SEARCH

SEARCH BY CITATION

Keywords:

  • cell osmoadaptation;
  • cell osmoregulation;
  • cell volume regulation;
  • hypernatremia;
  • hyperosmolarity;
  • osmoprotection

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References

In brain osmoprotective genes known to be involved in cellular osmoadaptation to hypertonicity, as well as the related transcription factor tonicity-responsive enhancer binding protein (TonEBP) are only expressed in some cell subsets. In the search for other genes possibly involved in osmoadaptation of brain cells we have analyzed, through microarray, the transcriptional profile of forebrain from rats subjected to 45 min, 90 min, and 6 h systemic hypertonicity. Microarray data were validated by quantitative real-time PCR. Around 23 000 genes gave a reliable hybridization signal. The number of genes showing a higher expression increased from around 15 (45 min) up to nearly 200 (6 h). Among about 30 immediate early genes (IEGs) encoding transcription factors, only Atf3, Verge, and Klf4 showed a rapid increased expression. TonEBP-mRNA tissue level and TonEBP-mRNA labeling in neurons remained unchanged whereas TonEBP labeling was rapidly increased in neurons. Sodium-dependent neutral amino acid transporter-2 (SNAT2) encoded by gene Slc38a2 showed a delayed increased expression. The rapid tonicity-induced activation of Atf3, Verge, and Klf4 may regulate genes involved in osmoadaptation. Nfat5 encoding TonEBP is not an IEG and the early tonicity-induced expression of TonEBP in neurons may result from translational activation. Increased expression of sodium-dependent neutral amino-acid transporter 2 may lead to the cellular accumulation of amino acids for adaptation to hypertonicity.

Abbreviations used
AE

Cl/HCO3 anion exchanger

AR

aldose reductase

ATF

activating transcription factor

CYR61

cysteine-rich protein 61

DUSP

dual specificity phosphatase

F

fold change

GADD

growth arrest and DNA damage-inducible protein

HSP

heat-shock protein

IEG

immediate early gene

IkappaB

NF-Kappa B inhibitor

ISH

in situ hybridization

KLF

Krüppel-like factor

NF

nuclear factor

NHE

Na+/H+ exchanger

NFAT

nuclear factor of activated T-cells

NKCC

Na+, K+, 2 Cl transporter

OD

optical density

qRT-PCR

quantitative real-time PCR

SMIT

sodium-myo-inositol transporter

SNAT

sodium-dependent neutral amino acid transporter

TauT

taurine transporter

TonEBP

tonicity enhancer-binding protein

Verge

vascular early response gene

Numerous studies, mostly on renal cells that are exposed in physiological conditions to a fluctuating extracellular tonicity, have revealed various mechanisms that allow cellular osmoadaptation by counteracting the effects resulting from osmotic stress (Lang et al. 1998; Wehner et al. 2003). Hypertonicity causes water to leave cells by osmosis until a new equilibrium is reached between intra- and extracellular compartments. As a result of this water efflux, cell volume decreases and intracellular ionic strength increases. These alterations perturb cell function by affecting the rates of biochemical reactions, the stability and conformation of macromolecules, as well as the transmembrane ionic gradients. As a first step in osmoadaptation, cell shrinkage activates Na+, K+, 2 Cl transporters (NKCC), Na+/H+ exchangers (NHE), and Cl/HCO3 anion exchangers (AE), which permit intracellular accumulation of inorganic ions (Na+, K+, and Cl) and a subsequent osmosis-driven water influx that restores cell volume (Hoffmann and Dunham 1995; O’Neill 1999). Intracellular ionic strength is then lowered by the accumulation of so-called compatible organic osmolytes (e.g. sorbitol, myo-inositol, taurine, betaine, and amino acids) that relies upon the osmo-induced transcription of so-called osmoprotective genes that encode the biosynthetic enzyme (aldose reductase; AR) or the transporters (e.g. sodium-myo-inositol transporter; SMIT) of organic osmolytes (Burg et al. 1997; Waldegger and Lang 1998; Handler and Kwon 2001; Ferraris and Burg 2006). The transcription of osmoprotective genes is thought to be primarily under the control of a transcription factor called tonicity enhancer-binding protein (TonEBP), a member of the NFAT family encoded by gene Nfat5, that acts as an osmo-inducible transactivator (Woo et al. 2002). Hypertonicity also activates the expression of heat-shock proteins (HSPs), which, as molecular chaperones, counteract destabilization and unfolding of proteins (Beck et al. 2000). Finally, high hypertonicity induces DNA breaks (Kultz and Chakravarty 2001) and up-regulates proteins known to respond to genotoxic stresses such as p53 (Dmitrieva et al. 2000), as well as p53-regulated growth arrest and DNA damage-inducible proteins (GADDs) (Kultz et al. 1998; Chakravarty et al. 2002).

Brain interstitial and cerebro-spinal fluids are in osmotic equilibrium with blood plasma. While blood plasma osmolality is maintained in a very narrow range under normal physiological conditions, there exist pathological states that lead to hypertonic blood plasma and neurological disorders (Adrogue and Madias 2000; Verbalis 2003; Lin et al. 2005). Neurological disorders result from osmosis-driven water movement from brain fluids to blood plasma and subsequently from brain cell intracellular medium to interstitial fluid through the cell membrane. Cell shrinkage results in alterations in brain cell functions and spatial interrelationships, which are at the origin of these neurological disorders. However, the severity of neurological disorders is greatly reduced when plasma hypertonicity develops gradually over a period of several days. This indicates that brain cells possess osmoprotective adaptive mechanisms that primarily allow them to recover their cell volume. This hypothesis is substantiated by experimental data in animals. Thus, the water content of brain tissue decreases following acute systemic hypertonicity but slowly returns to normal levels when systemic hypertonicity persists beyond several days (Ayus et al. 1996). Osmoadaptation of brain cells to hypertonicity involves the activation of osmoprotective genes. mRNA levels for several osmoprotective genes were reported to be increased in brains from animals subjected to systemic hypertonicity (Ibsen and Strange 1996;Minami et al. 1996; Bitoun and Tappaz 2000). Previously, we reported the tonicity-induced expression of TonEBP in brain that was however restricted to neurons following acute (Loyher et al. 2004) and prolonged (Maallem et al. 2006a) systemic hypertonicity. AR-mRNA expression was found to be tonicity-induced in some subsets of neurons, while SMIT-mRNA expression was found to be tonicity-induced in some subsets of non-neuronal cells (Maallem et al. 2006b). Moreover, large discrepancies were recorded in the cellular distribution of the tonicity-induced expression of TonEBP and two of its target genes, namely AR and SMIT (Maallem et al. 2006b). Depending on the cell subsets and the osmoprotective genes, TonEBP thus appeared insufficient or conversely unnecessary for the tonicity-induced activation of an osmoprotective gene. The available data so far clearly indicate that many pieces are still missing in the overall picture of the various mechanisms used by the different brain cells for osmoadaptation to hypertonicity. A first step in the identification of new genes possibly involved in this process is to look for the genes that are rapidly activated in brain tissue following systemic hypertonicity. In the present study, we have compared the transcriptional profile in forebrain from rats subjected to systemic hypertonicity of increasing duration (45 min, 90 min, and 6 h) versus sham-treated animals.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References

Animal treatment

The investigations were carried out on 300 g male Sprague–Dawley rats (Charles River, Lyon, France). Animal handling and treatment were carried out in accordance with the European Communities Council Directive (86/609/EEC). Under light halothane anesthesia, the rats received one intraperitoneal (i.p.) injection of 2 M sucrose solution in distilled water (3 mL/100 g body weight). The animals were kept water-deprived and killed by decapitation 45 min and 90 min after injection. Another group of rats received i.p. injections of 2 M sucrose solution (1.5 mL/100 g body weight) at t = 0 and t = 90 min. They were kept water-deprived and killed by decapitation at t = 6 h. Sham-treated animals received injections of isotonic saline. Five rats were used in each group. The brain was rapidly removed from the skull and cut between cerebrum and cerebellum. The forebrain was taken out and immediately frozen in liquid nitrogen and then kept at −80°C. Forebrain corresponded to whole brain minus olfactory bulbs, midbrain, pons, medulla oblongata, and cerebellum. A blood sample was collected for the determination of plasma osmolality in a freezing point depression microosmometer (Roebling, Berlin, Germany), calibrated using a standard 300 mOsm/kg sealed saline solution.

RNA extraction

Total RNA was extracted from forebrain using Trizol reagent (Invitrogen, Cergy Pontoise, France) according to the supplier’s protocol. The amount of RNA was determined from the optical density (OD) at 260 nm and its purity was ascertained from the OD ratio, OD 260 nm/280 nm (around 1.8). RNA integrity was checked by electrophoresis on 1.5% agarose gel and determining the ratio rRNA28S/18S (around 1.7). For microarray analysis, total RNA extracts from the five animals of the same group were pooled together while quantitative real-time PCR (qRT-PCR) analysis was performed on individual samples.

