SEARCH

SEARCH BY CITATION

Keywords:

  • Affymetrix array;
  • apoptosis;
  • dorsal raphe;
  • estrogen;
  • progesterone;
  • serotonin

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We sought the effect of estradiol (E) and progesterone (P) on survival gene expression in laser captured serotonin neurons and in the dorsal raphe region of monkeys with cDNA array analysis. Spayed rhesus macaques were treated with either placebo, E or E + P via Silastic implant for 1 month prior to killing. First, RNA from a small block of midbrain containing the dorsal raphe was hybridized to Rhesus Gene Chips (n = 3/treatment). There was a significant change in 854 probe sets with E ± P treatment (anova, p < 0.05); however, only 151 probes sets exhibited a twofold or greater change. Twenty-five genes related to cell survival changed significantly. The expression of vascular endothelial growth factor, superoxide dismutase (SOD1), and the caspase inhibitor, BIRC4, was confirmed with quantitative RT-PCR. Then, RNA from laser captured serotonin neurons (n = 2/treatment) was hybridized to Rhesus Gene Chips. There was a significant change in 744 probe sets, but 10 493 probe sets exhibited a twofold or greater change. Pivotal changes in apoptosis and cell cycle pathways included twofold or greater increases in SOD1, IκBα, Fas apoptotic inhibitory molecule, fibroblast growth factor-receptor 2 (FGFR2), neurotrophic tyrosine kinase receptor 2 (NTRK2), phosphoinositide-3-kinase (p85 subunit), cyclic AMP dependent protein kinase (PKA) (catalytic subunit), calpain 2, and ataxia telangectasia mutated (ATM). Twofold or greater decreases occurred in TNF receptor interacting serine-threonine kinase 1 (RIP1), BH3 interacting domain death agonist (BID), apoptotic peptidase activating factor 1 (Apaf1), caspase recruitment domain 8 (CARD8), apoptosis inducing factor (AIF), Diablo and Cyclins A, B, D, and E. The regulation of SOD1, calpain 2, Diablo, and Cyclin D was confirmed with quantitative RT-PCR (n = 3/treatment). The data indicate that ovarian steroids target the cytokine-signaling pathway, caspase-dependent and -independent pathways and cell cycle proteins to promote serotonin neuron survival.

Abbreviations used
AIF

apoptosis inducing factor

Apaf1

apoptotic peptidase activating factor 1

ATM

ataxia telangectasia mutated

BAD

bcl-1 antagonist of cell death

BID

BH3 interacting domain death agonist

CARD

caspase recruitment domain

CXCL12

chemokine ligand 12

E

estadiol

FGF-R2

fibroblast growth factor-receptor 2

GAPDH

glyceraldehyde 3 phosphate dehydrogenase

HT

hormone therapy

IAPs

inhibitor of apoptosis proteins

JNK1

c-jun n-terminal kinase

MAP2K5

MAPK kinase 5

NGF

nerve growth factor

NTRK2

neurotrophic tyrosine kinase receptor 2

OVX

ovariectomized

P

progesterone

PAK

p21-activated kinase

PBS

phosphate-buffered saline

PDCD4

programmed cell death 4

PKA

cyclic AMP dependent protein kinase

PTGFR

prostaglandin F receptor

qRT-PCR

quantitative RT-PCR

RAS GRF

Ras protein-specific quanine nucleotide-releasing factor 1

RIP1

TNF receptor interacting serine-threonine kinase 1

SOD1

superoxide dismutase

TNF

tumor necrosis factor

TPH

tryptophan hydroxylase

SNK

Student Newman Keul's

VEGF

vascular endothelial growth factor

The serotonin system modulates a wide range of neural outcomes from emotion to intellect to metabolism and it is a target of pharmacotherapies, steroid hormones, cytokines, neuropeptides, and trophic factors, all of which impact the generation and efficacy of serotonin neurotransmission. Thus, any loss or degeneration of serotonin neurons could have profound ramification.

This laboratory has devoted effort toward understanding the actions of ovarian hormones in serotonin neurons and their terminal fields with a macaque model of surgical menopause. Serotonin neurons express estrogen receptor beta and progestin receptors (Bethea 1993; Gundlah et al. 2001). We found that estradiol (E) ± progesterone (P) supplementation, regulates the expression of pivotal serotonin-related genes and proteins in the monkey dorsal raphe in a pattern suggestive of increased serotonin production, increased serotonin turnover, increased neural firing, and decreased degradation (Bethea et al. 2002; Lu and Bethea 2002; Lu et al. 2003).

In another paradigm, we observed that stress-sensitive cynomolgus monkeys have fewer serotonin neurons than stress-resilient companions. Moreover, the lower serotonin cell number was strongly correlated to lower levels of E and P during their menstrual cycles. The stress-sensitive macaques also had overall lower expression of serotonin-related genes than stress-resilient counterparts reflecting the serotonin cell number (Bethea et al. 2005). These correlations raised the question of whether E and P could be neuroprotective for serotonin neurons.

This issue may be extremely important for menopausal women grappling with issues surrounding hormone therapy (HT). Women experience premature ovarian failure and loss of ovarian steroid production around 50 years of age. Thus, with extended lifespans, a woman may live 35–40 years without ovarian steroids. If serotonin neurons are gradually dying because of lack of steroid supported gene expression, then geriatric depression, anxiety, fretfulness, decreased coping skills, and increased vulnerability to stress can be predicted outcomes.

In a preliminary study, we probed the Human Affymetrix Gene Chip with RNA extracted from a small block of tissue containing the dorsal and median raphe nuclei (Reddy and Bethea 2005). This study indicated that several genes involved in neurotoxicity or programmed cell death (PDCD) (apoptosis) were regulated by E ± P. One very important pro-apoptosis gene, JNK1 (c-jun n-terminal kinase or MAPK8), was markedly decreased by HT. Subsequently, a rhesus macaque Affymetrix Gene Chip and better software for global analysis were marketed. In addition, the technology to microdissect individual neurons became available.

Therefore, in this study, we sought novel genes related to neuronal survival that are regulated by E and P in laser captured serotonin neurons of rhesus monkeys using the Rhesus Affymetrix cDNA array and quantitative (q) RT-PCR. We also probed the rhesus array with the RNA from the dorsal raphe block for comparative purposes. We found that E and P altered the expression of genes in the cytokine signaling pathway, in caspase-dependent and -independent pathways and in the cell cycle, which could have a significant impact on serotonin neuron survival. Moreover, seven pivotal gene changes predicted by the microarray were confirmed by qRT-PCR.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The Oregon National Primate Research Center Institutional Animal Care and Use Committee approved this study.

Animals and treatments

Eighteen adult female rhesus monkeys (Macaca mulatta) were ovariectomized (OVX) by the surgical personnel of Oregon National Primate Research Center between 3 and 6 months before assignment to this project according to accepted veterinary surgical protocol. All animals were born in China, were aged between 7 and 14 years by dental exam, weighed between 4 and 8 kg, and were in good health.

Animals were either treated with placebo (OVX-control group;n = 6), or treated with E for 28 days (E group; n = 6), or treated with E for 28 days and then supplemented with progesterone (P) for the final 14 of the 28 days (E + P group; n = 6). The placebo treatment of the spay-control monkeys consisted of implantation with empty Silastic capsules (s.c.). The E-treated monkeys were implanted (s.c.) with two 4.5-cm E-filled Silastic capsules (i.d. 0.132 in.; o.d. 0.183 in.; Dow Corning, Midland, MI, USA). The capsule was filled with crystalline E [1,3,5(10)-estratrien-3,17-b-diol; Steraloids, Wilton, NH, USA]. The E + P-treated group received E-filled capsules, and 14 days later, received one 6-cm capsule filled with crystalline P (4-pregnen-3,20 dione; Steraloids). All capsules were placed in the periscapular area under ketamine anesthesia (ketamine HCl, 10 mg/kg, s.c.; Fort Dodge Laboratories, Fort Dodge, IA, USA).

