SEARCH

SEARCH BY CITATION

Keywords:

  • astrocytes;
  • GLAST;
  • glutamate;
  • glutamate transporters;
  • PHI;
  • VPAC2

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Considering the putative neuroprotective role of the vasoactive intestinal peptide (VIP) and the pituitary adenylyl cyclase-activating polypeptide (PACAP), we investigated the acute modulation of glial glutamate uptake by the structurally related peptide histidine isoleucine (PHI). Using cultures of cortical astrocytes, we demonstrated that a 6 min treatment with 1 μmol/L PHI strongly increased the d-[3H]-aspartate uptake velocity from 24.3 ± 1.9 to 46.8 ± 3.5 nmol/mg prot/min. This effect was found to reflect an increase in the activity of the GLAST, the predominant functional glutamate transporter in these cultures. The combination of protein kinase A and C inhibitors was effective in blocking the effect of PHI and the use of peptide antagonists contributed to demonstrate the implication of the VIP/PACAP type 2 receptor (VPAC2). Accordingly, G-protein activation measures and gene reporter assays revealed the expression of functional PHI-sensitive receptors in cultured astrocytes. Biotinylation/immunoblotting studies indicated that PHI significantly increased the cell surface expression of the GLAST (by 34.24 ± 8.74 and 43.00 ± 6.36%, when considering the 72 and 55 kDa immunoreactive proteins, respectively). Such cross-talk between PHI and glutamate transmission systems in glial cells opens attractive perspectives in neuropharmacology.

Abbreviations used
[35S]-GTPγS

[35S]-guanosine 5′-(γ-thio)triphosphate

AC

adenylyl cyclase

BSA

bovine serum albumin

carbachol

carbamoylcholine chloride

CRE

cAMP responsive element

DHK

dihydrokainic acid

DTT

1,4-dithiotreitol

EAAC1

excitatory amino acid carrier-1

EAAT

excitatory amino acid transporter

FBS

fœtal bovine serum

GLAST

glutamate and aspartate transporter

GLT1

glutamate transporter-1

GPCR

G protein-coupled receptor

H89

[N-[2-(p-bromocinnamylamino)-ethyl]-5-(isoquinolinesulfonamide)]

l-SOS

l-serine O-sulfate potassium salt

LTHA

l-(-)-threo-3-hydroxyaspartic acid

P6-38

PACAP (6-38)

PAC1

PACAP-preferring receptor

PACAP

pituitary adenylyl cyclase-activating polypeptide

PHI

peptide histidine isoleucine

PKA and PKC

protein kinase A and C

PLC

phospholipase C

PMSF

phenylmethylsulfonylfluoride

VA

[Ac-Tyr1, d-Phe2]GRF(1-29) amide VIP antagonist

VIP

vasoactive intestinal peptide

Vmax

maximal velocity

VPAC1 and 2

polyvalent VIP/PACAP type 1 and 2 receptors

Peptide histidine isoleucine (PHI) in rodents and its counterpart peptide histidine methionine in human belong to the family of the vasoactive intestinal peptide (VIP) and the pituitary adenylyl cyclase-activating polypeptide (PACAP) (Tatemoto and Mutt 1981). These structurally related endogenous peptides, widely expressed in the central and peripheral nervous systems (Sherwood et al. 2000) act as neurotransmitters or neuromodulators and are endowed with neurotrophic and neuroprotective properties (Dejda et al. 2005; Brenneman 2007). At least three common PACAP/VIP receptors subtypes have been identified. The so-called ‘PACAP-preferring receptor’ (PAC1, with multiple splice variants) shows high selectivity for PACAP, recognizing VIP with a 1000-fold lower affinity (KD ∼ 1 μmol/L) whereas the polyvalent VIP/PACAP type 1 and 2 receptors (VPAC1 and VPAC2) exhibit similar affinity (KD ∼ 1 nmol/L) for VIP and PACAP (Harmar et al. 1998). Though PHI could interact with both VPAC1 and VPAC2 receptors, a selective PHI receptor has been identified in goldfish, showing a high degree of identity (54%) with the human VPAC2 receptor (Tse et al. 2002). These G protein-coupled receptors (GPCR) are associated with diverse and complex signaling cascades. While induction of cAMP production is commonly reported, mobilization of intracellular calcium is also documented, revealing a dual coupling with adenylyl cyclase (AC) and phospholipase C (PLC) (for review, see Vaudry et al. 2000).