RNA amplification

Total RNA (1 μg) was amplified and biotin-labeled by a round of in vitro transcription with a Message Amp aRNA kit (Ambion, Austin, TX, USA) according to the manufacturer’s protocol. Before amplification, spikes of synthetic mRNA at different concentrations were added to all samples; these positive controls were used to ascertain the quality of the procedure. The aRNA yield was measured with an UV spectrophotometer and its quality ascertained on nanochips with the Agilent 2100 Bioanalyser (Agilent, Massy, France).

Array hybridization and processing

Ten micrograms of biotin-labeled aRNA was fragmented using 5 μL of fragmentation buffer in a final volume of 20 μL, then mixed with 240 μL of Amersham hybridization solution (GE Healthcare Europe GmbH, Freiburg, Germany) and injected onto CodeLink Uniset Rat Whole Genome bioarrays containing 36 000 rat oligonucleotide gene probes (both from GE Healthcare Europe GmbH). Arrays were hybridized overnight at 37°C under agitation in an incubator. The slides were washed in stringent TNT buffer (100 mM Tris, 150 mM NaCl, and 0.02% Tween 20) (all from Sigma-Aldrich, Saint Quentin-Favallier, France) at 46°C for 1 h and then a streptavidin-cy5 (GE Healthcare Europe GmbH) detection step was performed. Each slide was incubated for 30 min in 3.4 mL of streptavidin-cy5 solution, then washed four times in 240 mL of TNT buffer, rinsed twice in 240 mL of water containing 0.2% Triton X-100, and dried by centrifugation at 1800 g. The slides were scanned using a Genepix 4000B scanner (Axon, Union City, CA, USA) and Genepix software, with the laser set at 635 mm, the laser power at 100%, and the photomultiplier tube voltage at 60%. The scanned image files were analyzed using CodeLink expression software, version 4.0 (GE Healthcare Europe GmbH), which produces both raw and normalized hybridization signals for each spot on the array.

Microarray data analysis

The relative intensity of the raw hybridization signal on arrays varied in different experiments. CodeLink software was therefore used to normalize the raw hybridization signal on each array to the median of the array (median intensity is 1 after normalization) for better cross-array comparison. The threshold of detection was calculated using the normalized signal intensities of the 100 negative control samples in the array. Spots with signal intensities below this threshold are referred to as ‘absent.’ Quality of processing was evaluated by generating scatter plots of positive signal distribution. Signal intensities were then converted to log base 2 values. Comparison and filtering were performed using Genespring 7.0 software (Agilent).

Quantitative real-time PCR

Individual RNA samples (1 μg) were heated for 10 min at 70°C, immediately cooled in ice, and then incubated at 42°C for 1 h in 20 μL of 50 mM Tris–HCl, pH 8.3, buffer containing 75 mM KCl, 3 mM MgCl2, 2 mM of each dNTP, 1 μM oligo-dT primer (Invitrogen), 10 mM dithiothreitol, 2 U Rnase out (Invitrogen), and 20 U of Moloney murine leukemia virus reverse transcriptase (Invitrogen) for synthesis of cDNA. Negative controls were performed by replacing RT with water. qPCR was performed on a LightCycler instrument (Roche Diagnotics, Mannheim, Germany). Samples of RT products (2 and 0.2 μL) were diluted in glass capillaries to a volume of 20 μL with PCR mix (LightCycler Faststart DNA Master SYBR Green plus; Roche Diagnotics) containing 2 mM MgCl2 and 1 μM of forward and backward primers (Table 1). Following a 10 min denaturation at 95°C, 40 amplification cycles were performed. Each cycle included 10 s denaturation at 95°C, 10 s hybridization at 60°C, and 15 s elongation at 72°C. Fluorescence was measured on line after each amplification cycle. After full amplification, the temperature was slowly raised above melting temperature of the PCR product to establish the melting curve. Non-specific amplification products such as primer dimers could be readily distinguished by their lower melting points. The presence of a single PCR product of the expected size was systematically checked by electrophoresis after each amplification run. Negative controls without RT were also analyzed. The amount of PCR product corresponding to a given mRNA was determined from the crossing point values and was expressed relative to the amount of glyceraldehyde-3-phosphate dehydrogenase product used as a housekeeping gene for the same sample. Fold change values of mRNA levels represent the mean of five sucrose-injected rats divided by the mean of five sham-injected rats. Statistical comparisons were performed between hypertonic and corresponding sham animals using Student’s t-test.

Table 1.   Primers used for qRT-PCR
GenBankSymbolForward primerReverse primerRT-PCR product
PositionSize (bp)
  1. Primers were designed using MacVector software (MacVector Inc., Carry, NC, USA) from GenBank accession records.

NM_012912Atf3TCTGTCCCCGAGTGAACCGTGGGTCCACCCCACCTGTCAAGG87–1057186
M60921Btg2GTATGAGCCACGGGAAGAGAGATGCGGTAGGACACTTCGT63–403341
U22414Ccl3CTGTTACCTGCTCAGCACCACTCAAGCCCCTGCTCTACAC51–409359
NM_031327Cyr61CCTCTCCTGCCTTCCCCAGTGCCCCATCCCTCCCCGAAAG1742–1889148
X06769FosGAGGGAGCTGACAGATACGCATGATGCCGGAAACAAGAAG608–966359
M17701GapdhGAGGACCAGGTTGTCTCCTGGGATGGAATTGTGAGGGAGA856–1155301
Z27118Hspa1aGGTGAACTACAAGGGCGAGACGATCGTCAGGATGGACAC217–542326
D26307JundGACCCTCAAAAGCCAGAACACGTAGGACTGGGGGTACAGA992–1303312
NM_053713Klf4AACCTTTCACACTGTCTTCCCACGCCCTTGGACTCTTCCTTTCTCCTG1582–1702121
XM_001076581Nfat5CACCACCACCTGAGGACTTGCTGTTCACAATCTCGTCGTTTGACCCC929–1149220
X63594NfkbiaAAGGACGAGGATTACGAGCAGTCTCGGAGCTCAGGATCAC161–472312
X84004Dusp1TGGAGATCCTGTCCTTCCTGAATACTCCGCCTCTGCTTCA687–1045359
NM_181090Slc38a2TGGCGTAGTCGTGATGATTGGAAGGTCTGAGCGAGTTGAGTGGACCC1831–1974144
AY673969VergeGATGGGGAGTCCTGGAGAGAGAGACGGTTTTCTTTTTCAAGCCAAGTGC2339–2470142
NM_133290Zfp36AGAACCTCACCACCACCTCCAGGGCAGCAGAGAAGGCAGAAGGGG605–726122

Histological methods

TonEBP-mRNA labeling through in situ hybridization (ISH) was performed using a digoxigenin-labeled antisense riboprobe as described previously (Maallem et al. 2006a). TonEBP immunolabeling was performed through immunocytochemistry using an antiserum raised against the N-terminal 473 amino acids of TonEBP as previously described (Loyher et al. 2004).

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References

After i.p. injection of a hypertonic sucrose solution, plasma osmolality increased rapidly (Table 2). mRNA expression profiles of forebrain from sucrose- and sham-injected rats were established following 45 min, 90 min and 6 h of systemic hypertonicity. For each time point, five animals were used in each group. Forebrain RNA extracts from the same group were pooled together for microarray analysis and processed individually for qRT-PCR determination. Results are expressed as fold change ratio (F) of normalized hybridization signals for sucrose-injected to sham-injected controls. About 23 000 genes were expressed in forebrain extracts with a reliable hybridization signal. The number of genes whose expression levels increased at least twofold in forebrain of hypertonic animals grew rapidly with the duration of systemic hypertonicity from 14 at 45 min up to 191 at 6 h (Table 3). However, for the majority of these genes the increased expression showed a rather modest fold change (2 < F < 3). Similarly, the number of genes whose expression levels decreased by at least 50% increased rapidly with duration of hypertonicity from 12 at 45 min up to about 120 at 6 h (Table 3). On these microarrays about 1/3 of modified expression signals corresponded to identified genes. Instead of presenting the full list of genes whose expression levels were modified we have focused our attention on a few categories of genes, namely immediate early genes (IEGs) encoding transcription factors, p53 and cell death related genes, osmoadaptation-related genes, and miscellaneous genes whose expression levels increased markedly.

Table 2.   Plasma osmolality at the time of killing following i.p. injection of a hypertonic sucrose solution
 Sham-injectedSucrose-injected
  1. Sham-injected animals were injected with an isotonic saline solution. Values expressed in mOsm/kg are the mean ± SEM (n = 5). In normal non-injected animals, plasma osmolality was 316 ± 1 (n = 4). ***p < 0.001 by Student’s t-test.