The monkeys were killed at the end of the treatment periods according to procedures recommended by the Panel on Euthanasia of the American Veterinary Association. Each animal was sedated with ketamine, given an overdose of pentobarbital (25 mg/kg, i.v.), and exsanguinated by severance of the descending aorta.

Hormone assays

Assays for E and P were performed utilizing a Roche Diagnostics (Basel, Switzerland) 2010 Elecsys assay instrument. Prior to these analyses, measurements of E and P on this platform were compared with traditional radioimmunoassays (RIA’s) as previously reported (Bethea et al. 2005). The E + P treatment regimen has been shown to cause differentiation of the uterine endometrium in a manner similar to the normal 28-day menstrual cycle (Brenner and Slayden 1994).

Tissue preparation for block dissection (n = 9; 3 animals/treatment group)

The left ventricle of the heart was cannulated and the head of each animal was perfused with 3 L of 1× cold RNA-later buffer (Ambion Inc., Austin, TX, USA). The brain was removed from the cranium and blocked. The dissected midbrain block displayed the rounded central canal on its anterior surface and the wing-shaped canal on its caudal surface. This section was microdissected and a small square piece of tissue was harvested which extended from the middle of the central gray to the decussation of the cerebellar peduncles. We call this small piece the dorsal raphe nucleus block (DNR block). The piece was the width of the central gray and contained the major portion of the dorsal raphe (approximately 5 mm wide, 6 mm high, and 3 mm thick). The dorsal raphe block was immediately frozen in liquid nitrogen. For RNA extraction, the frozen block was dropped directly into TriReagent (Sigma, St. Louis, MO, USA).

Tissue preparation for laser capture dissection (n = 9; 3 animals/treatment group)

The left ventricle of the heart was cannulated and the head of each animal was perfused with 3 L of 1× cold RNA-later buffer (Ambion Inc.) plus 20% sucrose. The brain was removed from the cranium, dissected into blocks and frozen at −80°C. The pontine midbrain block was placed in a cryostat (Global Medical Instrumentation Microm HM500, Ramsey, MN, USA) and brought to −20°C. Thin sections (7 μm) through the dorsal raphe nucleus were thaw mounted onto plain glass slides and frozen at −80°C. The next morning, the sections were processed in a rapid, Rnase-free immunohistochemical assay for tryptophan hydroxylase (TPH). The sections were immersed in cold acetone for 1 min, cold ethanol for 30 s, cold phosphate-buffered saline (PBS) for 3 min, and then covered with normal rabbit serum (1/500) containing 1% Rnase inhibitor for 10 min. The normal rabbit serum was blotted and the sections were covered with sheep anti-TPH (1/300; Chemicon, Temecula, CA, USA) containing 1% Rnase inhibitor for 30 min, then immersion washed in PBS for 3 min, and covered with biotinylated rabbit anti-sheep serum (1/120; Vector Laboratories, Burlingame, CA, USA) containing 1% Rnase inhibitor for 20 min. The sections were then immersed in PBS for 3 min, covered with Vector ABC reagent for 30 min, immersed in cold 0.2 M Tris (pH 8.2), immersed in cold diaminobenzidine containing H2O2 (30% solution diluted 1/5000) and dehydrated in 100% ethanol for 2 min. Finally, the slides were immersed in xylene for 2 min and then dried under vacuum for 1 h prior to laser capture. Serotonin neurons appeared darkly stained and were captured with an Arcturus Laser Dissection Microscope (PixCell II, Molecular Devices, Sunnyvale, CA, USA). After capture to the microcap film (Capsure macro-211, Molecular Devices), the films were removed from the caps and immersed in lysis buffer. Up to 10 films with 1000–3000 pulses each were collected into one microtube containing 200 μL of lysis buffer. Approximately 150 000 laser pulses were conducted for a pool (12–15 microtubes were pooled).

RNA extraction from tissue blocks

RNA was obtained from the microdissected block of nine rhesus midbrains containing the dorsal raphe nucleus using TriReagent and further cleaned with a Qiagen RNAeasy column (Velencia, CA, USA). The quality of the RNA from the Qiagen column was examined on an Agilent Bioanalyzer and found acceptable and of equal quality.

RNA extraction from laser-captured neurons

Two pools were prepared from two placebo, two E-treated and two E + P-treated animals. One of the pools was used for hybridization to the microarray and one pool was set aside for qRT-PCR. An additional pool was prepared from another placebo, E-treated and E + P-treated animal for qRT-PCR. Thus, two animals per group were used for hybridization and three animals per group were used to confirm gene changes with qRT-PCR.

The tubes containing the lysis buffer and films were vortexed to dislodge the captured material from the films. Each tube was adjusted to 350 μL of lysis buffer and then 350 μL of 70% ethanol was added and mixed well. The samples were extracted with the RNAeasy microRNA kit from Qiagen according to the directions. The final eluates were pooled and evaporated in a Speedvac. The RNA was suspended in 12 μL of TE (0.01 M Tris + 0.005 M EDTA). The quantity of RNA in the resuspended sample was determined with the Ribogreen Quantitation Kit (Molecular Probes, Eugene, OR, USA) or with a Nanodrop Spectrophotometer (ND 1000 V3.3, Wilmington, DE, USA). The integrity of the RNA was examined with the Agilent Bioanalyzer using the pico-chip according to the directions of the manufacturer.

Affymetrix hybridization

Labeled target cRNA was prepared from nine raphe blocks (n = 3 animals/treatment group) and six pools of laser-captured serotonin neurons (n = 2 animals/treatment group). The cRNA was hybridized to Rhesus Affymetrix GeneChip arrays. Microarray assays were performed in the Affymetrix Microarray Core of the OHSU Gene Microarray Shared Resource.

Data analysis with GeneSifter software

The data was processed with Affymetrix GCOS interface software and compressed into CHP files and uploaded to GeneSifter (VisX Labs, Seattle, WA, USA). The software calculated the mean signal intensity and the SEM for each treatment group. Probe sets that were undetectable in all treatment groups were eliminated. The remaining probe sets were examined in two ways: (i) an analysis of variance was performed and the probe sets exhibiting a significant difference between treatment groups were subjected to Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis; and (ii) the probe sets were filtered and those probes sets exhibiting a twofold or greater change between the treatment groups were subjected to KEGG analysis. The use of a twofold filter was chosen based upon a survey of other microarray studies. Probe sets with robust signal intensities that showed a consistent change with E and E + P (both decreased or both increased) and probe sets that were consistent across multiple representations on the chip were reported.

Quantitative RT-PCR

The RNA from the microdissected block of nine rhesus midbrains containing the dorsal raphe nucleus was subjected to qRT-PCR for three genes of greatest interest which were: vascular endothelial growth factor (VEGF), superoxide dismutase (SOD1), and BIRC4 (XIAP, an endogenous caspase inhibitor). Another laser capture pool was made from the six animals used for the microarrays, plus an additional three animals, yielding nine laser capture pools (n = 3 animals/treatment group) for qRT-PCR confirmation of four pivotal genes which were: SOD1, calpain (CAPN2), Diablo, and Cyclin D (CCND1). In addition, the relative expression of TPH2 was compared in the DRN block and in the laser-captured pools to increase confidence in the captured material. Glyceraldehyde 3 phosphate dehydrogenase (GAPDH) was used as the reference gene, as the array hybridization data indicated that this gene was not regulated (data not shown).