Noteworthy, while most of the neuroprotective effects of PACAP appear to result from a direct stimulation of PAC1 receptors located on neuronal cells, the protective activity of VIP has also been assigned to an influence on glial cells. Hence, VIP was demonstrated to act as a potent secretagogue promoting release of glial-derived trophic substances associated with the protection of developing neurons (Brenneman et al. 1996, 2000, 2003). Beside the release of neurotrophic factors, astrocytes actively contribute to neuroprotective processes through the efficient clearance of extracellular glutamate. Indeed, this excitatory amino acid represents a potent neurotoxin at high extracellular concentrations, and is thought to participate in the development of acute nervous insults and progressive neurodegenerative processes (Rothstein et al. 1992; Bonde et al. 2003). Glutamate uptake is essentially ensured by specific membrane excitatory amino acid transporters (EAATs) belonging to the family of cell surface Na+-dependent solute carriers. The cloned EAAT1-3 are known in rodents as GLAST (glutamate and aspartate transporter), GLT1 (glutamate transporter-1) and EAAC1 (excitatory amino acid carrier-1), respectively. GLAST and GLT1 are primarily expressed by glial cells throughout the cerebellum and forebrain whereas EAAC1 is generally considered as a neuronal protein (Danbolt 2001). Inhibition, impairment or reversal of the glutamate transport contribute to increase the extracellular concentration of glutamate, participating in excitotoxic neuronal insults (Rothstein et al. 1992; Hazell et al. 1997; Lievens et al. 2000; Rossi et al. 2000; Trotti et al. 2001). Therefore, the study of the regulation of glutamate uptake in glial cells receives considerable attention and previous studies have reported on the influence of long-term (24–72h) exposure of astrocytes to PACAP or VIP on the glial glutamate uptake and metabolism. These data suggest that these peptides may participate in an active regulatory cross-talk between neurons and glial cells in glutamatergic synapses (Brown 2000; Figiel and Engele 2000; Schluter et al. 2002; Kosugi and Kawahara 2006). Considering that PHI and VIP may also prevent the development of acute excitotoxic lesions (Rangon et al. 2005), we herein focused our attention on the consequences of a brief exposure of cultured astrocytes to these peptides on the activity and subcellular trafficking of glial glutamate transporters.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Materials

Neuropeptides PHI porcine, VIP human, porcine, rat, [Ac-Tyr1, d-Phe2]GRF(1–29) amide VIP antagonist (VA) and PACAP (6–38) (P6-38) were purchased from NeoMPS (Strasbourg, France). The protein kinase inhibitors [N-[2-(p-bromocinnamylamino)-ethyl]-5-(isoquinolinesulfonamide)] (H89) and Ro-320432 were from Calbiochem VWR International (Zaventem, Belgium). Carbamoylcholine chloride (carbachol), guanosine 5′-diphosphate sodium salt (GDP), 2′/3′-O-(N-methylanthraniloyl) guanosine-5′-[β,γ-imido]triphosphate triethylammonium salt (GppNHp), l-aspartate, poly-l-lysine, bovine serum albumin fatty acid free from Fraction V (BSA), bacitracin, O-phenanthroline, phenylmethylsulfonylfluoride (PMSF), proteases inhibitors cocktail, 1,4-dithiotreitol (DTT), Tween-20 and l-Serine O-sulfate potassium salt (l-SOS) were provided by Sigma–Aldrich (Bornem, Belgium) and dihydrokainic acid (DHK) and l-(-)-threo-3-hydroxyaspartic acid (LTHA) were from Tocris (Bristol, United Kingdom). Perkin-Elmer NEN (Leuven, Belgium) supplied d-[3H]-aspartate (specific activity of 23.9 Ci/mmol) and [35S]-guanosine 5‘-(γ-thio)triphosphate ([35S]-GTPγS) (specific activity of 1250 Ci/mmol) and the enhanced chemoluminescence (ECL) reagents. The providers of primary and secondary antibodies were Chemicon international (Hampshire, United Kingdom) for the guinea-pig anti-glutamate transporter GLAST polyclonal antibody, Sigma–Aldrich for the rabbit anti-actin antibody and the peroxidase-conjugated goat anti-rabbit IgG and Jackson Immunoresearch Laboratory (DePinte, Belgium) for the peroxidase-conjugated goat anti-guinea-pig IgG. EZ-Link Sulfo-NHS-biotin and immobilized streptavidin were obtained from Pierce, Perbio-science (Erembordegem-Aalst, Belgium). Tripure RNA isolation reagent was from Roche Diagnostic (Mannheim, Germany). Reverse transcription (RT) was performed using the iScript cDNA Synthesis Kit from Bio-rad Laboratories (Nazareth, Belgium) and the Elongase Enzyme Mix and the PCR primers were obtained from Invitrogen (Merelbeke, Belgium). CELLSTAR® Standard Cell Culture flasks and dishes used for cultured astrocytes were provided by Greiner bio-one (Wemmel, Belgium). All culture media and consumables and the Lipofectamine transfection reagent were purchased from Invitrogen. The luciferase reporter experiments were performed using the cis-reporter plasmids pCRE-Luc and pAP-1-Luc from Stratagene (Amsterdam, Netherlands), the Renilla luciferase reporter phRG-TK vector and the dual-luciferase reporter assay system from Promega (Mannheim, Germany).

Cultures of rat cortical astrocytes

Primary cultures of astrocytes were prepared from postnatal (2-day old) Wistar rats. All animal procedures were conducted in strict adherence to the European Community Concil directive of 24 November 1986 (86-609/EEC) and Decree of 20 October 1987 (87-848/EEC). Animals were kept at constant temperature (23 ± 1°C) and relative humidity (40–60%) on a 12 h light/dark cycle with access ad libitum to both food and water. Briefly, after brain dissection, the cortices were isolated and mechanically dissociated under sterile conditions in Dulbecco’s modified Eagle medium supplemented with fœtal bovine serum (FBS) (10%), penicillin–streptomycin (50 μg/mL), fungizone (2.5 μg/mL) and proline (50 μg/mL). After two centrifugation washing steps at 275 g during 5 min, cells were resuspended in culture medium and residual tissue aggregates were removed by filtration through a cell strainer with a pore size of 70 μm. The cells were plated on cell culture flasks (one cortex per 175 cm2) and grown in a humidified atmosphere of 5% CO2/95% air at 37°C. They were fed weekly until they reached confluence (10 days) before being shaken at 200 rpm for 24 h (fresh medium after 6 h) on a horizontal orbital shaker to remove any remaining oligodendrocytes and microglia. Hence, the purity of astrocytes (about 95%) was assessed by immunocytochemical detection of the astrocytic marker glial fibrillary acidic protein. Two or three days later, cells were collected after trypsinization and distributed at 1.5 × 104 cells/cm2 either on poly-l-lysine coated surfaces into 12-well dishes for uptake and luciferase assays or into non-coated six-well dishes for RT-PCR and 58 cm2 Petri dishes for cell membrane preparations and biotinylation experiments. After adherence (48 h), cell maturation was initiated by decreasing the FBS concentration to 3% during 7 days (Swanson et al. 1997; Duan et al. 1999; Vermeiren et al. 2005a,b).