45 min312 ± 2.2400 ± 5.1***
90 min314 ± 1.8422 ± 7.1***
6 h315 ± 1.9426 ± 7.3***
Table 3.   Number of genes showing an altered expression level following a systemic hypertonicity of increasing duration
 45 min90 min6 h
  1. Total number of genes whose mRNA levels showed a fold change value F either > 2 or < 0.5 in sucrose-injected rats when compared with sham-treated rats after 45 min, 90 min, and 6 h systemic hypertonicity. The number of expressed sequence tags (EST) corresponding to as yet unidentified genes is given in parenthesis. For genes showing an up-regulated expression, the numbers of genes are also given based on the range of F values.

Up-regulated
 Total (F > 2)14 (6)67 (33)191 (129)
 2 < F < 3 954143
 3 < F < 4 1 7 30
 F > 4 4 6 18
Down-regulated
 Total (F < 0.5)12 (7)30 (24)119 (87)

On these microarrays, about 30 IEGs encoding transcription factors gave reliable hybridization signals (Table 4). Of these, three, namely activating transcription factor 3 (Atf3), vascular early response gene (Verge) and Krüpel-like factor 4 (Klf4) showed rapidly increased expressions after only 45 min systemic hypertonicity. All increased levels of mRNA detected by microarrays were confirmed by qRT-PCR determination. Each showed a peculiar time course evolution of expression level (Fig. 1). Atf3 showed by far the highest increase in expression level from about sevenfold at 45 min up to 38-fold at 6 h. Verge expression increased to about the same level at 45 min but peaked more rapidly. Increased expression level of Klf4 was much more modest. Other members of the Atf or Klf families did not show any altered expression. The expression of several members of various IEG families that are known to be strongly and rapidly activated by different cellular stresses (Table 5) remained unchanged (Jun, Egr, and Ier families) or showed only a weak and delayed increase (Jund and Fos). For comparison, we also measured the mRNA levels of TonEBP, the transactivator of osmoprotective genes, as TonEBP increased in brain within 1 h of systemic hypertonicity (Loyher et al. 2004). TonEBP-mRNA relative levels, as determined by qRT-PCR, were not modified after up to 6 h systemic hypertonicity (Fig. 1). TonEBP-mRNA basal labeling through ISH using an antisense riboprobe that was observed in neurons such as the pyramidal and granule cells in hippocampus was not modified following systemic hypertonicity (Fig. 2), whereas no significant ISH labeling was seen using the sense riboprobe (not shown, see Maallem et al. 2006a). In contrast, TonEBP labeling though immunocytochemistry showed a strong increase that was already observed after 45 min systemic hypertonicity (Fig. 2) as previously reported (Loyher et al. 2004).

Table 4.   Expression of immediate early genes encoding transcription factors
GenBankSymbolName and other aliasesMicroarrayqRT-PCR
45 min90 min6 h45 min90 min6 h
  1. Results are expressed as fold change values of relative mRNA levels between sucrose-injected versus sham-injected animals for increasing durations of systemic hypertonicity. Microarray analysis was performed on pooled RNA from five animals. qRT-PCR analysis was performed on individual samples (mean ± SEM) (n = 5). **p < 0.01 and ***p < 0.001 by Student’s t-test.

BF390071Atf1Activating transcription factor 10.80.91.0   
NM_031018Atf2Activating transcription factor 20.91.21.3   
NM_012912Atf3Activating transcription factor 3; LRF-111.815.217.37.3 ± 0.3***27.2 ± 1.0***38 ± 5.8***
NM_024403Atf4Activating transcription factor 40.91.31.7   
NM_172336Atf5Activating transcription factor 51.01.30.9   
NM_134443Creb1cAMP responsive element binding protein 1; Creb1.311.2   
NM_013086CremcAMP responsive element modulator; Icer1.11.31.2   
NM_012551Egr1Early growth response 1; Krox24; NGF1-A; Zif2681.11.20.8   
NM_053633Egr2Early growth response 2; Krox20; NGF1-B; Zfp251.30.90.5   
NM_017086Egr3Early growth response 31.11.20.5   
NM_019137Egr4Early growth response 4; NGFI-C1.00.80.7   
AW915240.1Fosc-fos1.42.23.1 2.1 ± 1.05.7 ± 1.6**
NM_012953Fosl1Fos-like antigen 1; Fra-11.11.11.3   
BC061717Ier2Immediate early response 21.82.11.6   
BU759906Ier3Immediate early response 31.11.21.1   
BQ193418Ier5Immediate early response 51.00.80.8   
NM_021835JunJun oncogene1.11.41.6   
NM_021836JunbJun-B oncogene0.80.81.4   
BE096021JundJun D proto-oncogene1.12.63.6 1.5 ± 1.25.7 ± 0.7**
BF562149Klf3Krüppel-like factor 31.00.91.0   
NM_053713Klf4Krüppel-like factor 4 (gut); Gklf2.63.03.12.7 ± 0.1***3.2 ± 0.2**4.5 ± 0.6***
NM_053394Klf5Krüppel-like factor 51.00.91.2   
NM_057211Klf9Krüppel-like factor 91.01.11.1   
NM_031135Klf10Krüppel-like factor 100.90.80.7   
NM_053536Klf15Krüppel-like factor 151.01.21.2   
AW523915VergeVascular early response gene protein5.14.94.47.9 ± 0.3***12.9 ± 0.3***5.3 ± 0.2**
image

Figure 1.  Time course of evolution of ATF3-, VERGE-, KLF4-, and TonEBP-mRNA levels following systemic hypertonicity. Results are expressed as fold change values of mRNA levels between sucrose-injected versus sham-injected animals for increasing durations of systemic hypertonicity. Determinations were performed by qRT-PCR on individual samples (mean ± SEM) (n = 5). **p < 0.01 and ***p < 0.001 by Student’s t-test.

Download figure to PowerPoint

Table 5.   Comparative expression of immediate early genes encoding transcription factors in brain following different acute cellular stresses
GenesSystemic hypertonicityTransient ischemiaPermanent ischemiaHypoxiaSeizures
Lu et al. 2004Nagata et al. 2004Soriano et al. 2000 Tang et al. 2006Sandberg et al. 2000Flood et al. 2004 Regard et al. 2004
  1. Our present results are compared with those previously reported in the literature as indicated. The range of the fold change values F of the relative mRNA levels is as follows: −, F < 2; +, 2 < F < 5; ++, 5 < F < 10; +++, 10 < F < 20; ++++, F > 20.

Atf3++++ ++ 
Crem++   
Fos++++++++ ++++
Fos-B ++++  
Fra+   
Jun+++ ++
JunB+++++ +++
JunD+   
Egr1++++ ++
Egr2+  ++++
Egr4 +++  
Ier3  + 
Klf4+    
Verge+++   ++++
image

Figure 2.  Time course of evolution of TonEBP-mRNA labeling and TonEBP labeling in the hilus of the hippocampus dentate gyrus following systemic hypertonicity. TonEBP-mRNA labeling through ISH is not modified in the pyramidal cells of the polymorphic layer or in the granule cells with increasing durations of systemic hypertonicity. In these cells, TonEBP labeling through immunocytochemistry increases after 45 min systemic hypertonicity and reaches its maximal intensity after 90 min systemic hypertonicity. po, polymorphic layer; gl, granule cell layer. Scale bar: 50 μm.

Download figure to PowerPoint

In vitro cell death, possibly through p53-activated proapoptotic genes, was reported along with increased GADD expression, following exposure of renal cells to a strong hypertonic medium (see Discussion). On microarrays, about 25 cell death and DNA damage-related genes, which included several proapoptotic p53 target genes, gave reliable hybridization signals. None of these showed increased expression levels in forebrain of animals subjected to systemic hypertonicity (Table 6).

Table 6.   Expression of cell death and DNA damage-related genes
GenBankSymbolName and other aliasesMicroarray
45 min90 min6 h
  1. Results are expressed as fold change values of relative mRNA levels between sucrose-injected versus sham-injected animals for increasing durations of systemic hypertonicity. Microarray analysis was performed on pooled RNA from five animals.

