeloid differentiation primary response gene 88
1369948_atNerve growth factor receptor-associated (TNFRSF16) protein 1
1374075_atNSF attachment factor, SNAP, gamma (predicted)
1368261_atNeurexin 3
1371812_atP55
1388076_atPAI-1 mRNA-binding protein
1370214_atParvalbumin
1371455_atPhosphomannomutase 1 (predicted)
1373243_atPhosphomevalonate kinase (predicted)
1388847_atPositive cofactor 2, multiprotein complex, Q-rich- associated protein
1370187_atPropionyl coenzyme A carboxylase, beta polypeptide
1370746_atProtein kinase, cAMP dependent, catalytic, beta (predicted)
1373741_atPseudouridine synthase 1 (predicted)
1369564_atRad- and gem-related GTP-binding protein 2
1367596_atRibosomal protein S26
1372240_atSarcoglycan, alpha (dystrophin-associated glycoprotein) (predicted)
1368058_atScaffold attachment factor B
1370116_atSeptin 3
1371425_atSerine/arginine repetitive matrix 1 (predicted)
1371487_atSH3 domain binding glutamic acid-rich protein-like 3 (predicted)
1373605_atSimilar to 106 kDa O-GlcNAc transferase-interacting (predicted)
1377656_atSimilar to 2600016B03Rik protein (predicted)
1374362_atSimilar to 4930566A11Rik protein (predicted)
1373958_atSimilar to ALEX3 protein
1373945_atSimilar to bruno-like 5, RNA-binding protein
1372157_atSimilar to CGI-143 protein (predicted)
1371399_atSimilar to over-expressed breast tumour protein
1371863_atSimilar to phosphatidylglycerophosphate synthase (predicted)
1370925_atSimilar to potential phospholipid-transporting ATPase IIB
1372054_atSimilar to sex-determination protein homolog Fem1a
1369160_a_atSolute carrier family 4, sodium bicarbonate cotransporter, 7
1368391_atSolute carrier family 7 (cationic amino acid transporter), 1
1370042_atStathmin-like 2
1369251_a_atSynapsin I
1369628_atSynaptic vesicle glycoprotein 2b
1368276_atSynaptophysin
1373865_atSynaptosomal-associated protein, 91 kDa homolog (mouse)
1369058_atSynaptotagmin 3
1368417_atSynaptotagmin 5
1370691_a_atThyroid hormone receptor alpha
1371695_atTranslocated promoter region (predicted)
1373495_atUbiquitin-conjugating enzyme E2, J1 (predicted)
1367481_atVacuolar protein sorting 28 (yeast) (predicted)
1368641_atWingless-related MMTV integration site 4
1372483_atZinc finger protein 469 (predicted)
1390649_atZinc transporter ZnT-3

These genes were reanalysed by GOTM (Zhang et al. 2004), a tool that presents a subset of the GO hierarchy that is associated with statistically enriched functional categories. The results of the analysis are shown in Table 3.

Table 3.   Enriched functional categories according to GOTM of genes, the expression of which was altered in PSNH and restored by H
Go termObsaExpbRatiocp-valued
  1. aObserved gene number in the GO category; bExpected gene number in the GO category; cThe Exp/Obs enrichment. dSignificance of enrichment for the GO category that show a significant p-value of <0.01.