Cell membrane preparations and [35S]-GTPγS binding assays

Confluent astrocytes were washed with phosphate-buffered saline (PBS, 140 mmol/L NaCl, 2.7 mmol/L KCl, 8 mmol/L Na2HPO4, 1.5 mmol/L KH2PO4, pH 7.4), scraped from the 58 cm2 Petri dishes and collected in PBS by low-speed centrifugation. The pellet was resuspended in a buffer containing 50 mmol/L Tris pH 7.4, 100 mmol/L NaCl, 5 mmol/L MgCl2 and 1 mmol/L EDTA and cells were disrupted in a Dounce homogenizer. Unbroken cells and nuclei were pelleted by centrifugation at 2000 g for 10 min. The cell membranes were collected after a repeated two-time step of centrifugation at 49 000 g for 10 min in the previous buffer supplemented with 0.1% bovine serum albumin (BSA), 0.1% bacitracin, 2 mmol/L O-phenanthroline, 0.15 mmol/L PMSF, 1 mmol/L DTT and 10 μmol/L GDP (binding buffer) and the protein concentration was determined. All these procedures were performed at 4°C. The binding experiments were realized in a 1 mL final volume of binding buffer containing 0.1 nmol/L [35S]-GTPγS, carbachol or PHI (at the indicated concentrations) and initiated by the addition of 50 μg proteins. The non-specific binding was measured in the presence of 0.1 mmol/L GppNHp. Incubations were performed at 30°C during 45 min and were terminated by rapid filtration and three washes in ice-cold buffer (50 mmol/L Tris pH 7.4, 100 mmol/L NaCl, 5 mmol/L MgCl2 and 1 mmol/L EDTA) through presoaked GF/C glass fiber filters (Whatman, Maidstone, United Kingdom) using an automated cell harvester (Brandel Inc., Gaithersburg, MD, USA). Bound radioactivity was measured by liquid scintillation counting.

Identification of PACAP/VIP receptors by RT-PCR

Total RNA was extracted from cultured astrocytes into 6-well dishes or from whole brain from two-day-old rats using the Tripure isolation reagent and cDNA was generated using the iScript cDNA Synthesis kit as suggested by the manufacturer. PCR reactions were carried out in a total volume of 50 μL reaction mixture containing the Elongase Enzyme Mix according to the manufacturer’s protocol with a final concentration of 60 mmol/L Tris-SO4 (pH 9.1), 18 mmol/L (NH4)2SO4, 2 mmol/L MgSO4, 200 μmol/L dNTPs, 400 nmol/L of forward and reverse primers and 500 ng of cDNA from the RT step. The primer pair sequences for PAC1 isoforms, VPAC1 and VPAC2 were the same as those published by Grimaldi and Cavallaro (Grimaldi and Cavallaro 1999). For PAC1, two pairs of primers designed from the rat PACAP-R-HIP-HOP1 isoform were used to discriminated PAC1 splice variants characterized by the absence (short variant) or the presence (HIP/HOP variants) of the 27–28-amino acid cassettes in the third intracellular loop (primers P1/P2) and by a 21-amino acid deletion (very short variant) in the N-terminal extracellular domain (primers P3/P4). The expression of VPAC1 and VPAC2 mRNAs were determined respectively using the primers V1/V2 and V3/V4. The primer sequences and the attended length of the amplicons are summarized in Table 1. Amplification products were obtained after 35 cycles consisting of denaturing at 94°C for 30 s, annealing at 58°C for 45 s and extension at 72°C for 30 s. At the end of the PCR, samples were kept at 72°C for 10 min for final extension and stored at 4°C. Samples from RT-PCR were electrophoresed on a 2% agarose gel and visualized with ethidium bromide staining. Densitometric analysis of the PCR signals was performed on digital images using GelDoc 2000 imaging system (Bio-rad Laboratories, Hemel Hempstead, United Kingdom).

Table 1.   PCR primers and amplification products (F, forward primer; R, reverse primer)
GeneAccession no.Primer sequenceAmplicon (bp)
Short variant of PAC1Z23272P1F: CATCCTTGTACAGAAGCTGC P2R: GGTGCTTGAAGTCCATAGTG300
HIP/HOP variants of PAC1:
 with one cassette  390
 with two cassettes  472
Very short variant of PAC1Z23272P3F: CTGCATCTTCAAGAAGGAGC P4R: CACAAGCATCGAAGTAGTGG268
PAC1 variant with the N-terminal domain  330
VPAC1M86835V1F: CACGAGTGTGAGTACCTGCA V2R: CGGTCTTCACGGTATTGTAG332
VPAC2Z25885V3F: CCAGCTCAGGTACACTGCGC V4R: CAAACACCATGTAGTGGACG480