NM_023979Apaf1Apoptotic protease activating factor 11.11.01.0
NM_053812Bak1BCL2-antagonist/killer 10.90.90.9
BC061728Badbcl2-associated death promoter; bcl-2 associated death agonist0.91.00.9
U32098BaxBcl2-associated X protein1.30.80.7
NM_173837Bbc3Bcl-2 binding component 3; Puma1.01.01.1
BI273775Bcl2l1Bcl2-like 1; Bcl-xl1.11.01.1
AY185098Bcl2l2Bcl2-like 2; BCL-w1.01.11.0
NM_053733Bcl2l10Bcl2-like 10; BCL2-like 10 (apoptosis facilitator)1.11.01.0
NM_022684BidBH3-interacting domain death agonist; Apoptotic death agonist; BID0.81.01.4
NM_057130Bid3BH3-interacting (with BCL2 family) domain, apoptosis agonist; Dp5; Hr1.20.90.9
NM_053704BikBcl2-interacting killer1.01.01.0
NM_053420Bnip3Bcl2/adenovirus E1B 19 kDa-interacting protein 3; Nip30.90.80.7
NM_080888Bnip3lBcl2/adenovirus E1B 19 kDa-interacting protein 3-like; Nix1.00.90.9
AI227742BokBcl-2-related ovarian killer protein1.00.81.1
NM_012922Casp3Caspase 3, apoptosis-related cysteine protease0.80.70.8
NM_031632Casp9Caspase 91.10.91.1
NM_024134Ddit3DNA-damage inducible transcript 3; ChoplO; Gaddl531.21.31.1
NM_080906Ddit4DNA-damage-inducible transcript 4; Rtp801; Dig20.91.31.4
NM_024127Gadd45aGrowth arrest and DNA-damage-inducible 45 alpha; Gadd45; Dditl0.90.91.0
B1292212Pdcd4Programmed cell death 4; death-upregulated gene; Dug0.90.81.6
NM_031356Pdcd8Programmed cell death 8; Aif0.80.91.2
AF192757Pdcd6ipProgrammed cell death 6 interacting protein; AIP1; Alix0.90.71.0
AW915661PerpPERP; Tp53 apoptosis effector0.91.11.0
NM_030989Tp53Tumor protein p530.91.11.1

Ion cotransporters and exchangers, organic osmolyte transporters and possibly HSPs are known to contribute to cell adaptation to hypertonicity (for references see introduction). mRNA levels of the various isoforms of NKCC, NHE, and AE did not show modified expression levels following systemic hypertonicity (Table 7). As for osmolyte transporters, mRNA levels of SMIT, taurine transporter (TauT), and form 2 of sodium-dependent neutral amino-acid transporter (SNAT2) increased about twofold (Table 7). Forms 1 and 3 of SNAT1 and SNAT3 showed no change in expression. Increased SNAT2-mRNA expression was confirmed by qRT-PCR (Table 7). HSP70-1 encoded by gene hspa1a, small HSPs, HSP27, and HSP25, encoded by genes hspb1 and hspb2, respectively, as well as stress proteins related to HSPs (alpha crystallins encoded by genes Cryab and Cryac, and osmotic stress protein 94 encoded by gene Hspa4l) did not show altered mRNA levels (Table 7).

Table 7.   Expression of osmoadaptation-related genes
GenBankSymbolName and other aliasesMicroarrayqRT-PCR
45 min90 min6 h45 min90 min6 h
  1. Results are expressed as fold change values of relative mRNA levels between sucrose-injected versus sham-injected animals for increasing durations of systemic hypertonicity. Microarray analysis was performed on pooled RNA from five animals. qRT-PCR analysis was performed on individual samples (mean ± SEM) (n = 5). **p < 0.01 by Student’s t-test.

NM_019134Slcl2a1Na+, K+, 2 Cl cotransporter 1; NKCC21.00.90.9   
NM_031798Slcl2a2Na+, K+, 2 Cl cotransporter 2; NKCC10.90.91.1   
NM_012652Slc9a1Na+/H+ exchanger 1; NHE11.00.90.9   
NM_012653Slc9a2Na+/H+ exchanger 2; NHE20.80.91.0   
NM_138858Slc9a5Na+/H+ exchanger 5; NHE51.01.21.3   
NM_012651Slc4a1Cl/HCO3 anion exchanger; AE11.01.10.7   
NM_017048Slc4a2Cl/HCO3 anion exchanger; AE21.11.11.1   
NM_017049Slc4a3Cl/HCO3 anion exchanger; AE31.01.21.1   
NM_053715Slc5a3Sodium-myo-inositol transporter; SMIT1.01.22.4   
NM_017206Slc6a6Taurine transporter; TauT1.01.11.8   
NM_138832Slc38a1Sodium/neutral amino acid transporter 1; SNAT10.91.41.0   
NM_181090Slc38a2Sodium/neutral amino acid transporter 2; SNAT2; ATA21.11.22.21.1 ± 0.30.8 ± 0.34.3 ± 1.3**
NM_145776Slc38a3Sodium/neutral amino acid transporter 3; SNAT30.90.90.8   
NM_031971Hspa1aHeat-shock 70 kDa protein 1A; HSP70-11.31.62.3 1.2 ± 0.51.8 ± 0.8
BF401583Hspa4lHeat-shock 70 kDa protein 4-like; OSP941.00.91.0   
NM_013083Hspa5Heat-shock 70 kDa protein 5; GRP781.20.80.9   
BG375996Hspb1Heat-shock 27 kDa protein 1; HSP251.11.31.4   
BM389653Hspb2Heat-shock 27 kDa protein 2; HSP271.01.20.8   
NM_012935CryabCrystallin, alpha B; HSPB50.91.01.1   
NM_053612CryacCrystallin, alpha C; HSPB8; HSP2210.91.1   

Finally, a few miscellaneous genes showed above average increases in expression levels. Table 8 gives the list of genes whose expression levels increased at least threefold over at least one given period of systemic hypertonicity. Many of them showed a delayed expression increase following 6 h of systemic hypertonicity only. Nevertheless, two of them (Cyr61 and Zfp36) showed a rapidly increased expression, 16- and 4-fold, respectively, based on qRT-PCR data after only 45 min systemic hypertonicity.

Table 8.   Miscellaneous genes showing a marked increased expression following systemic hypertonicity
GenBankSymbolName and other aliasesMicroarrayqRT-PCR
45 min90 min6 h45 min90 min6 h
  1. Results are expressed as fold change values of relative mRNA levels between sucrose-injected versus sham-injected animals for increasing duration of systemic hypertonicity. The genes listed showed at least a threefold increase of fold change value for at least a given time of hypertonicity. Microarray analysis was performed on pooled tissue from five animals. qRT-PCR analysis was performed on individual samples (mean ± SEM) (n = 5). *p < 0.05; **p < 0.01 and ***p < 0.001 by Student’s t-test.

NM_024400Adamts1A disintegrin-like and metallopeptidase with thrombospondin type 1 motif, 11.92.53.2   
NM_017259Btg2B-cell translocation gene 2, anti-proliferative; Pc3; Tis 212.43.12.4 2.9 ± 1.1*2.9 ± 0.6**
NM_013025Ccl3Chemokine (C-C motif) ligand 3; MIP1a; Scya31.84.54.7 3.4 ± 1.79.3 ± 1.8***
NM_031327Cyr61Cysteine rich protein 61; CCN19.07.24.316.1 ± 1.4***22.6 ± 0.7***6.6 ± 0.6***
NM_053769Dusp1Dual specificity phosphatase 1; MKP-1; CL100; Ptpnl62.32.93.5 3.4 ± 1.0*7.3 ± 1.4**
NM_013089Gys2Glycogen synthase 20.81.76.1   
NM_013144Igfbp1Insulin-like growth factor binding protein 11.01.66.3   
CA509173NfkbiaNF-kappa-B inhibitor alpha; RL/IF-11.02.63.3 2.6 ± 1.1*7.6 ± 2.0**
NM_138504Okl38Pregnancy-induced growth inhibitor1.63.83.5   
NM_012620Serpine1Serine (or cysteine) peptidase inhibitor, clade E, member 12.22.33.7   
NM_017076Taa1Poliovirus receptor1.72.84.1   
NM_133290Zfp36Zinc finger protein 36; tristetraprolin; Tis11; Nup4754.13.53.94.0 ± 0.9**3.9 ± 0.8**3.1 ± 0.4***

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References

Here, we have applied DNA microarray technology to analyze temporal gene expression in brain tissue following acute systemic hypertonicity brought about by i.p. injection of a hypertonic sucrose solution, as previously described (Loyher et al. 2004). For microarray analysis, we used pooled total RNA from five animals while qRT-PCR analyses were performed on individual samples from each animal. Comparisons were made with sham-treated animals in order to eliminate variations brought about by injection and handling stress. For the overwhelming majority of genes, the fold change values of mRNA levels were very close to one for each duration of systemic hypertonicity. These figures which correspond to genes whose expression levels were not modified provide evidence for the reliability of microarray determinations. Furthermore, for all microarray determinations that were checked, qRT-PCR data validated the results of the microarray assay though the high values of the actual fold change ratio tended to be underestimated by microarray analysis, as already reported (Rajeevan et al. 2001). The number of genes with higher expression levels increased rapidly with the duration of systemic hypertonicity from about 15 after 45 min to up to nearly 200 after 6 h of systemic hypertonicity, out of a total number of about 23 000 genes whose mRNA levels could be reliably detected. Most of them showed a modest expression increase with a fold change value below three. Among these genes it is likely that only a few contributed to the osmoadaptation processes. For most of them the increased expression probably reflected altered cell functioning resulting from osmotic stress. Therefore presenting the whole list of genes with increased expression levels is not very informative. We have focused our attention on a few categories of genes, in particular those genes whose increased expression levels may be relevant to cell osmoadaptation.