Down-regulated (93 genes)
Biological process
 Transmission of nerve impulse72.372.950.008718
 Synaptic transmission72.253.110.006539
 Regulation of neurotransmitter levels40.666.060.004077
 Neurotransmitter secretion30.436.980.008711
 Membrane organization and biogenesis30.2114.290.001184
 Secretory pathway61.344.480.002005
 Exocytosis40.577.020.002403
 Calcium ion-dependent exocytosis20.1414.290.008633
 Vesicle-mediated transport72.412.90.009429
 Synaptic vesicle transport30.3100.003289
 Secretion61.753.430.007488
Molecular function
 Death receptor binding20.04500.000460
 SNARE binding20.1513.330.009689
 Syntaxin binding20.1216.670.006595
Cellular component
 Cell projection51.114.50.004762
 Neuron projection30.427.140.008148
 Axon20.1513.330.009680
 Cytoplasmic vesicle51.333.760.009904
 Cytoplasmic membrane-bound vesicle51.333.760.009904
 Coated vesicle50.826.10.001243
 Clathrin-coated vesicle50.726.940.000697
 Synaptic vesicle50.4411.360.000070
 Synaptic vesicle membrane20.1216.670.006588
 Synapse50.995.050.002856
Up-regulated (125 genes)
Biological process
 Transmembrane receptor protein tyrosine phosphatase signalling pathway20.1118.180.005
 Transport2716.161.620.003
 Localization2918.51.570.004
 Establishment of localization2918.411.580.003
Molecular function
 Transmembrane receptor protein tyrosine phosphatase activity20.1200.004
Cellular component
 None    

The enrichment in GO annotations for the genes that were analysed is shown by a directed acyclic graph based on the hierarchy of these annotations. These genes play a role in trafficking in the synapse and in the neurotransmitter release machinery (Fig. 3; Table 3). By contrast, other genes that were down-regulated and linked to growth and electrical properties of neurons were not restored by H. (Table 1).

Figure 3.

 A diacyclic graph according to GOTM. In bold and grey background are the enriched gene ontology (GO) (p < 0.01) belonging to ‘biological process’ category. For details see Table 2. Only 42.5% of the genes differentially expressed between the CNH and PSNH rats are annotated by GO.

Table 3 also shows the enrichment in GO annotations for the 125 genes that were up-regulated by stress and reversed by H. As can be seen, they conform to only a small number of GO terms that are not associated to any specific process, unlike those genes that were down-regulated by prenatal stress and reversed by H.

Relative expression of genes associated with the pre-synaptic secretory apparatus

The prevalent functional category that was restored by H is associated with the structure and function of the synapses. RT-PCR of various genes that have been linked to vesicle trafficking and organization of the pre-synaptic secretory proteins, e.g. stathmin like-2, rab3A, SV2b and to a lesser extent synaptotagmin 5, validated the results obtained from the GeneChip, which were changed by prenatal stress and H, as well as those that were unchanged. The latter group included genes that are involved in dendritic maturation (staufen) and in the regulation of the active zone (Rim1). Results of the RT-PCR reactions and the expression profile for eight representative genes are shown (Fig. 4).

Figure 4.

 Reverse transcriptase PCR (RT-PCR) for selected genes. RT-PCR reaction products are shown following separation in 1.5% agarose gels and ethidium bromide staining. (a) Representative results for a number of selected genes – stathmin-like 2, rab3A, synaptotagmin 5 (tagmin 5), SV2b, staufen (RNA localization) and Rims (Rab2 interaction, active zone protein) are shown. The level of the housekeeping ribosomal L19 gene is used for calibration and as a reference to test the relative expression. (b) The expression levels of specific amplimers were determined by densitometry relative to L19 expression. The plot summarizes results for the genes shown in (a) and Arc (activity-dependent cytoskeleton-associated gene). Each gene from each group (CNH, PSNH and PSH) was measured twice and the average value is plotted.

Change in expression of major pre-synaptic proteins

Prenatal stress significantly reduced the levels of synaptophysin, synaptotagmin 1 and synaptojanin as shown by western analysis (Fig. 5). H only restored the expression of the first two proteins (Figs 5a and b). By contrast, there were no detectable changes in synapsin 1 and rab3A proteins, despite changes in the levels of gene expression. Synapsin 1 is associated with a pre-synaptic cytoskeletal adaptor of synaptic vesicles and rab3A, with the regulation of their priming (Sudhof 2004). In agreement with the data from the GeneChip analysis, there was no difference in the expression of soluble N-ethylmaleimide-sensitive factor receptors (SNAREs), syntaxin 1A, SNAP-25 and VAMP-2 in PSNH, PSH or CNH and CH rats. These results indicate that some but not all the changes in proteins match the profile of those at the mRNA level. They also show that the effects of prenatal stress and H are very specific and cannot be attributed to a global change in synaptic proteins or in the number of synapses.