Measurement of Na+-dependent transport activity

Uptake assays were realized as previously described (Vermeiren et al. 2005a) with some modifications. Cortical astrocytes were grown on coated 12-well plates. When indicated, cells were treated at 37°C with the selective protein kinase A and C (PKA and PKC) inhibitors, respectively H89 at 10 μmol/L or Ro-320432 at 1.5 μmol/L for 30 min (Fukushima et al. 2005; Nanmoku et al. 2005), the neuropeptides PHI or VIP at the specified concentrations or antagonists VA or P6-38 at respectively 0.5 or 0.1 μmol/L for 6 min in 3% FBS-culture medium supplemented with 0.1% BSA. Plates were immediately placed at the surface of a 37°C water bath and rinsed twice with 600 μL of preheated Krebs buffer (25 mmol/L HEPES pH 7.4, 4.8 mmol/L KCl, 1.2 mmol/L KH2PO4, 1.3 mmol/L CaCl2, 1.2 mmol/L MgSO4, 6 mmol/L glucose and 140 mmol/L NaCl). When indicated, inhibitors of glutamate transporters were added 6 min before the addition of the substrate, to final concentrations of 100 μmol/L for LTHA or DHK or 200 μmol/L for l-SOS in accordance with previous investigations (Arriza et al. 1994). In these experiments, l-glutamate was substituted by d-aspartate, its transportable analogue which does not interact with glutamate receptors and is not metabolised. When indicated, d-[3H]-aspartate (50 nmol/L) was diluted with unlabeled l-aspartate to achieve a final concentration of 100 μmol/L (single concentration assays) or a concentration range from 10 to 300 μmol/L (saturation assays). The uptake was stopped after 6 min by three rinses with 2 mL of ice-cold sodium-free Krebs buffer in which NaCl was replaced by choline chloride at the same osmolarity (120 mmol/L). In these conditions, the uptake was linear for at least 6 min as previously observed (Kimmich et al. 2001) and the concentration of substrate (50 nmol/L or 100 μmol/L) in the medium was not significantly modified during this incubation. The cells were lysed with 1 mL of 1N NaOH and the radioactivity of 400 μL of the lysate was evaluated by liquid scintillation counting. A fraction of the lysate was also used for protein determination. The specific activity of the glutamate transporters (expressed as the uptake velocity per mg of protein) was estimated after subtracting the data obtained using the non-selective glutamate transporter inhibitor LTHA.

Transient transfection and Luciferase (Luc) Assays

Matured astrocytes grown at 75% confluence on coated 12-well dishes received 1.5 μg/mL of pCRE-Luc or pAP-1-Luc using the Lipofectamine Transfection Reagent in accordance with the manufacturer’s instructions. To normalize Luc activity data, cis-Reporter plasmids were co-transfected with discrete quantities of the control vector phRG-TK (0.19 μg/mL). Treatments with 1 μmol/L PHI and 0.1 μmol/L of VA or P6-38 antagonists were performed in culture medium supplemented with 0.1% BSA for 6 min. The rinsed transfected cells were then harvested 5 h later and analysed using the Dual-Luciferase Reporter Assay System following provider’s recommendations and a Sirius Luminometer (Berthold, Pforzheim, Germany).

Cellular trafficking of glutamate GLAST transporter

For biotinylation experiments, astrocytes from primary cultures were plated on 58 cm2 Petri dishes, grown until 7 days for maturation and treated when indicated with 0.1 μmol/L PHI in culture medium supplemented with 0.1% BSA for 10 min. After rinsing with PBS containing 0.1 mmol/L CaCl2 and 0.1 mmol/L MgCl2, cells were incubated with 10 mmol/L EZ-Link Sulfo-NHS-biotin with gentle shaking for 1 h at 4°C. Biotinylation was stopped with three rinses in cold PBS-Ca2+/Mg2+ containing 100 mmol/L glycine and shaking in this buffer for 30 min at 4°C to quench the unbound biotin reagent. Cells were lysed in a buffer containing 100 mmol/L Tris–HCl pH 7.4, 150 mmol/L NaCl, 1 mmol/L EDTA, 1% triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate completed with proteases inhibitors (250 mmol/L PMSF and proteases inhibitors cocktail according to recommendations) for 1 h of strong shaking at 4°C. Supernatant was carefully collected after centrifugation at 16 000 g for 20 min at 4°C and a 15 μL fraction was diluted in 50 mmol/L DTT-Laemmli buffer (for crude lysate analysis) and 200 μL supernatant were incubated with an equal volume of immobilized streptavidin for 1 h at 22°C. After centrifugation (16 000 g for 15 min at 4°C), the supernatant corresponding to the non-biotinylated cellular proteins was collected and diluted in an equal volume of 50 mmol/L DTT-Laemmli buffer while the pellet was washed four times and resuspended in 100 μL of 50 mmol/L DTT-Laemmli buffer. After 45 min shaking, this last fraction was cleared by centrifugation (16 000 g for 15 min at 4°C) and collected (biotinylated cell surface proteins). In these conditions, the crude lysate, intracellular and cell surface fractions represented respectively 10, 20 and 60% (v/v) of the total proteins extracted from the cells contained in the 58 cm2 Petri dish. Samples were stored at −20°C until western blotting analysis.