Immediate early genes encoding transcription factors

The exposure of a cell to external stimuli triggers complex intracellular signaling cascades that result in finely tuned alterations in gene expression, enabling the cell to react in an appropriate manner to the stimulus. IEGs are operationally defined as genes whose rapid and usually transient activation for RNA transcription upon an external stimulus does not require de novo protein synthesis i.e. is directly linked to transduction mechanisms activated by the stimulus (Thomson et al. 1999). IEGs encoding inducible transcription factors regulate the secondary transcriptional responses appropriate for the particular stimulus to which a cell is exposed (Herdegen and Leah 1998). Following exposure to hypertonicity the rapid tonicity-induced expression of some IEGs encoding transcription factors was thus expected as part of the cellular response to the osmotic stress. Three IEGs were thus identified, namely Atf3, Verge, and Klf4 that showed a rapid tonicity-induced expression. To our knowledge none of these has previously been reported to be tonicity-induced. Increased Atf3 and Verge expression in whole tissue was markedly high. This may indicate that it occurs in cells that are widely distributed in brain parenchyma. In comparison, there was a relatively weak increase in Klf4 expression, suggesting that it may only occur in some cell subsets.

Atf3 encodes a member of the activating transcription factor (ATF)/cAMP response element binding protein family of transcription factors with a basic region-leucine zipper (bZip) DNA binding domain (Hai and Hartman 2001). ATF3 is expressed at low levels in quiescent cells and is rapidly induced in a variety of tissues by different stresses (Hai et al. 1999). ATF3 can function as a homodimer or as a complex with members of the CCAAT/enhancer binding protein (C/EBP) family of transcription factors. Atf3 is thought to be an adaptive response gene that participates in cellular processes to adapt to extra- and/or intracellular changes (Lu et al. 2007). Few ATF3 target genes have been reported to date and the precise functional significance of ATF3 in the adaptive response to a particular stress remains poorly documented. Depending on the cell context, the overall physiological function of ATF3 may be protective or detrimental. ATF3 was thus reported to be associated with cell survival (Kawauchi et al. 2002; Nobori et al. 2002) or cell death (Mashima et al. 2001; Hartman et al. 2004). Verge is a newly identified IEG whose expression is induced selectively in brain vascular endothelial cells by seizures and focal ischemia (Regard et al. 2004). Krüppel-like factors (KLFs) are a subclass of the zinc finger family of DNA-binding transcription factors showing homology to the DNA-binding domain of the Drosophila melanogaster protein Krüppel which exhibit tissue-selective expression and wide-ranging regulatory functions (Dang et al. 2000). KLF4 (also known as gut-enriched KLF; GKLF) regulates the transcription of genes involved in cell growth inhibition (Ghaleb et al. 2005).

Activation of IEGs encoding transcription factors in response to environmental stress triggers the coordinated expression of functionally related effector genes that lead either to cell recovery, or alternatively, cell death. In order to evaluate the beneficial or detrimental roles of the rapid tonicity-induced activation of the above IEGs we looked at the transcriptional profiles for possible indices of apoptosis and focused our attention on the expression of DNA damage and cell death related genes, given the data previously reported in vitro. Cells exposed acutely to a strongly hypertonic medium (osmolality > 500 mOsm/kg) show DNA breaks, as well as up-regulation of proteins known to respond to genotoxic stress, such as p53 and GADDs. In the mIMCD3 renal cell line, DNA breaks appear within 15 min after acute elevation of osmolality from 300 to 500–600 mOsmol/kg by adding NaCl (Kultz and Chakravarty 2001). Acute elevation of NaCl also results in rapid increases in p53 abundance, p53 phosphorylation, and p53 transcriptional activity (Dmitrieva et al. 2000). High NaCl also increases the abundance of the proteins GADD34, 45, and, 153 (Kultz et al. 1998; Chakravarty et al. 2002). p53 protein is a transcription factor that is activated by phosphorylation/acetylation upon DNA damage caused by various genotoxic stresses that lead to the downstream transactivation of a wide variety of genes controlling the cell cycle, DNA repair, and apoptosis (Vousden 2000). p53 up-regulates the expression of Gadd45, a gene involved in the control of the cell cycle and DNA repair, as well as many proapoptotic genes such as Aip1, Apaf1, Bax, Bak, Perp, and Puma (Vousden and Lu 2002). In brain tissue of rats subjected to systemic hypertonicity, no increased expression of p53 was recorded. Furthermore, there was no increased expression of the p53-regulated genes, Gadd45, Aip1, Apaf1, Bax, Bak, Perp, and Puma. Indeed none of the apoptosis-related genes that gave a detectable hybridization signal on the microarrays showed an altered expression following systemic hypertonicity for up to 6 h. In particular, the proapoptotic genes, Bad, Bid, Bid3, Bik, Bnip3, and Bnip3L, which encode BH3-only proteins that are essential initiators of programmed cell death (Bouillet and Strasser 2002) did not show increased expression. Taken together, these data indicate that DNA damage inducing cell cycle arrest, DNA repair, and ultimately apoptosis is unlikely to occur to a significant extend in brain cells under our conditions of systemic hypertonicity. The sharp contrast with the data reported for renal cells in vitro is probably because of the fact that brain cells in vivo were subjected to a weaker hypertonic stress, which was applied more progressively. Altogether these observations suggest that the IEGs, whose activation we recorded, are not involved as primary signals for triggering apoptosis.

It must be noted that there exists selectivity of the tonicity-induced expression of IEGs encoding transcription factors. The expression of most of them was not affected by hypertonicity. Furthermore, among the different members of the same family, the expression of only one member appears to be tonicity-induced, e.g. Atf3 among the Atf family and Klf4 among the Klf family. For some families such as Fos/Jun, Egr or Ier, hypertonicity did not lead to an early increased expression of any of their members. Tissue expression of some genes that is increased by systemic hypertonicity is also increased by other stresses, albeit at different levels. Increased Atf3 expression following systemic hypertonicity is thus much larger than that reported following hypoxia (Tang et al. 2006). More significant is the marked difference in the overall profiles of stress-induced genes. Fos/jun as well as Egr gene families show a large increase in expression following ischemia (Soriano et al. 2000; Lu et al. 2004; Nagata et al. 2004) but no altered expression following systemic hypertonicity. In other words, although each of these cellular stresses may induce overlapping signaling pathways and target genes, the IEG expression profile is stress-specific. This specificity suggests that the activation of these IEGs represents the primary response of the cells for secondarily triggering the expression of the genes allowing adaptation to the stress. According to this view the tonicity-induced expression of ATF3, VERGE, and to a lesser extend KLF4, may activate genes encoding proteins involved in cellular osmoadaptation.

Tonicity enhancer-binding protein

In renal cells exposed to a hypertonic medium TonEBP-mRNA, TonEBP, and TonEBP neosynthesis increased progressively to reach a maximum after around 12 h exposure (Woo et al. 2000). These data provided evidence that the tonicity-induced expression of TonEBP results from the activation of transcription of gene Nfat5 encoding TonEBP. In brain, we previously reported a rapid increase in TonEBP expression in neurons reaching a maximum within 1 h and half of systemic hypertonicity (Loyher et al. 2004). In the present study, TonEBP-mRNA tissue levels remained unchanged following acute systemic hypertonicity for up to 6 h. Furthermore, at the cellular level, TonEBP-mRNA labeling in neurons showing a rapid and strong tonicity-induced expression of TonEBP, as in the pyramidal and granule cells in hippocampus, remained unchanged following acute systemic hypertonicity. These data indicate that the rapid tonicity-induced expression of TonEBP in brain neurons does not result from the activation of transcription but rather supports the hypothesis that it might result from the activation of translation. While much less studied than transcriptional regulations, translational regulations of protein expression are now well established. Virtually all steps of protein translation can be subject to regulations modifying translation efficiency and ultimately protein expression (Wilkie et al. 2003). Translational regulations which are more rapid than transcriptional regulations have been shown to be implemented following cellular stress (Sheikh and Fornace 1999). As far as TonEBP tonicity-induced expression is concerned translational up-regulation may be functionally relevant. Neurons do not store TonEBP in the cytoplasm (Loyher et al. 2004; Maallem et al. 2006a), so an early tonicity-induced translocation from the cytoplasm to the cell nucleus for the activation of target genes, as shown in renal cells (Dahl et al. 2001), cannot occur. We suggest that an early tonicity-induced up-regulation of TonEBP translation by endoplasmic reticulum ribosomes, followed by rapid translocation to the cell nucleus may similarly bring about early activation of target genes.