Complementary DNA synthesis was performed using Oligo-dT 15 primer and random hexamers (Invitrogen Life Technologies, Carlsbad, CA, USA) and Superscript III reverse transcriptase (200 U/μg of RNA; Invitrogen Life Technologies) at 50°C for 1 h. Then, Rnase H (1 μL, 37°C, 15 min) was added to remove RNA templates. A pool of RNAs from different rhesus tissues was used as the standard.

Quantitative RT-PCR was conducted with Platinum SYBR Green qPCR Super Mix UDG (Invitrogen Life Technologies). This mix contains a modified Platinum DNA Taq Polymerase, uracil DNA glycosylase (UDG) and Sybr green I fluorescent dye, which is specific for double-stranded DNA. There is a linear increase in fluorescence detected as the concentration of amplified double-stranded product cDNA increases during the reaction. The fluorescence was detected with the ABI 7900 thermal cycler during 40 cycles. The reaction (final volume 20 μL) contained dilutions from 1 to 1000 pg of cDNA, 100 nM of forward and reverse primers and 1× Invitrogen PCR mix. The amount of cDNA added to the reaction mix was measured as sscDNA with the Nanodrop Spectrophotometer and from the amount of RNA used for reverse transcriptase. A standard curve was generated for all of the primer sets. The slope of the standard curve was used to calculate the relative pg of each transcript in the RNA extracted from the raphe blocks and laser-captured pools. Then, the ratio of each transcript to GAPDH was calculated.

Primer selection

For our genes of interest, the probe set ID was saved as a .txt file. This file was launched to batch query at Affymetrix Netaffix program on the web. This program enabled retrieval of the annotation list of the genes of interest and provides direct access to Genebank sequence at National Center for Biotechnology Information (NCBI). Thus, using Netaffix, the oligonucleotide location on each cDNA sequence was identified. Based upon the oligoset distribution, a target area of each gene of interest was selected. The target sequence was then loaded into Primer Express software, which chooses the primers for optimum qRT-PCR. The primers were obtained from Invitrogen Life Technologies. The primers utilized for qRT-PCR on the RNA extracted from the DRN block are shown in Table 1. The primers utilized for qRT-PCR on the RNA extracted from the laser-captured serotonin neurons are shown in Table 2.

Table 1.   Primer sets utilized for qRT-PCR on RNA extracted from DRN blocks
DRN block primers
Gene IDAccession IDNamePrimersTm (°C)Amplicon size
SOD1NM_000454Rhesus superoxide dismutase 1Primer F AGGGCACCATCAATTTCGAG (47–66 bp)59202
Primer R CCAACATGCCTCTCTCTTCATCC (248–228 bp)58 
VEGFXM_001089925Vascular endothelial growth factorPrimer_F ATCACCATGCAGATTATGCGG (1732–1752 bp)59208
Primer_R GCGAGTCTGTGTTTTTGCAGG (1939–1919 bp)60 
BIRC4XM_001086574Rhesus baculoviral IAP repeat containing 4Primer_F TCCAAAATCCTATGGTACAAGAAGCTATA (464–492 bp)60208
Primer_R GCTCTTCAGTACTAATCTCTTTCTGTAATGA (670–640 bp)58 
GAPDHXR_013566Glyceraldehyde-3-phosphate dehydrogenaselnt_F CTGACACTGAGTACGTCGTGGA (348–369 bp)57267
lnt_R TGGACTGTGGTCATGAGTCCTT (615–594 bp)58 
Table 2.   Primer sets utilized for qRT-PCR on RNA extracted from laser-captured serotonin neurons
Laser-capture primers
Gene IDAccession IDNamePrimersTm (°C)Amplicon size
SODlNM_000454Rhesus superoxide dismutase 1Int_F GAAGGCCTGCATGGATTCC (121–139 bp)59207
Int_R TCCTGAGAGCGAGATCACAGAA (327–360 bp)58 
CAPN2XM_001098172Rhesus CALPAIN2 large subnitInt_F GGCGGTGGAATGACAACTG (1275–1293 bp)57251
Int_R TCGGGTAGTTCCTGCAGCC (1526–1508 bp)59 
DIABLOXM_001097400Second mitochondrial apoptosis complex (Smac/Diablo)Int_F GAGGGCGGTGTCTTTGGTAA (275–294 bp)59251
Int_R GTCATCCAAGTGGTTTCCAGC (526–506 bp)59 
CCND1XM_001101029Cyclin DlInt_F GCTGGCCATGAACTACCTGG (464–483 bp)59267
Int_R GTTCGATGAAATCGTGCGG (714–696 bp)59 
TPH2AY_098914Tryptophan hydroxylase 2Int_F CTGACACTGAGTACGTCGTGGA (306–326 bp)58253
Int_R TCCCAGTGACAGGAAGAG (558–538 bp)59 
GAPDHXR_013566Glyceraldehyde-3-phosphate dehydrogenaseInt_F CTGACACTGAGTACGTCGTGGA (348–369 bp)57268
Int_R TGGACTGTGGTCATGAGTCCTT (615–594 bp)58 

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Expression increases in the DRN block

Hormone therapy changed the expression of a number of pivotal genes in the DRN block of tissue that play a role in cell survival. Figure 1 illustrates the pathways and the genes that were significantly altered as determined by anova (p < 0.05). Genes illustrated in red print were increased and genes illustrated in blue print were decreased. Genes illustrated in green boxes were previously confirmed by qRT-PCR on this RNA preparation (Reddy and Bethea 2005). HT induced a significant increase in SOD1, in several genes in the classical MAPK pathway such as VEGF, fibroblast growth factor-receptor 2 (FGF-R2), nerve growth factor (NGF) receptor associated protein, Ras protein-specific quanine nucleotide-releasing factor 1 (RAS GRF), and MAPK kinase 5 (MAP2K5). HT also increased the expression of three genes that code for endogenous caspase inhibitors called BIRC4 (also known as XIAP), MCL-1 and bifunctional apoptosis regulator (BFAR), and increased the expression of two ubiquinases. E2F1 was previously found to increase (Reddy and Bethea 2005).

image

Figure 1.  Diagrammatic representation of hormone therapy (HT)-induced changes in gene expression in the DRN block. Genes that exhibited a significant increase (p < 0.05, anova) are shown in red and genes that exhibited a significant decrease (p < 0.05, anova) are shown in blue. Green blocks outline gene changes that were previously confirmed with qRT-PCR. Other information is shown in black. Arrows indicate downstream drive or activation, whereas t-bars indicate downstream blockade. Significant increases in expression were observed in vascular endothelial growth factor (VEGF), fibroblast growth factor-receptor 2 (FGF-R2), nerve growth factor (NGF) receptor-associated protein, Ras protein-specific quanine nucleotide-releasing factor 1 (RAS GRF), MAPK kinase 5 (MAP2K5), superoxide dismutase (SOD1), and in two ubiquinases (UCHL1 and UBCH7). Also, gene expression significantly increased for three proteins called baculovirus inhibitor of apoptosis proteins (IAP) repeat containing four (BIRC4 or XIAP), BCL2-related protein (MCL-1), and bifunctional apoptosis regulator (BFAR) that are capable of inhibiting caspases. Significant decreases in expression were observed in members of the cytokine signaling pathway including chemokine ligand 12 (CXCL12), TGF-β receptor 3 (TGFβ3), tumor necrosis factor α-induced protein (TNFAIP6), member 21 of the TNF superfamily (TNFRSF21), the prostaglandin F receptor (PTGFR), and Fas-associated factor 1 (FAF1). Significant decreases were also observed in downstream effectors of cell death including p21-activated kinase 2 (PAK), MAPK kinase 4 (MAP2K4), and nibrin (NBSI). The pro-apoptosis gene programmed cell death 4 (PDCD4) was significantly decreased as well. With qRT-PCR we previously found that expression of kynurenin mono-oxygenase (KMO), which produces neurotoxic metabolites of serotonin, and c-jun n-terminal kinase (JNK), which is an apoptosis effector, were significantly decreased in this mRNA preparation (green outline). We also previously found that E2F1 was significantly increased in this mRNA preparation (green outline).