Western blotting analysis

The samples were thawed and boiled for 10 min before analysis by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis according to Laemmli. After electrophoresis, proteins were transferred to nitrocellulose membrane with a Bio-rad minitransblot electrophoretic transfer cell. These membranes were incubated with 5% dry milk dissolved in Tris-buffered saline (50 mmol/L Tris pH 8.1, 150 mmol/L NaCl) containing 0.05% Tween-20 for 30 min with a gentle shaking at 22°C. Immunoprobing was then performed overnight at 4°C using a guinea-pig anti-GLAST polyclonal antibody (1/2500) or a rabbit anti-actin antibody (1/750). Subsequently, the membranes were washed three times with Tris-buffered saline-0.05% Tween-20 and incubated with the secondary antibody peroxidase-conjugated goat anti-guinea-pig IgG (1/5000) or peroxidase-conjugated goat anti-rabbit IgG (1/3000) for 1 h at 22°C. Immunoreactive proteins were detected with the ECL reagents and densitometric analysis of the signal was determined using the Multimodal Imaging system of Kodak Image Station 2000 MM (Eastman Kodak Company, New Haven, CT, USA).

Statistical analysis

Data were expressed as means ± SEM and EC50, Km and Vmax values were obtained by non-linear analysis of experimental data using GraphPad Prism version 3.02 (GraphPad Software, CA, USA). Significance of difference between control and samples treated with various drugs was determined by one-way anova followed by the Bonferroni’s test for multiple comparisons. Values of < 0.05 were considered as statistically significant (*: < 0.05; **: < 0.01; *** or ###: < 0.001).

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Expression of functional PHI receptors in cultures of cortical astrocytes

So far, the characterization of PHI-sensitive receptors has never been reported in glial cells. Therefore, we here specifically examined the ability of this peptide to promote G-protein activation in cultured astrocytes by measuring its influence on [35S]-GTPγS binding in crude cell membrane preparations. As illustrated in Fig. 1a, the neuropeptide specifically stimulated radiolabeled nucleotide binding in a concentration-dependent manner with an EC50 of 0.29 ± 0.04 μmol/L, and a maximal stimulation corresponding to 40.5 ± 3.2% increase above basal, < 0.01. Under these experimental conditions, carbachol, an agonist of muscarinic receptors present in these astrocytes (Vermeiren et al. 2005b) maximally stimulated [35S]-GTPγS binding by 23.9 ± 2.2% with an EC50 of 1.57 ± 0.34 μmol/L. This experiment demonstrates the existence of functional PHI-sensitive GPCRs in cultured cortical astrocytes.

image

Figure 1.  Expression of functional PHI receptors in cultured rat astrocytes. (a) Influences of increasing concentrations of PHI (closed symbols) or carbachol (open symbols) on the specific binding of [35S]-GTPγS in astrocytes membrane preparations. Data (mean ± SEM of three independent experiments performed in quadruplicate) are expressed as a percentage of basal nucleotide binding (*< 0.05; **< 0.01). (b) Detection of PACAP/VIP receptors expression in cultured astrocytes analysed by RT-PCR. Total RNA from cortical astrocytes and whole brain was submitted to RT-PCR with specific primers for PAC1 (lanes 1), the N-terminally truncated PAC1 (lanes 2), VPAC1 (lanes 3) and VPAC2 (lanes 4). A 100-bp DNA ladder is shown at the left of the agarose gel electrophoresis analysis. (c) cAMP responsive element (CRE)- or AP-1-dependent transcription was evaluated in cells transfected with the reporter plasmids pCRE-Luc or pAP-1-Luc. Cells were exposed to vehicle (control) or 1 μmol/L PHI and when indicated with 0.1 μmol/L P6-38 or 0.5 μmol/L VA. Data are expressed as firefly luciferase activity normalized to the Renilla activity (from a co-transfected control plasmid) and represent the mean with SEM from three independent experiments performed in quadruplicate (***< 0.001).

Download figure to PowerPoint

Further characterization of PACAP/VIP receptors expression in cultured astrocytes was performed by RT-PCR using appropriate primers. Preliminary experiments identified the expression of several PAC1 receptor subtypes in the cultured astrocytes. Therefore, additional amplifications targeting this receptor were performed using pairs of primers allowing to determine the presence of HIP/HOP variants (27–28 residues insertion in the third intracellular loop) as well as the very short isoform (21 residues deletion within the amino-terminal domain). Using primers P1/P2, two amplification fragments corresponding to short variants and HIP/HOP variants of PAC1 with one cassette (respectively ∼300 and 390 bp) were detected with brain samples. In contrast, only the shorter fragment (∼300 bp) was observed for cultured astrocytes, revealing the absence of the HIP/HOP variants in these cultures (lanes 1 Fig. 1b). Besides, with the use of primers P3/P4, encompassing the PAC1 amino-terminal domain deletion, resulted in a single amplification product of ∼330 bp in both astrocytes and brain samples, indicating the conservation of the 21-amino acid domain in the PAC1 variants detected (lanes 2, Fig. 1b). Concerning the VPACs receptors, positive amplifications were obtained with pairs of primers targeting either the VPAC1 or VPAC2 receptor. The sizes of the fragments were identical when amplification were performed on brain and culture samples, confirming the expression of both VPAC1 (expected size of 332 bp lanes 3) and VPAC2 (expected size of 480 bp lanes 4) in cultured astrocytes (Fig. 1b).