Osmoadaptation-related genes

Cellular osmoadaptation to a hypertonic medium relies upon the accumulation of inorganic and organic osmolytes. The accumulation of inorganic ions results primarily from the activation of cotransporters and exchangers (NKCC, NHE, and AE) constitutively expressed on the cell membrane (Hoffmann and Dunham 1995; O’Neill 1999). Genes coding for various isoforms of these cotransporters and exchangers were expressed in brain tissue to a level that gave a reliable hybridization signal on microarrays, but none of them showed increased expression following systemic hypertonicity. These results are in agreement with the prevailing view that tonicity regulates the activity rather than the expression of these transporters and exchangers (Hoffmann and Dunham 1995; O’Neill 1999). In contrast, the accumulation of organic osmolytes results from increased expression through the activation of transcription of the genes encoding either the biosynthetic enzyme (AR) or the transporter (SMIT, TauT, and betaine transporter 1) of organic osmolytes (Burg et al. 1997; Waldegger and Lang 1998; Handler and Kwon 2001; Ferraris and Burg 2006). SMIT- and TauT-mRNA levels rose slightly after 6 h of systemic hypertonicity, in agreement with the two- to threefold increase we reported previously following acute salt-loading (Bitoun and Tappaz 2000). No information concerning AR- and betaine/GABA transporter 1-mRNA levels is available as the microarrays did not contain the corresponding probes. More interesting is the increased expression of gene slc38a2 encoding isoform 2 of SNAT that was recorded after 6 h of systemic hypertonicity. The fold change ratio was modest but confirmed by qRT-PCR assays. Furthermore, it appeared specific as no increased expression of genes slc38a1 and slc38a3 encoding two other isoforms, SNAT1 and SNAT3, respectively, was observed. This result may have a functional relevance given what is already known concerning amino acid transport and transporter in relation to adaptation to a hyperosmotic medium. The accumulation of neutral amino acids, through increase of their transmembrane transport, was reported in various cell types (fibroblasts, epithelial cells, endothelial cells, etc) exposed in vitro to a hyperosmotic medium and therefore neutral amino acids are considered to play the role of compatible organic osmolytes for cell volume recovery following tonicity-induced shrinkage (for review see Bussolati et al. 2001). In endothelial cells exposed to a hyperosmotic medium, the in vitro expression of SNAT2-mRNA (previously called ATA2) was found to have rapidly increased (Alfieri et al. 2001). Furthermore, the silencing of SNAT2 expression in fibroblasts exposed to a hyperosmotic medium reduced amino acid accumulation and prevented cell volume recovery (Bevilacqua et al. 2005). In brains of animals subjected to chronic hypertonicity, the tissue neutral amino acid content was reported to be increased (Heilig et al. 1989; Lien et al. 1990). Our present data further support the working hypothesis that some brain cells may accumulate neutral amino acids by up-regulating the expression of SNAT2 to adapt to hypertonicity. The tonicity-induced expression of SNAT2 in whole brain tissue appears relatively modest but it may very well occur in a restricted subset of cells so that the actual increase in those cells may be much higher. Such a speculation appears sensible as previous investigations have already shown a large cellular heterogeneity among brain cells for the tonicity-induced expression of various genes involved in osmoadaptation (Loyher et al. 2004; Maallem et al. 2006a,b).

Heat-shock proteins are a family of proteins induced by a wide range of harmful stimuli, which may contribute to cellular osmoadaptation to hypertonicity by counteracting, as molecular chaperones, protein misfolding brought about by increase in cellular ionic strength (Beck et al. 2000). Exposure of renal epithelial cells in vitro to hypertonicity induces the expression of a variety of HSPs: HSP70, HSP25/27, and HSP110 as well as HSP structurally related stress proteins such as alphaB-crystallin or osmotic stress protein 94 (Cohen et al. 1991; Cowley et al. 1995; Kojima et al. 1996; Rauchman et al. 1997). In kidney, the intra-renal distribution of HSPs follows the osmotic gradient (Beck et al. 2000). The expression of gene Hsp70.1 (official symbol Hspa1a), one of the two genes that encodes HSP70, is selectively tonicity-induced (Lee and Seo 2002) and targeted disruption of this gene markedly reduces cell viability following osmotic stress (Shim et al. 2002). In brain from rats subjected to systemic hypertonicity a slightly greater than twofold increase in expression was detected by microarray only for gene hspa1a, but this increased expression was not found statistically significant by qRT-PCR quantification. Brain cells do not show a tonicity-induced expression of various HSPs, which, accordingly, are unlikely to contribute to their osmoadaptation to hypertonicity.

Miscellaneous genes

Expression of the gene encoding cysteine-rich protein 61 (CYR61) showed an early and marked increase that was not, however, maintained over time. Given the amplitude of the tonicity-induced up-regulation, it is likely that it occurs in most brain cells. Similarly a rapid and strong but transient increase in CYR61-mRNA level was observed in vitro in a renal cell line (mIMCD3) derived from the inner medullary collecting ducts of mouse kidney exposed to a hypertonic medium (Nahm et al. 2002). CYR61 is a secreted matricellular protein of the CCN protein family, which is encoded by an IEG and involved in adhesion, migration, proliferation, and extracellular matrix synthesis (Brigstock 2003). Although minimally expressed in quiescent adult tissues CYR61 expression is strongly up-regulated in mechanically challenged cells (Tamura et al. 2001). At the molecular level, Cyr61 gene expression appears to be regulated by changes in cytoskeletal actin dynamics which are transduced by various components of the signaling machinery, i.e. small Rho GTPases, MAP kinases, and actin binding proteins (Chaqour and Goppelt-Struebe 2006). The first effect of exposure to a hypertonic medium is shrinkage of the cell volume resulting from water loss through osmosis that alters the cytoskeleton. Accordingly, it makes sense that CYR61 expression is rapidly and strongly up-regulated in cells exposed to hypertonicity. Less is known about the functional implication of increased CYR61 expression. It has been suggested that CYR61 can regulate the expression of genes involved in angiogenesis and matrix remodeling (Zhou et al. 2005). Remodeling of extracellular matrix challenged by cell shrinkage might very well be part of the cellular osmoadaptation process. Two genes, Dusp1 and Nfkbia, encoding proteins involved in the regulation of signaling pathways, dual specificity phosphatase (DUSP1) and nuclear factor (NF)-kappa B inhibitor alpha (IkappaBa), respectively, showed increased expression that culminated after 6 h systemic hypertonicity. DUSP1 is a member of the family of the dual specificity protein phosphatase family that dephosphorylates threonine and tyrosine residues of MAP kinases. DUSP1 is encoded by an IEG and is induced by a great variety of stimuli, including osmotic shock (Wiese et al. 1998). DUSP1 expression is part of a feedback mechanism in which activation of MAP kinases induces DUSP1, that in turn dephosphorylates and thus inactivates phosphorylated MAP kinases (Camps et al. 2000). As MAP kinases have been shown in a renal cell line to be commonly involved in signaling pathways leading to the activation of genes by hypertonicity, mostly through the p38 MAP kinase (Nahm et al. 2002), the increased expression of DUSP1 in brain may simply reflect the involvement of DUSP1 in the feedback regulation of tonicity-induced activation of MAP kinase signaling pathways in brain cells. IkappaBa is an ubiquitous member of the inhibitory IkappaB protein family, which, in unstimulated cells, binds to NF-kappa B to form an inactive complex stored in the cytoplasm. Upon extracellular stimulation, IkappaB is rapidly phosphorylated and then degraded by the ubiquitin/proteasome system. This degradation leads to the release of NF-kappa B, which translocates to the nucleus and binds to specific Kappa-B sequences of DNA to activate the transcription of target genes (Verma et al. 1995). Nfkbia is one of the target genes activated by NF-kappa B, which is thus part of the feedback loop regulating the activity of NF-kappa B (Cheng et al. 1994). Accordingly, increased IkappaBa expression in brain tissue provides indirect evidence that the NF-kappa B transducing pathway is stimulated in brain cells following acute systemic hypertonicity. This interpretation is further supported by in vitro data already showing activation of NF-kappa B in intestinal epithelial cells subjected to hyperosmotic stress (Nemeth et al. 2002). It remains to identify which genes in which brain cells are actually tonicity activated by NF-kappa B and to what extent their activation may contribute to osmoadaptation. A rapid, although modest, increase in Zfp36 expression was also recorded. Zfp36 codes for the protein tristetraprolin, a non-classical tandem CCCH zinc finger protein, that was initially identified as an IEG through its rapid and transient activation by a variety of stimuli. It promotes rapid mRNA decay by binding to AU-rich sequence elements located at the 3′-untranslated region and is thus capable of the complex regulations of short-lived mRNAs containing AU-rich instability motifs (Blackshear 2002).