Figure 5.

 Western blot analysis of hippocampal protein extracts from CNH, prenatally stressed non-handled (PSNH) and PSH groups. (a) β-Tubulin is used as a reference for unchanged protein. SNAP-25 showed no difference in expression in the different groups. Synaptophysin, synaptotagmin 1 and synaptojanin showed a significant reduction in PSNH, but were not reversed by H. (b) The average differential expression (triplicate) for synaptophysin is shown. Significantly different from the CNH, *p < 0.005; significantly different from the PSNH #p < 0.01. There was no significant difference between the CH, CNH and PSH groups.

Discussion

The major new finding in this study is the identification of specific genes and proteins in the hippocampus of naïve juvenile female rats that show altered expression as a result of prenatal stress. The hippocampus was chosen because of its important role in the aetiology of anxiety and depression and because it shows specific structural changes both in humans (Campbell and MacQueen 2004) and in experimental animal models of these conditions (Lemaire et al. 2000; Coe et al. 2003). By performing the study in weanling rats, we attempted to limit any gene changes to those resulting from increased levels of stress hormones in the maternal milieu and early postnatal rearing influences. We found that differences in the behaviour of PS females from that of controls in the EPM could be detected at this early age with a smaller variance than that in adults, probably because of the absence of an influence of the oestrus cycle (Marcondes et al. 2001).

Having identified a number of genes that were altered by prenatal stress, we focussed on the genes that no longer differed from those of controls in rats that had been subjected to H, as this manipulation prevented the development of anxiogenic behaviour. Of 582 genes that were altered by prenatal stress, 52% were under-expressed and 48% over-expressed relative to controls. We did not include these genes in the present analysis, as they were unaltered by H and therefore less likely to contribute to the anxiogenic behaviour.

Genes that were down-regulated by PS relative to controls were found by GO annotation to fall into three main functional categories. These participate in; (i) development and axonal growth; (ii) function of ion channels, transporters and proteins that define the physiology of the neurons and (iii) trafficking of secretory organelles and regulation of neurotransmitter release (Table 1). About 30% of them were fully restored by H and are mainly associated with trafficking and regulation of neurotransmitter release.

Several complementary processes could be involved in the prevention of the anxiogenic effect of prenatal stress by H: (i) induction of new synapses; (ii) acceleration of axonal transport to the nerve terminal; (iii) reshaping of post-synaptic sites; (iv) reshaping of pre-synaptic sites; (v) activation of neurotransmitter release. However, our results show that H mainly affects processes (iv) and (v). It is also evident that the genes affected by H are not restricted to synaptic vesicle proteins (i.e. SV2b, synaptophysin), but include synaptic vesicle reorganizer proteins (i.e. synapsin) and those that directly regulate neurotransmitter release (i.e. synaptotagmin, rab3A, neurexin, complexin). Table 4 shows the role and the interacting partners for 22 representative genes that are associated with the GO term synaptic vesicles and synaptic transmission.

Table 4.   A representative list of genes that showed reduced expression as a result of prenatal stress
No. in Fig. 6aGene namesGene symbolNo. in familybReferenceCellular process (protein interaction)
  1. aGenes listed are those that were restored by H (bold, grey background) and the rest were unaffected by H. bThe numbers of family members that are detected in mammals, excluding alternative spliced variants.