The intracellular signaling cascades activated by PHI in cultured astrocytes were further examined by measuring CRE or AP-1 dependent transcriptional activities (Fig. 1c). Appropriate cis-reporter plasmids in which luciferase gene transcription is under the control of a defined promoter containing CRE or AP-1 consensus sequences allowed to indirectly monitor the activation of cell signaling involving either cAMP or PKC (Tsuda et al. 1987; Sassone-Corsi et al. 1988). In cultured astrocytes transfected with either pCRE-Luc or pAP-1-Luc, PHI (1 μmol/L, 6 min exposure) was found to strongly induce luciferase activity when measured 5 h after agonist application. For both constructs, the response to 1 μmol/L PHI was almost fully inhibited by VA (0.5 μmol/L), a synthetic peptide antagonist of VPAC1/2 receptors and by the truncated peptide P6-38 (0.1 μmol/L), which antagonizes both PAC1 and VPAC2 receptors (Dickinson and Fleetwood-Walker 1999). These data indicate the presence of functional VIP/PACAP receptors in the model of cultured astrocytes and that the binding of PHI promotes activation of both cAMP and PKC related intracellular signals.

Acute exposure to PHI enhances d-[3H]-aspartate uptake in cultured astrocytes

The acute influence of PHI on glutamate transporter activity was first examined by briefly (6 min treatments in the culture medium) exposing the cultured astrocytes to increasing peptide concentrations (ranging from 1 pmol/L to 1 μmol/L) before measuring the velocity of specific [3H]-aspartate uptake (50 nmol/L d-[3H]-aspartate diluted with 100 μmol/L l-aspartate in order to ensure the detection of both GLAST and GLT1). In these conditions, PHI was found to significantly increase the substrate uptake in a concentration-dependent manner (up to 130% above control, Fig. 2a). In good correlation with the submicromolar activity of PHI determined in [35S]-GTPγS binding assays, a significant effect was detected at a concentration of 1 nmol/L PHI (< 0.01) and non-linear analysis of the uptake data suggested an EC50 of approximately 25 nmol/L (Fig. 2a). In the same conditions, VIP was also found to enhance the uptake (97% increase at 1 μmol/L) but with a lower potency (estimated EC50 value of approximately 250 nmol/L).

image

Figure 2.  Regulation of aspartate uptake after short-term exposure (6 min) to VIP and PHI. (a) Velocity of Na+-dependent aspartate uptake (100 μmol/L) was measured in cultured astrocytes pre-treated with increasing concentrations of PHI (filled symbols) or VIP (open bars). (b) Influence of 1 μmol/L PHI on the saturation of aspartate uptake velocity. (c) Pharmacological blockade of the regulation of the aspartate uptake velocity mediated by 1 μmol/L PHI observed in the presence of VIP/PACAP antagonists P6-38 (0.1 μmol/L) or VA (0.5 μmol/L). Data shown are mean ± SEM from at least three independent experiments performed in quadruplicate (*< 0.05; **< 0.01 and ***< 0.001).

Download figure to PowerPoint

The modulation of glutamate transporters activity induced by PHI was further characterized by measuring specific uptake of isotopic dilutions of d-[3H]-aspartate (dilutions with l-aspartate) in order to derive the uptake kinetic parameters (Fig. 2b). Analysis of saturation isotherms revealed that the 6 min treatment with PHI (1 μmol/L) caused a doubling of the maximal velocity (Vmax) from 24.9 ± 0.5 nmol/min/mg prot for control to 48.3 ± 1.0 nmol/min/mg prot measured for PHI-treated cells, with no significant modification of the affinity for the substrate (Km values of 71.5 ± 3.9 μmol/L for control and 89.0 ± 4.6 μmol/L for PHI-treated cells). In order to determine the nature of the receptor subtypes involved in this modulation, we used the above mentioned antagonists for PAC1 and VPAC receptors. As indicated in Fig. 2c, the increased aspartate uptake velocity mediated by PHI (1 μmol/L) was almost totally abolished by either P6-38 (0.1 μmol/L) or VA (0.5 μmol/L) suggesting a predominant involvement of the VPAC2 receptors and to a lesser extent the VPAC1 receptors.

Considering the variety of signaling cascades activated by PHI and that the activity of many transporters can be modified by phosphorylation processes, the roles of PKA and PKC in the modulation of glutamate uptake was examined using the selective inhibitors H89 for PKA and Ro-320432 for PKC. While these drugs were without significant effect on their own, the acute enhancement in substrate uptake induced by PHI was partially impaired in presence of 10 μmol/L H89 (< 0.01) or 1.5 μmol/L Ro-320432 (< 0.05) and was totally abolished in presence of a combination of these drugs (Fig. 3). These data suggest that the acute induction of glial glutamate uptake activity could involve both PKA and PKC-dependent signaling pathways.

image

Figure 3.  Implication of PKA and PKC in the modulation of aspartate uptake induced by PHI in cultured astrocytes. The regulation of aspartate uptake velocity (100 μmol/L l-aspartate) induced by PHI (1 μmol/L, 6 min) was examined in astrocytes pretreated for 30 min to H89 (10 μmol/L) and/or Ro-320432 (1.5 μmol/L). Data shown represent the mean ± SEM of three different experiments performed at least in triplicate (*< 0.05; **< 0.01 and ***< 0.001).