Download figure to PowerPoint

Expression decreases in the DRN block

Hormone therapy decreased the expression of a number of pivotal genes in the stress-related cytokine-signaling pathway. The expression of chemokine ligand 12 (CXCL12), transforming growth factor (TGF)-β receptor 3 (TGFβ3), tumor necrosis factor α-induced protein (TNFAIP6), member 21 of the TNF superfamily (TNFRSF21), the prostaglandin F receptor (PTGFR), and Fas-associated factor 1 were significantly decreased. Intermediaries p21-activated kinase (PAK) and MAP2K4 which code for proteins that can activate JNK1 were decreased, and we previously found that JNK1 was decreased by HT as well (Reddy and Bethea 2005). The expression of nibrin and PDCD4 were also significantly decreased.

Examples and validation of expression changes in the DRN block

Different genes were chosen for illustration of the changes in signal intensity observed on the microarray and for confirmation of the microarray results with qRT-PCR. The HT-induced increase in signal intensity on the microarray of MAP2K5 and MCL-1 is illustrated in Fig. 2. The HT-induced decrease in signal intensity on the microarray of CXCL12, PTGFR, PAK2, and PDCD4 is illustrated in Fig. 3. The increase in SOD1, VEGF, and BIRC4 observed on the microarray was confirmed with qRT-PCR (Fig. 4).

image

Figure 2.  Histograms illustrating the signal intensity of MAPK kinase 5 (MAP2K5) and MCL-1 on the microarrays probed with mRNA extracted from the DRN block (three animals : chips/treatment). There was a significant difference between the groups for both genes (anova,p < 0.05). Post hoc comparisons indicated that there was a significant increase in MAP2K5 with E + P treatment and significant increases in MCL-1 with E and E + P treatment (SNK, p < 0.05). The asterisks denote that the group was significantly different from the OVX control group at p < 0.05, Student-Newman-Keuls posthoc pairwise comparison.

Download figure to PowerPoint

image

Figure 3.  Histograms illustrating the signal intensity of chemokine ligand 12 (CXCL12), PTCFR, PAK2, and programmed cell death 4 (PDCD4) on the microarrays probed with mRNA extracted from the DRN block (three animals : chips/treatment). There was a significant difference between the groups for all four genes (anova,p < 0.05). Post hoc comparisons indicated that there was a significant decrease in CXCL12 with E and E + P treatment and a significant decrease in prostaglandin F receptor (PTGFR), PAK2, and PDCD4 with E + P treatment (SNK, p < 0.05). The asterisks denote that the group was significantly different from the OVX control group at p < 0.05, Student-Newman-Keuls posthoc pairwise comparison.

Download figure to PowerPoint

image

Figure 4.  Histograms illustrating the relative expression of superoxide dismutase (SOD1), vascular endothelial growth factor (VEGF), and BIRC4 in the DRN block as determined with qRT-PCR (n = 3 animals/treatment). There was a significant difference between treatment groups for each gene (p < 0.05, anova). Post hoc pairwise comparison indicated that SOD1 and VEGF were significantly higher in the E + P group than the OVX control group, and that BIRC4 was significantly higher in the E and E + P groups than in the OVX control groups (SNK, p < 0.05). These changes in expression confirm the expression as reported by the microarray. The asterisks denote that the group was significantly different from the OVX control group at p < 0.05, Student-Newman-Keuls posthoc pairwise comparison.

Download figure to PowerPoint

Comparison of DRN block to laser-captured serotonin neurons

To validate the laser-capture pools, the relative expression of TPH2 was examined in the laser capture pools versus the DRN blocks. TPH2 is the rate-limiting enzyme for serotonin synthesis in the brain. There was a significant enrichment of TPH2/GAPDH in the laser capture pools compared with the DRN blocks. TPH2/GAPDH was significantly increased by E and E + P treatment in the laser capture pools [anova,p < 0.02; Student Newman Keul's (SNK), p < 0.05] and in the DRN block (anova, p < 0.01; SNK, p < 0.05). Figure 5 contains histograms of the relative expression in the laser capture pools (top) and of the relative expression in the DRN blocks (bottom) plotted on the same axis scales to illustrate the enrichment of TPH2 relative to GAPDH in the laser capture pools. The insert contains the relative expression of TPH2 in the DRN block on a smaller scale to better illustrate the regulation by E and E + P.

image

Figure 5.  Histograms illustrating the relative expression of TPH2 in the DRN block compared with laser-captured serotonin neurons (n = 3 animals/treatment). There was an enrichment of TPH2 relative to glyceraldehyde 3 phosphate dehydrogenase (GAPDH) in the laser-capture pools (top) compared with the DRN blocks (bottom) illustrated by plotting the data on the same scale. The insert illustrates the relative expression of TPH2 in the DRN block on a smaller x-axis scale. There was a significant difference between the treatment groups in the laser capture pools (anova,p < 0.02) and in the DRN blocks (anova,p < 0.01). Asterisks indicate a significant difference from the OVX control group as determined by post hoc pairwise comparison (SNK, p < 0.05). The asterisks denote that the group was significantly different from the OVX control group at p < 0.05, Student-Newman-Keuls posthoc pairwise comparison.

Download figure to PowerPoint

Although the HT-induced changes in gene expression detected in the DRN blocks were significant by anova, the absolute changes in signal intensity were not robust. Using the KEGG analysis provided by GeneSifter, we compared the number of probe sets that changed twofold or greater with HT in the DRN blocks versus the laser-captured serotonin neurons and the results are illustrated in Fig. 6. Only 151 probe sets changed twofold or greater in the DRN blocks whereas 10 493 probe sets changed twofold or greater in the laser-captured serotonin neurons. In the laser-captured serotonin neurons, HT altered 24 out of 70 probe sets in tryptophan metabolism twofold or greater, whereas no changes were detected in this pathway in the DRN block. This further indicates that the laser-captured pools were enriched in serotonin neurons. There was a marked increase in robust HT regulation of genes in the laser-captured serotonin neurons in all of the intracellular signaling pathways, in pathways that control plasticity such as axon guidance and adhesion, as well as apoptosis and cell cycle pathways. To further our hypothesis of neuroprotection, we examined the apoptosis and cell cycle pathways in the laser-captured serotonin neurons.

image

Figure 6.  Diagrammatic illustration of different pathways and cellular functions exhibiting hormone therapy (HT)-induced changes in gene expression using the rhesus monkey Affymetrix microarray. Represented in orange are the probe sets that changed with HT in the DRN blocks (twofold or greater compared with OVX placebo control, n = 3/treatment) and represented in green are the probe sets that changed with HT in laser-captured serotonin neurons (twofold or greater compared with OVX placebo control, n = 2/treatment). The numerator represents the number of probe sets that changed, and the denominator represents the number of probe sets on the array that are involved in the pathway or function. The percent of changed probe sets is shown in parentheses. Because there may be several different probe sets for the same gene on the microarray, it is important to note that these numbers represent probe sets and not genes. However, there is a marked increase in the number of probe sets that changed in the laser-captured neurons compared to the DRN block. This suggests that in the block of tissue, gene changes in one cell population may be masked by dilution with other cell populations.