In conclusion, this study shows a rapid increased expression of a small number of IEGs encoding transcription factors namely, Atf3, Verge, and Klf4. The selectivity of this expression pattern for osmotic stress when compared with other stresses and the lack of evidence of apoptosis suggest that activation of these IEGs may represent the primary response to hypertonicity, which contributes to regulating the secondary transcriptional response of effector genes involved in cellular osmoadaptation. The increased expression of slc38a2 encoding a member (SNAT2) of the neutral amino acid transporter family suggests that it may play the role of an osmoprotective gene, at least in some subpopulations of brain cells, by allowing the accumulation of neutral amino acids as osmolytes. In contrast, this study shows no change in HSP expression, which means that HSPs are unlikely to contribute to the osmoadaptation process in brain cells. Finally, our data show that Nfat5 encoding TonEBP is not an IEG and indicate that the early increased expression of TonEBP in neurons following acute hypertonicity is likely to be regulated at the translational level.

Acknowledgement

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References

This work was supported by INSERM, Région Rhône Alpes and Université Lyon 1.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References
  • Adrogue H. J. and Madias N. E. (2000) Hypernatremia. N. Engl. J. Med. 342, 14931499.
  • Alfieri R. R., Petronini P. G., Bonelli M. A., Caccamo A. E., Cavazzoni A., Borghetti A. F. and Wheeler K. P. (2001) Osmotic regulation of ATA2 mRNA expression and amino acid transport system A activity. Biochem. Biophys. Res. Commun. 283, 174178.
  • Ayus J. C., Armstrong D. L. and Arieff A. I. (1996) Effects of hypernatraemia in the central nervous system and its therapy in rats and rabbits. J. Physiol. 492(Pt. 1), 243255.
  • Beck F. X., Neuhofer W. and Muller E. (2000) Molecular chaperones in the kidney: distribution, putative roles, and regulation. Am. J. Physiol. Renal Physiol. 279, F203F215.
  • Bevilacqua E., Bussolati O., Dall’Asta V., Gaccioli F., Sala R., Gazzola G. C. and Franchi-Gazzola R. (2005) SNAT2 silencing prevents the osmotic induction of transport system A and hinders cell recovery from hypertonic stress. FEBS Lett. 579, 33763380.
  • Bitoun M. and Tappaz M. (2000) Gene expression of taurine transporter and taurine biosynthetic enzymes in brain of rats with acute or chronic hyperosmotic plasma. A comparative study with gene expression of myo-inositol transporter, betaine transporter and sorbitol biosynthetic enzyme. Brain Res. Mol. Brain Res. 77, 1018.
  • Blackshear P. J. (2002) Tristetraprolin and other CCCH tandem zinc-finger proteins in the regulation of mRNA turnover. Biochem. Soc. Trans. 30, 945952.
  • Bouillet P. and Strasser A. (2002) BH3-only proteins – evolutionarily conserved proapoptotic Bcl-2 family members essential for initiating programmed cell death. J. Cell Sci. 115, 15671574.
  • Brigstock D. R. (2003) The CCN family: a new stimulus package. J. Endocrinol. 178, 169175.
  • Burg M. B., Kwon E. D. and Kultz D. (1997) Regulation of gene expression by hypertonicity. Annu. Rev. Physiol. 59, 437455.
  • Bussolati O., Dall’Asta V., Franchi-Gazzola R., Sala R., Rotoli B. M., Visigalli R., Casado J., Lopez-Fontanals M., Pastor-Anglada M. and Gazzola G. C. (2001) The role of system A for neutral amino acid transport in the regulation of cell volume. Mol. Membr. Biol. 18, 2738.
  • Camps M., Nichols A. and Arkinstall S. (2000) Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB J. 14, 616.
  • Chakravarty D., Cai Q., Ferraris J. D., Michea L., Burg M. B. and Kultz D. (2002) Three GADD45 isoforms contribute to hypertonic stress phenotype of murine renal inner medullary cells. Am. J. Physiol. Renal Physiol. 283, F1020F1029.
  • Chaqour B. and Goppelt-Struebe M. (2006) Mechanical regulation of the Cyr61/CCN1 and CTGF/CCN2 proteins. FEBS J. 273, 36393649.
  • Cheng Q., Cant C. A., Moll T., Hofer-Warbinek R., Wagner E., Birnstiel M. L., Bach F. H. and De Martin R. (1994) NK-kappa B subunit-specific regulation of the I kappa B alpha promoter. J. Biol. Chem. 269, 1355113557.
  • Cohen D. M., Wasserman J. C. and Gullans S. R. (1991) Immediate early gene and HSP70 expression in hyperosmotic stress in MDCK cells. Am. J. Physiol. 261, C594C601.
  • Cowley B. D. Jr, Muessel M. J., Douglass D. and Wilkins W. (1995) In vivo and in vitro osmotic regulation of HSP-70 and prostaglandin synthase gene expression in kidney cells. Am. J. Physiol. 269, F854F862.
  • Dahl S. C., Handler J. S. and Kwon H. M. (2001) Hypertonicity-induced phosphorylation and nuclear localization of the transcription factor TonEBP. Am. J. Physiol. Cell Physiol. 280, C248C253.
  • Dang D. T., Pevsner J. and Yang V. W. (2000) The biology of the mammalian Kruppel-like family of transcription factors. Int. J. Biochem. Cell Biol. 32, 11031121.
  • Dmitrieva N., Kultz D., Michea L., Ferraris J. and Burg M. (2000) Protection of renal inner medullary epithelial cells from apoptosis by hypertonic stress-induced p53 activation. J. Biol. Chem. 275, 1824318247.
  • Ferraris J. D. and Burg M. B. (2006) Tonicity-dependent regulation of osmoprotective genes in Mammalian cells. Contrib. Nephrol. 152, 125141.
  • Flood W. D., Moyer R. W., Tsykin A., Sutherland G. R. and Koblar S. A. (2004) Nxf and Fbxo33: novel seizure-responsive genes in mice. Eur. J. Neurosci. 20, 18191826.
  • Ghaleb A. M., Nandan M. O., Chanchevalap S., Dalton W. B., Hisamuddin I. M. and Yang V. W. (2005) Kruppel-like factors 4 and 5: the yin and yang regulators of cellular proliferation. Cell Res 15, 9296.
  • Hai T. and Hartman M. G. (2001) The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis. Gene 273, 111.
  • Hai T., Wolfgang C. D., Marsee D. K., Allen A. E. and Sivaprasad U. (1999) ATF3 and stress responses. Gene Expr. 7, 321335.
  • Handler J. S. and Kwon H. M. (2001) Transcriptional regulation by changes in tonicity. Kidney Int. 60, 408411.
  • Hartman M. G., Lu D., Kim M. L. et al. (2004) Role for activating transcription factor 3 in stress-induced beta-cell apoptosis. Mol. Cell. Biol. 24, 57215732.
  • Heilig C. W., Stromski M. E., Blumenfeld J. D., Lee J. P. and Gullans S. R. (1989) Characterization of the major brain osmolytes that accumulate in salt-loaded rats. Am. J. Physiol. 257, F1108F1116.
  • Herdegen T. and Leah J. D. (1998) Inducible and constitutive transcription factors in the mammalian nervous system: control of gene expression by Jun, Fos and Krox, and CREB/ATF proteins. Brain Res. Brain Res. Rev. 28, 370490.
  • Hoffmann E. K. and Dunham P. B. (1995) Membrane mechanisms and intracellular signalling in cell volume regulation. Int. Rev. Cytol. 161, 173262.
  • Ibsen L. and Strange K. (1996) In situ localization and osmotic regulation of the Na(+)-myo-inositol cotransporter in rat brain. Am. J. Physiol. 271, F877F885.
  • Kawauchi J., Zhang C., Nobori K., Hashimoto Y., Adachi M. T., Noda A., Sunamori M. and Kitajima S. (2002) Transcriptional repressor activating transcription factor 3 protects human umbilical vein endothelial cells from tumor necrosis factor-alpha-induced apoptosis through down-regulation of p53 transcription. J. Biol. Chem. 277, 3902539034.
  • Kojima R., Randall J., Brenner B. M. and Gullans S. R. (1996) Osmotic stress protein 94 (Osp94). A new member of the Hsp110/SSE gene subfamily. J. Biol. Chem. 271, 1232712332.