Download figure to PowerPoint

Short-term treatments with PHI enhance the activity and cell surface expression of the GLAST

In an attempt to discriminate the implication of the two principal glutamate transporters usually detected in glial cells (GLAST and GLT1), we included DHK (a selective GLT1 inhibitor with Ki value of 23 ± 6 μmol/L) or l-SOS (a GLAST/EAAC1 inhibitor with Ki values of 107 ± 8 and 150 ± 52 μmol/L, respectively) in the [3H]-aspartate uptake assays (Arriza et al. 1994). In order to ensure an efficient competition between the substrate and the inhibitors tested, [3H]-aspartate was used at low concentration (50 nmol/L d-[3H]-aspartate without further addition of unlabeled l-aspartate). At such low concentration, experimental data revealed particularly low velocity values (3 pmol/min/mg prot), but the induction by PHI was similar to that observed with high concentration of aspartate (105% increase). In control conditions, the [3H]-aspartate uptake was predominantly dependent on the activity of the GLAST as indicated by the 20% and 80% inhibition observed in the presence of DHK (100 μmol/L) and l-SOS (200 μmol/L), respectively. In PHI-treated cells, the l- resistant uptake was not modified, suggesting that the PHI-mediated increase in substrate uptake was almost totally attributable to an increase in GLAST activity. In contrast, the absolute DHK-sensitive uptake appeared almost unchanged after PHI treatment, suggesting the absence of GLT-1 regulation (Fig. 4).

image

Figure 4.  Characterization of the glial glutamate transporter subtypes associated with the increased aspartate uptake induced by PHI. The velocity of aspartate uptake (50 nmol/L) was measured in naive cells or in cells exposed to 1 μmol/L PHI (6 min), in the absence or in the presence of the glutamate transporter inhibitors DHK (100 μmol/L) or l-SOS (200 μmol/L). Data shown are the mean with SEM of three experiments performed in triplicate (*< 0.05; *** and ###< 0.001).

Download figure to PowerPoint

The rapid regulation of GLAST activity in astrocytes exposed to PHI which merely reflects an increased maximal velocity without alteration in the affinity for the substrate is likely to result from a rapid recruitment of active transporter molecules. Therefore, the GLAST immunoreactivity detected at the cell surface after a treatment of 10 min with 0.1 μmol/L PHI was quantitatively assessed using a membrane-impermeant biotinylation reagent combined with batch extraction of biotinylated proteins and western blotting. Thus, after extraction, cell surface proteins and intracellular proteins were analysed along with proteins from a total cell lysate. The blots were probed with anti-GLAST and anti-actin antibodies. Actin detection was performed in order to quantitatively normalize sample preparations and gel loadings as well as to validate the absence of intracellular protein biotinylation. In all protein fractions, the GLAST antibody evidenced two distinct bands at respectively 72 and 55 kDa which are thought to correspond to distinct glycosylation forms of the GLAST (Conradt et al. 1995). In control conditions, GLAST was detected in both the intracellular and cell surface fractions, whereas actin was only detected in the former. Incubation of astrocytes with 0.1 μmol/L PHI for 10 min resulted in a significant increase in the intensity of GLAST immunoreactivity in the cell surface protein fraction (34.24 ± 8.74% increase for the 72 kDa band, < 0.05 and 43.00 ± 6.36% for the 55 kDa band, < 0.01, = 5) (Fig. 5). In these conditions, a significant decrease (< 0.001, = 5) in the transporter immunoreactivity was detected in the corresponding intracellular protein fraction (51.21 ± 8.97% for the 72 kDa band and 50.94 ± 8.34% for the 55 kDa band). The total expression of GLAST proteins was not affected by the treatment with PHI, as indicated by the identical signals detected in samples of total cell lysate.

image

Figure 5.  Modulation of cell surface expression of the GLAST after short-term exposure (10 min) of cultured astrocytes to PHI. A cell membrane impermeant biotinylation reagent was used to distinguish cell surface and intracellular proteins. Protein samples from the lysate (L), intracellular (I) and cell surface (S) fractions were separated by SDS-PAGE and probed with anti-GLAST and anti-actin antibodies. The upper panels show typical autoradiograms for (a) untreated and (b) PHI (0.1 μM)-treated cells and the lower panels show quantitative data from densitometric analysis of signals obtained in five independent experiments (mean with SEM). Data are expressed as percentage of signals detected in samples from control cells (*< 0.05; **< 0.01; ***< 0.001).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

The key finding of the present study is the demonstration that PHI is able to induce a rapid and substantial increase in glutamate transporter activity in cortical astrocytes. The peptide significantly increased the velocity of substrate uptake with a greater potency than VIP. Further investigations with available antagonists lead us to speculate that VPAC2 receptors could play a major role in the up-regulation process. Finally, this up-regulation was found to essentially reflect an increased cellular trafficking of the GLAST which is recruited at the cell surface of astrocytes, contributing to the increase in substrate uptake.

A considerable attention has recently been devoted to the study of the mechanisms regulating the expression and activity of glutamate transporters with the objective to develop pharmacological strategies to increase extracellular glutamate clearance in the CNS. Up to now, several studies have been focused on the modulation of glutamate transporters protein and/or mRNA levels but there is accumulating evidence showing that the activity of these transporters can be acutely regulated, independently of changes in the expression of these proteins (Beart and O’shea 2007). While it has already been documented that neuropeptides from the VIP/PACAP family could modulate expression of glutamate transporters (Brown 2000; Figiel and Engele 2000; Schluter et al. 2002; Kosugi and Kawahara 2006), we established here that PHI could also activate rapid processes leading to the acute regulation of glutamate uptake by glial cells.