1SV glycoprotein 2BSV2B3Lazzell et al. (2004)Synaptic vesicle exocytosis (synaptotagmin 1)
2Synaptotagmin 5SYT516Stevens and Sullivan (2003)Ca2+ sensor, trafficking, exo–endocytosis (Rab27, Ca2+ channel)
3Synaptotagmin 3SYT316Stevens and Sullivan (2003)Ca2+ sensor, exo–endocytosis (Syt9, Ca2+ channel and neurexin)
4Synaptophysin/p38SYN4Valtorta et al. (2004)Synaptic vesicle targeting, biogenesis, exo-endocytosis (Vamp, physophilin)
5Vesicle-associated membrane protein 1VAMP18Sudhof et al. (1989)Vesicle-mediated transport (Snap25, syntaxin 1)
6Vesicle-associated membrane protein 7VAMP78Martinez-Arca et al. (2003)Vesicle-mediated transport (Snap25, Vamp2)
7Blocked early in transport 1BET11Mossessova et al. (2003)ER to Golgi transport (Sec22)
8Huntingtin-associated protein 1HAP11Kittler et al. (2004)Synaptic transmission (huntingtin, cynactin 1)
9Potassium voltage-gated channel subfamily HKCNH18Jeng et al. (2005)Ion transport (potassium channel regulator 1)
10Rab2RAB240Short et al. (2001)ER to Golgi vesicle-mediated transport (GDP dissociation inhibitor 2)
11γ-SNAPNAPG3Chen et al. (2001)Fusion, vesicle trafficking (GAF-1, NSF and RIP11)
12Complexin 2/synaphinCPLX24McMahon et al. (1995)Synaptic vesicle exocytosis (SNAREs, syntaxin)
13Frequenin homologFREQ5O’Callaghan et al. (2005)Ca2+ binding, transmission regulation (KCND2)
14Cortactin isoform BCTTN1Racz and Weinberg (2004)Protein interaction (δ-catenin, dynamin 1)
15Stathmin-like 2/SCG10STMN24Liu et al. (2002)Neurite outgrowth, cytoskeleton (RGS6)
16Kinesin 1KIF5b25Kanai et al. (2004)Microtubule-based movement (merlin)
17Brain-specific angiogenesis inhibitor 1-associated protein 2BAP22Oda et al. (1999)Neurite outgrowth, cytoskeleton (Atn1, Bal1, Enah, Eps8, Shank1–3 and Wasf1–2)
18Synapsin 1SYN13Paggi and Petrucci (1992)Cytoskeleton (Nos1, Rab3 and F-actin)
19Neurexin 1NRXN14Dean and Dresbach (2006)Axon guidance (neuroligin 1)
20SNAP91/AP180SNAP914Sousa et al. (1992)Endocytosis (clathrin, AP2)
21AmphiphysinAMPH1Shang et al. (2004)Synaptic transmission (dynamin 1)
22Synaptojanin 1SYNJ1Irie et al. (2005)Synaptic vesicle endocytosis (amphiphysin)

The assembly of a functional synapse is a fully coordinated sequential process that is sensitive to cues from the environment (Ziv and Garner 2004). Neurotransmitter release is needed for the fine tuning and maintenance of synaptic connections (Verhage et al. 2000) and may be modulated by a few genes such as synaptotagmin 1, synaptophysin and SV2b, all of which were restored by H. These major synaptic vesicle proteins participate in multiple protein–protein interactions in the synapse (Table 4). Their relative amounts determine whether a synaptic vesicle will be engaged into a productive cycle of docking and fusion. Synaptophysin determines the accessibility of VAMP-2 to the SNARE complex (McMahon et al. 1996) and SV2b determines the accessibility of synaptotagmin 1 to the SNAREs and the Ca2+ sensitivity of the fusion complexes (Lazzell et al. 2004). A model that shows the location and function of representative genes that were altered by prenatal stress and H is shown (Fig. 6). Although the data do not reveal the identity of the synapses and neurotransmitters, other studies have shown that alterations occur in the release of noradrenaline, dopamine, serotonin and glutamate in PS rats (Weinstock 2001; Berger et al. 2002).