  • Kultz D. and Chakravarty D. (2001) Hyperosmolality in the form of elevated NaCl but not urea causes DNA damage in murine kidney cells. Proc. Natl Acad. Sci. USA 98, 19992004.
  • Kultz D., Madhany S. and Burg M. B. (1998) Hyperosmolality causes growth arrest of murine kidney cells. Induction of GADD45 and GADD153 by osmosensing via stress-activated protein kinase 2. J. Biol. Chem. 273, 1364513651.
  • Lang F., Busch G. L. and Volkl H. (1998) The diversity of volume regulatory mechanisms. Cell Physiol. Biochem. 8, 145.
  • Lee J. S. and Seo J. S. (2002) Differential expression of two stress-inducible hsp70 genes by various stressors. Exp. Mol. Med. 34, 131136.
  • Lien Y. H., Shapiro J. I. and Chan L. (1990) Effects of hypernatremia on organic brain osmoles. J. Clin. Invest. 85, 14271435.
  • Lin M., Liu S. J. and Lim I. T. (2005) Disorders of water imbalance. Emerg. Med. Clin. N. Am. 23, 749770, ix.
  • Loyher M. L., Mutin M., Woo S. K., Kwon H. M. and Tappaz M. L. (2004) Transcription factor tonicity-responsive enhancer-binding protein (TonEBP) which transactivates osmoprotective genes is expressed and upregulated following acute systemic hypertonicity in neurons in brain. Neuroscience 124, 89104.
  • Lu X. C., Williams A. J., Yao C. et al. (2004) Microarray analysis of acute and delayed gene expression profile in rats after focal ischemic brain injury and reperfusion. J. Neurosci. Res. 77, 843857.
  • Lu D., Chen J. and Hai T. (2007) The regulation of ATF3 gene expression by mitogen-activated protein kinases. Biochem. J. 401, 559567.
  • Maallem S., Mutin M., Kwon H. M. and Tappaz M. L. (2006a) Differential cellular distribution of tonicity-induced expression of transcription factor TonEBP in the rat brain following prolonged systemic hypertonicity. Neuroscience 137, 5171.
  • Maallem S., Berod A., Mutin M., Kwon H. M. and Tappaz M. L. (2006b) Large discrepancies in cellular distribution of the tonicity-induced expression of osmoprotective genes and their regulatory transcription factor TonEBP in rat brain. Neuroscience 142, 355368.
  • Mashima T., Udagawa S. and Tsuruo T. (2001) Involvement of transcriptional repressor ATF3 in acceleration of caspase protease activation during DNA damaging agent-induced apoptosis. J. Cell. Physiol. 188, 352358.
  • Minami Y., Inoue K., Shimada S., Morimura H., Miyai A., Yamauchi A., Matsunaga T. and Tohyama M. (1996) Rapid and transient up-regulation of Na+/myo-inositol cotransporter transcription in the brain of acute hypernatremic rats. Brain Res. Mol. Brain Res. 40, 6470.
  • Nagata T., Takahashi Y., Sugahara M., Murata A., Nishida Y., Ishikawa K. and Asai S. (2004) Profiling of genes associated with transcriptional responses in mouse hippocampus after transient forebrain ischemia using high-density oligonucleotide DNA array. Brain Res. Mol. Brain Res. 121, 111.
  • Nahm O., Woo S. K., Handler J. S. and Kwon H. M. (2002) Involvement of multiple kinase pathways in stimulation of gene transcription by hypertonicity. Am. J. Physiol. Cell Physiol. 282, C49C58.
  • Nemeth Z. H., Deitch E. A., Szabo C. and Hasko G. (2002) Hyperosmotic stress induces nuclear factor-kappaB activation and interleukin-8 production in human intestinal epithelial cells. Am. J. Pathol. 161, 987996.
  • Nobori K., Ito H., Tamamori-Adachi M., Adachi S., Ono Y., Kawauchi J., Kitajima S., Marumo F. and Isobe M. (2002) ATF3 inhibits doxorubicin-induced apoptosis in cardiac myocytes: a novel cardioprotective role of ATF3. J. Mol. Cell. Cardiol. 34, 13871397.
  • O’Neill W. C. (1999) Physiological significance of volume-regulatory transporters. Am. J. Physiol. 276, C995C1011.
  • Rajeevan M. S., Vernon S. D., Taysavang N. and Unger E. R. (2001) Validation of array-based gene expression profiles by real-time (kinetic) RT-PCR. J. Mol. Diagn. 3, 2631.
  • Rauchman M. I., Pullman J. and Gullans S. R. (1997) Induction of molecular chaperones by hyperosmotic stress in mouse inner medullary collecting duct cells. Am. J. Physiol. 273, F9F17.
  • Regard J. B., Scheek S., Borbiev T., Lanahan A. A., Schneider A., Demetriades A. M., Hiemisch H., Barnes C. A., Verin A. D. and Worley P. F. (2004) Verge: a novel vascular early response gene. J. Neurosci. 24, 40924103.
  • Sandberg R., Yasuda R., Pankratz D. G., Carter T. A., Del Rio J. A., Wodicka L., Mayford M., Lockhart D. J. and Barlow C. (2000) Regional and strain-specific gene expression mapping in the adult mouse brain. Proc. Natl Acad. Sci. USA 97, 1103811043.
  • Sheikh M. S. and Fornace A. J. Jr (1999) Regulation of translation initiation following stress. Oncogene 18, 61216128.
  • Shim E. H., Kim J. I., Bang E. S. et al. (2002) Targeted disruption of hsp70.1 sensitizes to osmotic stress. EMBO Rep. 3, 857861.
  • Soriano M. A., Tessier M., Certa U. and Gill R. (2000) Parallel gene expression monitoring using oligonucleotide probe arrays of multiple transcripts with an animal model of focal ischemia. J. Cereb. Blood Flow Metab. 20, 10451055.
  • Tamura I., Rosenbloom J., Macarak E. and Chaqour B. (2001) Regulation of Cyr61 gene expression by mechanical stretch through multiple signaling pathways. Am. J. Physiol. Cell Physiol. 281, C1524C1532.
  • Tang Y., Pacary E., Freret T., Divoux D., Petit E., Schumann-Bard P. and Bernaudin M. (2006) Effect of hypoxic preconditioning on brain genomic response before and following ischemia in the adult mouse: identification of potential neuroprotective candidates for stroke. Neurobiol. Dis. 21, 1828.
  • Thomson S., Mahadevan L. C. and Clayton A. L. (1999) MAP kinase-mediated signalling to nucleosomes and immediate-early gene induction. Semin. Cell Dev. Biol. 10, 205214.
  • Verbalis J. G. (2003) Disorders of body water homeostasis. Best Pract. Res. Clin. Endocrinol. Metab. 17, 471503.
  • Verma I. M., Stevenson J. K., Schwarz E. M., Van Antwerp D. and Miyamoto S. (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev. 9, 27232735.
  • Vousden K. H. (2000) p53: death star. Cell 103, 691694.
  • Vousden K. H. and Lu X. (2002) Live or let die: the cell’s response to p53. Nat. Rev. Cancer 2, 594604.
  • Waldegger S. and Lang F. (1998) Cell volume and gene expression. J. Membr. Biol. 162, 95100.
  • Wehner F., Olsen H., Tinel H., Kinne-Saffran E. and Kinne R. K. (2003) Cell volume regulation: osmolytes, osmolyte transport, and signal transduction. Rev. Physiol. Biochem. Pharmacol. 148, 180.
  • Wiese S., Schliess F. and Haussinger D. (1998) Osmotic regulation of MAP-kinase activities and gene expression in H4IIE rat hepatoma cells. Biol. Chem. 379, 667671.
  • Wilkie G. S., Dickson K. S. and Gray N. K. (2003) Regulation of mRNA translation by 5′- and 3′-UTR-binding factors. Trends Biochem. Sci. 28, 182188.
  • Woo S. K., Dahl S. C., Handler J. S. and Kwon H. M. (2000) Bidirectional regulation of tonicity-responsive enhancer binding protein in response to changes in tonicity. Am. J. Physiol. Renal Physiol. 278, F1006F1012.
  • Woo S. K., Lee S. D. and Kwon H. M. (2002) TonEBP transcriptional activator in the cellular response to increased osmolality. Pflugers Arch. 444, 579585.
  • Zhou D., Herrick D. J., Rosenbloom J. and Chaqour B. (2005) Cyr61 mediates the expression of VEGF, alphav-integrin, and alpha-actin genes through cytoskeletally based mechanotransduction mechanisms in bladder smooth muscle cells. J. Appl. Physiol. 98, 23442354.