Download figure to PowerPoint

Expression changes related to neuroprotection in laser-captured serotonin neurons

Hormone therapy induced twofold or greater changes in several pivotal genes in the caspase dependent and independent pathways, as well as other survival genes in the laser captured serotonin neurons (Fig. 7). SOD1, Fas apoptotic inhibitory molecule (FAIM), IκBα, FGF-R2, neurotrophic tyrosine kinase receptor 2 (NTRK2), phosphoinositide-3-kinase p85, cyclic AMP dependent protein kinase (PKA) catalytic subunit, and calpain were increased twofold or greater. Pivotal genes exhibiting a twofold or greater decrease in expression with HT included BH3 interacting domain death agonist (BID), TNF receptor interacting serine-threonine kinase 1 (RIP1), apoptotic peptidase activating factor 1 (Apaf1), caspase recruitment domain (CARD) 8, apoptosis inducing factor (AIF), and Diablo. As illustrated in Fig. 8, HT-induced twofold or greater decreases in Cyclins A, B, D, and E. In addition, HT increased the expression of ataxia telangectasia mutated (ATM), which encodes a pivotal checkpoint protein.

image

Figure 7.  Diagrammatic illustration of the hormone therapy (HT)-induced gene changes related to apoptosis in laser-captured serotonin neurons (twofold or greater compared with OVX placebo control, n = 2 animals/treatment). Genes that exhibited a twofold or greater increase are shown in red and genes that exhibited a twofold or greater decrease are shown in blue. Other information is shown in black. Arrows indicate downstream drive or activation, whereas t-bars indicate downstream blockade. Genes were filtered that showed a similar pattern with E and E + P treatment. Superoxide dismutase (SOD1) and fibroblast growth factor-receptor 2 (FGF-R2) increased in serotonin neurons in the same fashion as in the DRN block. In the caspase-dependent pathway, RIP1, BID, Apaf1, Diablo, and caspase recruitment domain (CARD) 8 were decreased. The expression of procaspase 3 increased but this may not translate to active protein. In the caspase-independent pathway, apoptosis inducing factor (AIF) was decreased. There was a marked increase in IκBα, which binds NFκB in the cytoplasm. Other survival-related genes that increased include neurotrophic tyrosine kinase receptor 2 (NTRK2), phosphoinositide-3-kinase (PI3K) (85 KDa subunit), PKA (catalytic subunit) and calpain.

Download figure to PowerPoint

image

Figure 8.  Diagrammatic illustration of the hormone therapy (HT)-induced changes in cell cycle regulatory genes in laser-captured serotonin neurons. Genes that exhibited a twofold or greater increase are shown in red and genes that exhibited a twofold or greater decrease are shown in blue. Other information is shown in black. Arrows indicate downstream drive or activation, whereas t-bars indicate downstream blockade. Genes were filtered that showed a similar pattern with E and E + P treatment. There was a twofold or greater decrease in gene expression for Cyclins A, B, D, and E. However, there was a twofold increase in gene expression for the checkpoint protein, ATM. Altogether, these changes would prevent serotonin neurons from re-entering the cell cycle which leads to catastrophic apoptosis in terminally differentiated neurons.

Download figure to PowerPoint

Examples and validation of expression changes in laser-captured serotonin neurons

Different genes were chosen for illustration of the changes in signal intensity observed on the microarray and for confirmation of the microarray results with qRT-PCR. The HT-induced increase in signal intensity on the microarray of ATM, IκBα, NTRK2, and FGF-R2 is illustrated in Fig. 9. The HT-induced decrease in signal intensity on the microarray of Apaf1 and AIF is illustrated in Fig. 10. The expression of SOD1, calpain, Diablo, and Cyclin D were confirmed in laser-capture pools from three animals in each treatment group with qRT-PCR (Fig. 11). SOD1 and calpain expression were significantly increased by HT, whereas Diablo and Cyclin D were significantly decreased by HT as found on the microarray.

image

Figure 9.  Histograms illustrating the signal intensity of ATM, IκBα, neurotrophic tyrosine kinase receptor 2 (NTRK2), and fibroblast growth factor-receptor 2 (FGF-R2) on the microarrays probed with mRNA extracted from laser-captured serotonin neurons (two animals : chips/treatment). Statistical tests were not performed with n = 2. Rather, genes exhibiting a twofold or greater change between the groups were selected. There is a robust increase in gene expression in these four genes with E treatment compared with the OVX control group. The E + P treated group has greater variance, but the expression of each gene was generally higher than the OVX group.

Download figure to PowerPoint

image

Figure 10.  Histograms illustrating the signal intensity of Apaf1 and apoptosis inducing factor (AIF) on the microarrays probed with mRNA extracted from laser-captured serotonin neurons (two animals : chips/treatment). Statistical tests were not performed with n = 2. Rather, genes exhibiting a twofold or greater change between the groups were selected. There is a robust suppression of gene expression in these two genes E + P treatment compared with the OVX control group.

Download figure to PowerPoint

image

Figure 11.  Histograms illustrating the relative expression of superoxide dismutase (SOD1), calpain (CAPN2), Diablo, and Cyclin D (CCND1) in laser-captured serotonin neurons (n = 3 animals/treatment) as determined with qRT-PCR. There was a significant difference between the groups for all four genes. There was a significant increase in SOD1 and calpain with E and E + P treatment (post hoc comparison, SNK p < 0.05). There was a significant decrease in Cyclin D with E and E + P treatment and a significant decrease in Diablo with E + P treatment (post hoc comparison, SNK p < 0.05). These changes in expression confirm the expression as reported by the microarray. The asterisks denote that the group was significantly different from the OVX control group at p < 0.05, Student-Newman-Keuls posthoc pairwise comparison.

Download figure to PowerPoint

The magnitude of the expression changes was greater when determined by qRT-PCR when compared with the microarray. For the three genes examined in the DRN block, the average fold change reported by the microarray versus qRT-PCR equaled 1.78 and 16.7, respectively. For the four genes examined in the laser-captured serotonin neurons, the average fold change reported by the microarray versus qRT-PCR equaled 2.07 and 9.9, respectively.

Steroid hormone verification

The concentration of E and P in a serum sample obtained from each animal at necropsy was obtained to verify the efficacy of the Silastic implants. The concentration of E in the serum of the E and E + P-treated animals was 136.5 ± 15 pg/mL and the concentration of P in the serum of the E + P-treated animals was 8.17 ± 1.15 ng/mL. The concentrations of E and P in the serum of the untreated spayed control animals were 11.0 ± 0.1 pg/mL and 0.16 ± 0.13 ng/mL, respectively (significantly different from treated animals by anova, p < 0.01).

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

In animal models, HT provides numerous beneficial effects on CNS function and viability. However, human trials have yielded mixed results which lately seem to be due to the age at which HT is initiated (Espeland et al. 2004; Rossouw et al. 2007). In our model of surgical menopause in adult monkeys, HT has positive effects on serotonin function (Bethea et al. 2002). In this model, HT is administered for 1 month so the effects may be mediated by genomic or non-genomic mechanisms. Now, we show that HT changes gene expression related to survival in serotonin neurons.

In this study, we included gene expression changes effected by E or E + P. Some genes showed similar inductions with the treatments while others exhibited a change with E + P and not E alone. In the laser-captured material, there was more variance in the E + P-treated group than in the E-treated group. It is of significant interest to re-examine the Affymetrix data sets and filter for differences between E and E + P to gain a better understanding of the potentially unique actions of P.