Figure 6.

 Schematic representation of a pre-synaptic site indicating genes that were detected in the current study. A scheme of a synaptic vesicle and a generic transport organelle is shown. Various proteins are marked according to their location and function. In bold and grey are shown those genes that showed a reduced expression as a result of prenatal stress that was restored by H. The rest were down-regulated by prenatal stress but not restored by H. For additional information of these genes see Table 4.

Several groups of genes down-regulated by prenatal stress were not restored by H. These include genes that are important for axonal transport [i.e. myosin V, kinesin-like proteins (Okada et al. 1995)], shaping of the post-synaptic sites, neurotransmitter receptors, scaffolding proteins containing PDZ domains (Kim and Sheng 2004) and neuronal SNAREs. SNARE proteins are transported in vesicles that do not contain other synaptic vesicle proteins (Okada et al. 1995) and their accumulation in the growth cone precedes synaptic vesicle protein transport and the maturation of a functional synapse (Igarashi et al. 1997). The highest change in expression in PSNH relative to CNH was obtained for ion channels including pre-synaptic voltage-gated Ca2+ type P/Q and several K+ channels. These ion channels regulate the electrical properties of the neuron, and their down-regulation suggests a potential decrease in excitability and electrical properties of the newly formed synapses. However, these also were unaffected by H, suggesting that they are less important in determining anxiogenic behaviour in PS rats. Other genes that failed to show a significant level of recovery following H include synaptojanin, ampiphysin, caveolin that play a central role in synaptic vesicle endocytosis (Fig. 6). In a mature synapse, endocytosis is coupled to the exocytotic machinery (Linial and Parnas 1996). It is possible that H did not restore the activity of the endocytotic apparatus, because it matures at a later age than that at which our experiments were performed. Indeed, endocytotic proteins were shown to be expressed long after the biogenesis of the synaptic vesicles and following their accumulation in the synapse (Grabs et al. 2000). We will investigate this possibility by testing the level of gene expression of this machinery at a later stage of development (12 weeks).

Similar to other studies (Weaver et al. 2006), whole hippocampus was used to monitor changes in gene expression, enabling us to detect genes, proteins and processes that are differentially expressed as a result of prenatal stress and H. We expect to gain additional information by performing the analysis in discrete hippocampal regions (Lein et al. 2004). To our knowledge, there is only one other report of the effect of prenatal stress on gene expression that was performed on RNA from the prefrontal cortex of adult males. Its aim was to determine whether there were any similarities in the molecular changes that were found in PS rats to those seen in schizophrenic and bipolar patients (Kinnunen et al. 2003). In spite of the differences in experimental design, gender of the animals, their age and the brain area from those in the current study, some notable similarities were seen among the genes that showed a decreased expression as a result of prenatal stress. These include complexin 2, BDNF, synapsin and ionotropic NMDA 2A receptor. In contrast to those reported (Kinnunen et al. 2003), we did not detect a significant change in the expression of genes that make up the post-synaptic density.

In conclusion, our study shows that prenatal stress occurring during a critical period of foetal development alters the expression of a well-defined set of hippocampal genes in association with permanent changes in behaviour. Using the procedure of neonatal H, we were able to focus on a defined set of genes, the expression of which was restored to control levels in association with normalization of behaviour. The genes and proteins identified in this way play an important role in regulating the rate of pre-synaptic maturation. It remains to be determined whether the changes induced by prenatal stress in gene expression and behaviour result from exposure of the foetal brain to excess levels of maternal stress hormones and/or changes in maternal attention during the early postnatal period.

Acknowledgements

We thank Yaniv Bledi for helpful suggestions. Analysis of the Affymetrix data was performed at the Genomic Sequencing Centre at the Hebrew University. Y.B awarded a fellowship from SCCB, the Sudarsky Centre for Computational Biology, The Hebrew University of Jerusalem.

Ancillary