Expression increases in the DRN block

In the raphe block, HT induced a significant increase in SOD1. This critical enzyme scavages free oxygen radicals (reactive oxygen species) and thus, plays an important role in cell survival (Davis et al. 2007). HT induced a significant increase in several genes in the MAPK pathway such as VEGF, FGF-R2, NGF receptor-associated protein, RAS GRF, and MAP2K5. The proteins encoded by RAS GRF and MAP2K5 lead to activation of ERK and ERK5 which transcribe genes essential to cell survival (Almeida et al. 2005; Wu et al. 2005; Toborek et al. 2007) whereas VEGF has a newly recognized neuroprotective role (Gora-Kupilas and Josko 2005). The encoded FGF-R2 protein and the NGF receptor-associated protein are involved in signal transduction of their respective trophic factors and hence would be pro-survival. HT also increased the expression of three genes that code for endogenous caspase inhibitors called BIRC4 (also known as XIAP), MCL-1, and bifunctional apoptosis regulator (BFAR). This effect would decrease caspase activation and apoptosis along the caspase-dependent pathway (Nishihara et al. 2003). HT also increased the expression of two ubiquinases that shuttle α-synuclein and PARK 2 to the proteosome (Shimura et al. 2001), and this action could protect neurons from neurodegeneration associated with the accumulation of these proteins. E2F1 was previously found to increase (Reddy and Bethea 2005) and this action may block the activity of p53, which can initiate catastrophic entry into the cell cycle. Although E2F1 has been implicated in apoptosis (Hou et al. 2000), the integrity of the E2F1/Rb complex is neuroprotective in the presence of free oxygen radicals (Chong et al. 2006).

Expression decreases in the DRN block

Furthermore in the raphe block, HT decreased the expression of a number of pivotal genes in the stress-related, cytokine-signaling pathway. The expression of CXCL12, transforming growth factor (TGF)-β receptor 3 (TGFβ3), TNF α-induced protein (TNFAIP6), member 21 of the TNF superfamily (TNFRSF21), and the PTGFR were significantly decreased. Fas-associated factor 1 (FAF1) decreased significantly and the protein encoded by this gene binds to Fas antigen and can initiate apoptosis or enhance apoptosis initiated through Fas antigen. Intermediaries PAK and MAP2K4 which code for proteins that can activate JNK1 were also decreased. We previously found that HT decreased JNK1 expression as well (Reddy and Bethea 2005). JNK1 is a pivotal protein that can initiate a cascade leading to mitochondrial permeability and the release of either cytochrome c or AIF, leading to either caspase-dependent or -independent cell death. Thus, HT decreases gene expression in an intercellular signaling pathway that mediates various kinds of stresses.

The nibrin (NBS1) gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. Thus, a decrease in nibrin may indicate inhibition of the cell cycle, which is neuroprotective for neurons (Marcelain et al. 2005). PDCD4 encodes a protein localized to the nucleus in proliferating cells and the expression of this gene is modulated by cytokines. The gene product is thought to play a role in apoptosis, but the specific role has not yet been determined (Yang et al. 2001).

It is likely that the gene changes observed in the block of tissue are global changes that occur in many cell types, which is an important data set. Although the changes were deemed significant by anova, we noticed that the absolute differences in signal intensity between the groups were not robust, suggesting that masking of differences may occur when multiple cell types are examined. When we compared the number of probe sets that changed twofold or greater in the raphe block with the laser captured neurons, there was a marked enrichment of probe sets that changed twofold or greater with HT in the laser-captured serotonin neurons. This highlights our perception that HT regulates gene expression in serotonin neurons, but detection of the changes may be obscured in a block of tissue that contains other cell types.

It is curious that TPH2 expression in the laser-captured neurons was similar with E and E + P whereas it was decreased with E + P relative to E alone in the DRN block although both treatment groups were significantly elevated compared with the OVX group. In an earlier analysis of TPH2 with in situ hybridization, there was no difference between the inductions by E or E + P which is consistent with the laser-capture data (Sanchez et al. 2005). Thus, the difference in TPH2 induction in the DRN block may be due to some unknown variance in the progestin responsiveness of this group of monkeys.

Expression changes in apoptosis pathways in laser-captured serotonin neurons

To further our hypothesis that HT protects serotonin neurons from cell death, we focused on twofold or greater expression changes in apoptosis and cell cycle pathways in the laser-captured neurons. As in the raphe block, SOD1 and FGF-R2 increased in the laser-captured serotonin neurons. This suggests that the effect of HT on SOD1 and FGF-R2 may be global effects. The likely decrease in reactive oxygen species that would ensue from elevated SOD1 protein and the increase in FGF-R2 signaling may be an important part of HT-induced neuroprotection. In the caspase-dependent pathway, HT decreased RIP1, BID, Apaf1, and CARD8. The BID gene encodes a death agonist that heterodimerizes with bcl-2. The encoded protein is a member of the bcl-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase 8; caspase 8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it blocks bcl-2 and triggers cytochrome c release. Thus, decreasing expression of BID would promote cell survival. RIP1 encodes a TNF receptor (TNFRSF)-interacting serine–threonine kinase 1. It is an adaptor protein in the TNF signaling pathway that leads to apoptosis. Hence, a decrease in RIP1 would render the cell less susceptible to TNF signaling. Apaf1, or apoptotic peptidase activating factor 1, encodes a cytoplasmic protein that initiates apoptosis. Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves procaspase 9, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Therefore, the HT-induced decrease in Apaf1 in serotonin neurons is a pivotal means to decrease activity of the caspase-dependent apoptosis pathway. HT also decreased CARD8. CARD-containing proteins, such as CARD8, are involved in pathways leading to activation of caspases or nuclear factor kappa-B in the context of apoptosis or inflammation, respectively (Bouchier-Hayes et al. 2001). It is curious that we observed an increase in gene expression for procaspase 3. However, there appear to be mechanisms in place that would prevent its activation. Further work is underway to determine which of these changes in gene expression are manifested at the protein level and to determine active and inactive states of each protein.

Hormone therapy decreased an extremely pivotal gene in the caspase-independent pathway. Apoptosis inhibitory factor (AIF), also called PDCD8, was decreased fourfold with E + P treatment. The AIF gene encodes a flavoprotein essential for nuclear disassembly in apoptotic cells that is found in the mitochondrial intermembrane space in healthy cells. Induction of apoptosis results in the translocation of this protein to the nucleus where it effects chromosome condensation and fragmentation. In addition, this gene product induces mitochondria to release the apoptogenic proteins cytochrome c and caspase 9 so it also ties into the caspase-dependent pathway. Nonetheless, in certain cell lines, AIF is sufficient to induce apoptosis when the caspases are inhibited (Krantic et al. 2007). In preliminary western blots on subcellular fractions of raphe blocks, we find that the level of AIF in the mitochondria is decreased, and the amount of AIF translocated to the nucleus is significantly decreased in E + P-treated monkeys. This supports the notion that HT also acts through the caspase-independent pathway.

Expression changes in cytokine signaling in laser-captured serotonin neurons

Smac/Diablo is a second mitochondria-derived activator of caspases. Expression of Diablo was decreased threefold on the microarray and fivefold in the qRT-PCR assay with E + P treatment. Diablo encodes a protein that blocks the endogenous caspase inhibitor of apoptosis proteins (IAPs) (Verhagen et al. 2000) and it plays a pivotal role in the mediation of apoptosis through TRAIL and the TNF pathway (Deng et al. 2002). HT increased several IAP genes in the raphe blocks and Diablo would normally inhibit these IAPs, thereby removing a brake on the caspase-dependent pathway. A decrease in Diablo would allow activity of the IAPs. Moreover, we also observed a marked decrease in genes in the TNF/cytokine signaling pathway in the raphe block suggesting that HT may converge on multiple effectors of this pathway as a major mechanism of neuroprotection.

Hormone therapy induced a robust 23-fold increase in IκBα gene expression in serotonin neurons. The encoded protein binds to NFκB and prevents nuclear translocation and activation of stress-related genes, which can lead to apoptosis depending on the cell context (Post et al. 2000; Liang et al. 2007), although in some paradigms, NFkB has neuroprotective actions (Dhandapani et al. 2005). We previously demonstrated that NFκB colocalizes in serotonin neurons and that HT decreased the nuclear location of NFκB, but there was no change in the expression of NFκB at gene or protein levels (Bethea et al. 2006). The microarray data suggests an important mechanism by which HT reduced the translocation of NFκB to the nucleus. It is also worth noting that the 5HT1A autoreceptor gene contains NFκB response elements in the promoter and that HT decreases expression of the 5HT1A gene in the dorsal raphe. It follows that the HT-induced increase in IκBα and subsequent decrease in NFκB translocation may be mediating the effect of HT on 5HT1A gene expression.

Expression changes in intracellular signaling pathways in laser-captured serotonin neurons

Hormone therapy also increased several survival factors in serotonin neurons that are upstream of mitochondrial permeability. The expression of NTRK2 increased robustly with E treatment. This gene encodes a kinase that upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Mutations in the gene have been associated with obesity and mood disorders (Adams et al. 2005; Gray et al. 2007). The expression of the gene coding the 85 kDa regulatory subunit of phosphoinositide-3-kinase increased twofold. This protein activates AKT, which in turn, phosphorylates and inactivates bcl-2 antagonist of cell death (BAD) (Datta et al. 1999). BAD is a member of the bcl-2 family that opens mitochondrial pores by binding to bcl-2, thereby releasing cytochrome c (Zhu et al. 2006; Koh 2007). HT also increased the gene expression of the catalytic subunit of PKA (cAMP-dependent protein kinase). PKA also inhibits the activity of BAD, which would decrease mitochondrial permeability and the release of pro-apoptotic proteins. Previous work showed that E prevented BAD phosphorylation in a model of ischemic neuronal death (Won et al. 2005). Of note, HT caused a robust threefold increase in calpain 2. This is interesting because until recently the calpains were considered pro-apoptotic. However, new data suggests that they may be neuroprotective and prevent signaling through the TNF pathway (Lu et al. 2002; Tan et al. 2006). Thus, the ability of HT to block TNF signaling by decreasing gene expression in the intracellular signaling cascade and by increasing calpain further suggests that this is a pivotal site of action for HT-induced neuroprotection.

Expression changes in cell cycle genes in laser-captured serotonin neurons

Hormone therapy decreased gene expression of four of the cyclins, which play essential roles in the progression of the cell cycle. The most pivotal of the cyclins, Cyclin D, decreased twofold on the microarray and nearly 10-fold in the qRT-PCR assay with E and E + P treatment. Cyclin D is essential for cells to re-enter the cell cycle and re-entry into the cell cycle is catastrophic for terminally differentiated cells, like serotonin neurons (Herrup et al. 2004). Therefore in neurons, cell cycle proteins are considered pro-apoptotic (Becker and Bonni 2004, 2005). In addition, the gene encoding the pivotal protein ATM was increased twofold in serotonin neurons. This protein is an important cell cycle checkpoint kinase that functions as a regulator of a wide variety of downstream proteins (Evan and Littlewood 1998). Activation of ATM plays a central role in shutting down cell cycle transitions through a series of effector molecules at each checkpoint (Lavin and Kozlov 2007). Altogether, these data suggest that another mechanism by which HT is neuroprotective is by preventing re-entry of serotonin neurons into the cell cycle.

Although the majority of expression changes support the hypothesis that ovarian hormones act to enhance survival, there were two minor inconsistencies. Cytochrome c was represented by three probe sets, which reported different changes so this was considered unreliable. The pro-apoptotic Bax gene was undetectable in the OVX and E + P-treated groups but it was detectable in the E-treated group, which was reported as an increase in expression. However, the marginal signal intensity did not engender confidence.

Summary

Upon review, it appears that HT is neuroprotective of serotonin neurons and probably other neurons in the midbrain by several major mechanisms. HT induces a decrease in gene expression in the TNF/cytokine signaling pathway and in Smac/Diablo, a mediator of apoptosis by this pathway, and it increases calpain which blocks TNF signaling; HT induces a decrease in expression of genes that encode pivotal proteins in the caspase-dependent and -independent pathways; HT increases gene expression of pivotal survival factors; and HT alters gene expression governing cell cycle initiation and progression. Thus, HT provides trophic support and inhibits the expression of genes that increase vulnerability to cytokines and stress in serotonin neurons and the surrounding neuropile. Further study of gene expression in other intracellular signaling pathways is underway.

It is important to recognize that our model does not include a gross insult to the CNS such as ischemia or neurotoxic lesion. The changes observed in gene expression occurred in 1 month in otherwise normal animals in paired housing with environmental enrichment. Extrapolating from this data is straightforward. In the long-term absence of ovarian steroids, serotonin neurons would be less resilient and may die with normal life stress. However, it is necessary to demonstrate that the changes observed in gene expression are manifested at the protein level, and that the proteins are active. Essential to validation of the hypothesis will be demonstration that ovariectomized primates have fewer serotonin neurons than ovarian intact controls. Juvenile macaques, with ovariectomy or fallopian tube ligation, are currently maturing in a semi-free ranging troop in an outdoor corral for the answer to this question.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We are deeply grateful to the dedicated staff of the Division of Animal Resources including the staff of the Departments of Surgery and Pathology for their expertise and helpfulness in all aspects of monkey management. The staff of the OHSU Gene Microarray Shared Resource was essential for this study. This study was supported by NIH grants MH62677 to CLB, U54 contraceptive Center Grant HD 18185, and RR00163 for the operation of ONPRC.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • Adams J. H., Wigg K. G., King N. et al. (2005) Association study of neurotrophic tyrosine kinase receptor type 2 (NTRK2) and childhood-onset mood disorders. Am. J. Med. Genet. B Neuropsychiatr. Genet. 132, 9095.
  • Almeida R. D., Manadas B. J., Melo C. V., Gomes J. R., Mendes C. S., Graos M. M., Carvalho R. F., Carvalho A. P. and Duarte C. B. (2005) Neuroprotection by BDNF against glutamate-induced apoptotic cell death is mediated by ERK and PI3-kinase pathways. Cell Death Differ. 12, 13291343.
  • Becker E. B. and Bonni A. (2004) Cell cycle regulation of neuronal apoptosis in development and disease. Prog. Neurobiol. 72, 125.
  • Becker E. B. and Bonni A. (2005) Beyond proliferation – cell cycle control of neuronal survival and differentiation in the developing mammalian brain. Semin. Cell Dev. Biol. 16, 439448.
  • Bethea C. L. (1993) Colocalization of progestin receptors with serotonin in raphe neurons of macaque. Neuroendocrinology 57, 16.
  • Bethea C. L., Lu N. Z., Gundlah C. and Streicher J. M. (2002) Diverse actions of ovarian steroids in the serotonin neural system. Front. Neuroendocrinol. 23, 41100.
  • Bethea C. L., Streicher J. M., Mirkes S. J., Sanchez R. L., Reddy A. P. and Cameron J. L. (2005) Serotonin-related gene expression in female monkeys with individual sensitivity to stress. Neuroscience 132, 151166.
  • Bethea C. L., Reddy A. P. and Smith L. J. (2006) Nuclear factor kappa B in the dorsal raphe of macaques: an anatomical link for steroids, cytokines and serotonin. J. Psychiatry Neurosci. 31, 105114.
  • Bouchier-Hayes L., Conroy H., Egan H., Adrain C., Creagh E. M., MacFarlane M. and Martin S. J. (2001) CARDINAL, a novel caspase recruitment domain protein, is an inhibitor of multiple NF-kappa B activation pathways. J. Biol. Chem. 276, 4406944077.
  • Brenner R. M. and Slayden O. D. (1994) Cyclic changes in the primate oviduct and endometrium, in The Physiology of Reproduction, 2nd edn (KnobilE. and NeillJ. D., eds), pp. 541569. Raven Press, Ltd, New York.
  • Chong Z. Z., Li F. and Maiese K. (2006) Attempted cell cycle induction in post-mitotic neurons occurs in early and late apoptotic programs through Rb, E2F1, and caspase 3. Curr. Neurovasc. Res. 3, 2539.
  • Datta S. R., Brunet A. and Greenberg M. E. (1999) Cellular survival: a play in three Akts. Genes Dev. 13, 29052927.
  • Davis A. S., Zhao H., Sun G. H., Sapolsky R. M. and Steinberg G. K. (2007) Gene therapy using SOD1 protects striatal neurons from experimental stroke. Neurosci. Lett. 411, 3236.
  • Deng Y., Lin Y. and Wu X. (2002) TRAIL-induced apoptosis requires Bax-dependent mitochondrial release of Smac/Diablo. Genes Dev. 16, 3345.
  • Dhandapani K. M., Wade F. M., Wakade C., Mahesh V. B. and Brann D. W. (2005) Neuroprotection by stem cell factor in rat cortical neurons involves AKT and NFkappaB. J. Neurochem. 95, 919.
  • Espeland M. A., Rapp S. R., Shumaker S. A. et al. (2004) Conjugated equine estrogens and global cognitive function in postmenopausal women: Women’s Health Initiative Memory Study. JAMA 291, 29592968.
  • Evan G. and Littlewood T. (1998) A matter of life and cell death. Science 281, 13171322.
  • Gora-Kupilas K. and Josko J. (2005) The neuroprotective function of vascular endothelial growth factor (VEGF). Folia Neuropathol. 43, 3139.
  • Gray J., Yeo G., Hung C., Keogh J., Clayton P., Banerjee K., McAulay A., O’Rahilly S. and Farooqi I. S. (2007) Functional characterization of human NTRK2 mutations identified in patients with severe early-onset obesity. Int. J. Obes. (Lond.) 31, 359364.
  • Gundlah C., Lu N. Z., Mirkes S. J. and Bethea C. L. (2001) Estrogen receptor beta (ERb) mRNA and protein in serotonin neurons of macaques. Mol. Brain Res. 91, 1422.
  • Herrup K., Neve R., Ackerman S. L. and Copani A. (2004) Divide and die: cell cycle events as triggers of nerve cell death. J. Neurosci. 24, 92329239.
  • Hou S. T., Callaghan D., Fournier M. C. et al. (2000) The transcription factor E2F1 modulates apoptosis of neurons. J. Neurochem. 75, 91100.
  • Koh P. O. (2007) Estradiol prevents the injury-induced decrease of 90 ribosomal S6 kinase (p90RSK) and Bad phosphorylation. Neurosci. Lett. 412, 6872.
  • Krantic S., Mechawar N., Reix S. and Quirion R. (2007) Apoptosis-inducing factor: a matter of neuron life and death. Prog. Neurobiol. 81, 179196.
  • Lavin M. F. and Kozlov S. (2007) ATM activation and DNA damage response. Cell Cycle 6, 931942.
  • Liang Z. Q., Wang X., Li L. Y., Wang Y., Chen R. W., Chuang D. M., Chase T. N. and Qin Z. H. (2007) Nuclear factor-kappaB-dependent cyclin D1 induction and DNA replication associated with N-methyl-D-aspartate receptor-mediated apoptosis in rat striatum. J. Neurosci. Res. 85, 12951309.
  • Lu N. Z. and Bethea C. L. (2002) Ovarian steroid regulation of 5HT1A receptor binding and G protein activation in female monkeys. Neuropsychopharmacology 27, 1224.
  • Lu T., Xu Y., Mericle M. T. and Mellgren R. L. (2002) Participation of the conventional calpains in apoptosis. Biochim. Biophys. Acta 1590, 1626.
  • Lu N. Z., Eshleman A. J., Janowsky A. and Bethea C. L. (2003) Ovarian steroid regulation of serotonin reuptake transporter (SERT) binding, distribution and function in female macaques. Mol. Psychiatry 8, 353360.
  • Marcelain K., De La Torre C., Gonzalez P. and Pincheira J. (2005) Roles of nibrin and AtM/ATR kinases on the G2 checkpoint under endogenous or radio-induced DNA damage. Biol. Res. 38, 179185.
  • Nishihara H., Kizaka-Kondoh S., Insel P. A. and Eckmann L. (2003) Inhibition of apoptosis in normal and transformed intestinal epithelial cells by cAMP through induction of inhibitor of apoptosis protein (IAP)-2. Proc. Natl Acad. Sci. USA 100, 89218926.
  • Post A., Crochemore C., Uhr M., Holsboer F. and Behl C. (2000) Differential induction of NF-kappaB activity and neural cell death by antidepressants in vitro. Eur. J. Neurosci. 12, 43314337.
  • Reddy A. P. and Bethea C. L. (2005) Preliminary array analysis reveals novel genes regulated by ovarian steroids in the monkey raphe region. Psychopharmacology (Berl.) 180, 125140.
  • Rossouw J. E., Prentice R. L., Manson J. E., Wu L., Barad D., Barnabei V. M., Ko M., LaCroix A. Z., Margolis K. L. and Stefanick M. L. (2007) Postmenopausal hormone therapy and risk of cardiovascular disease by age and years since menopause. JAMA 297, 14651477.
  • Sanchez R. L., Reddy A. P., Centeno M. L., Henderson J. A. and Bethea C. L. (2005) A second tryptophan hydroxylase isoform, TPH-2 mRNA, is increased by ovarian steroids in the raphe region of macaques. Brain Res. Mol. Brain Res. 135, 194203.
  • Shimura H., Schlossmacher M. G., Hattori N., Frosch M. P., Trockenbacher A., Schneider R., Mizuno Y., Kosik K. S. and Selkoe D. J. (2001) Ubiquitination of a new form of alpha-synuclein by parkin from human brain: implications for Parkinson’s disease. Science 293, 263269.
  • Tan Y., Wu C., De Veyra T. and Greer P. A. (2006) Ubiquitous calpains promote both apoptosis and survival signals in response to different cell death stimuli. J. Biol. Chem. 281, 1768917698.
  • Toborek M., Son K. W., Pudelko A., King-Pospisil K., Wylegala E. and Malecki A. (2007) ERK 1/2 signaling pathway is involved in nicotine-mediated neuroprotection in spinal cord neurons. J. Cell. Biochem. 100, 279292.
  • Verhagen A. M., Ekert P. G., Pakusch M., Silke J., Connolly L. M., Reid G. E., Moritz R. L., Simpson R. J. and Vaux D. L. (2000) Identification of Diablo, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102, 4353.
  • Won C. K., Ha S. J., Noh H. S., Kang S. S., Cho G. J., Choi W. S. and Koh P. O. (2005) Estradiol prevents the injury-induced decrease of Akt activation and Bad phosphorylation. Neurosci. Lett. 387, 115119.
  • Wu T. W., Wang J. M., Chen S. and Brinton R. D. (2005) 17Beta-estradiol induced Ca2+ influx via L-type calcium channels activates the Src/ERK/cyclic-AMP response element binding protein signal pathway and BCL-2 expression in rat hippocampal neurons: a potential initiation mechanism for estrogen-induced neuroprotection. Neuroscience 135, 5972.
  • Yang H. S., Jansen A. P., Nair R., Shibahara K., Verma A. K., Cmarik J. L. and Colburn N. H. (2001) A novel transformation suppressor, PDCD4, inhibits AP-1 transactivation but not NF-kappaB or ODC transactivation. Oncogene 20, 669676.
  • Zhu Z. H., Yang R., Fu X., Wang Y. Q. and Wu G. C. (2006) Astrocyte-conditioned medium protecting hippocampal neurons in primary cultures against corticosterone-induced damages via PI3-K/Akt signal pathway. Brain Res. 1114, 110.