Nowadays, the limited interest for the neuromodulatory activity of PHI is mainly related to difficulties in identifying a selective high-affinity PHI receptor. In addition, PHI exhibits a lower potential than VIP for the stimulation of the VPAC receptors and does not discriminate between VPAC1 and VPAC2. Accordingly, modest physiological responses in neuronal cells are commonly observed after in vivo administration of PHI as compared to VIP or PACAP. Worth mentioning, similar potency for PHI and VIP were measured when examining the protection of white matter tissues against excitotoxic lesions (Rangon et al. 2005), raising questions regarding the activity of these peptides in glial cells. Indeed, our data indicate that PHI could promote the activation of G proteins and signaling pathways associated with VIP/PACAP receptors. Thus, PHI was demonstrated to specifically stimulate [35S]-GTPγS binding in membrane preparations and to activate signaling mechanisms dependent on cAMP production and/or PKC activation. Consistent with the ability of selective antagonists of VPAC1 and VPAC2 receptors to block the responses to PHI, RT-PCR experiments evidenced the expression of both VPAC1 and VPAC2 receptor mRNAs in cultured astrocytes. In contrast, the HIP/HOP PAC1 receptor variants documented in cortical neurons (Grimaldi and Cavallaro 1999) and described recently as potent mediators of the neuroprotective VIP activity (Pilzer and Gozes 2006) could not be detected. Of further interest, PHI appeared to enhance aspartate uptake velocity in a dose-dependent manner with a greater efficacy than VIP, contrasting with studies showing equivalent neuromodulatory activity of these two neuropeptides (Rangon et al. 2005). The selectivity of the modulation was attested using antagonists which severely impaired the PHI-mediated increase in substrate uptake. Effects of P6-38 (Dickinson and Fleetwood-Walker 1999), nearly totally abrogating the up-regulation, suggest the major participation of the VPAC2 rather than VPAC1 receptors and are in good correlation with earlier in vivo evidence for the incapacity of VIP and to a lesser extent PHI to protect VPAC2−/− mice from excitotoxic injury (Rangon et al. 2005). All together these results suggest that PHI could exert a rapid neuromodulatory activity in cultured cortical astrocytes, which essentially involves VPAC2 rather than VPAC1.

The influence of PHI on glutamate transporter activity was found to involve complex signaling pathways implicating both PKA and PKC. The stimulation of the VPAC2 receptors is generally associated to transduction mechanisms dependent on activation of AC, although functional coupling with PLC was also documented (MacKenzie et al. 2001). While both signaling cascades could be involved, the possibility to maximally interfere with the response to PHI through inhibition of either PKA or PKC suggests that both kinases may participate in a unique cascade leading to the regulation of the transporter. In striatal cultured neurons, activated PKA can cause an increase of intracellular Ca2+ stores which in turns, mediates the activation of Ca2+ -dependent proteins such as PKC (Zanassi et al. 2001). The existence of such a cross-talk between PKA and intracellular Ca2+ provides an alternative mechanism to PLC-dependent phosphoinositide turnover that is commonly credited for PKC activation.

According to several previous reports, the use of glutamate transporters blockers (l-SOS and DHK) indicated that GLAST-dependent aspartate uptake was largely predominant in cultured astrocytes. The use of the same inhibitors revealed that PHI specifically influenced the activity of GLAST, as DHK-sensitive uptake was not modified in the conditions tested. As frequently observed in studies focusing on the regulation of transmitter uptake, PHI strongly increased the uptake velocity, without significant modification in the affinity for the substrate. Considering the rapid response to the neuropeptide, the regulation of the GLAST function most likely involved the cell surface recruitment of existing glutamate transporter or the activation of dormant molecules, both processes being putatively triggered by post-translational modifications of the transporter. A modification of GLAST localization was specifically examined by biotinylation and immunoblotting studies, revealing that the brief treatment with PHI robustly increased the density of GLAST exposed at the cell surface of astrocytes. Concomitantly, a significant reduction of the GLAST immunoreactivity was observed in the intracellular fraction. With regards to our functional data revealing a role for PKC and PKA activation in the up-regulation of aspartate uptake, a possible implication of phosphorylation process in the control of GLAST trafficking can be proposed, as already suggested in the literature (Beckman et al. 1999; Robinson 2002; Susarla et al. 2004; Guillet et al. 2005). However, though consensus sites for PKC or PKA phosphorylation have been identified within intracellular regions of the glutamate transporters (Kanai and Hediger 1992; Pines et al. 1992; Storck et al. 1992), the phosphorylation of other cellular proteins involved in the regulation of the GLAST can not be excluded. Previously, several authors have reported that the activation of PKC was associated with a down-regulation of GLAST activity (Conradt and Stoffel 1997; Gonzalez et al. 1999; Guillet et al. 2005) whereas PKA stimulation resulted in the up-regulation of the trafficking of GLAST proteins at the surface of neuronal cells (Guillet et al. 2005). Indeed, these studies differ in terms of cell model and duration of stimulus and highlight the complexity of mechanisms participating in the regulation of glutamate handling by astrocytes.

In conclusion, we report here that a neuropeptide from the VIP/PACAP family strongly up-regulates the activity of a glutamate transporter in glial cells, much faster than could normally be achieved by altering the rate of transcription or protein synthesis. This endogenous regulatory mechanism could have a variety of physiological and pathological consequences. However, further research should be conducted to determine whether similar processes occur in vivo, efficiently promoting neuronal cells survival in models of excitotoxicity. Considering the importance of impaired glutamate uptake in several neurological diseases, this observation should encourage the development of therapeutic strategies based on the use of selective VIP/PACAP agonists targeting glial cells.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

We particularly thank A. Lebbe and R. Lenaert for their excellent technical assistance. This work was supported by the National Fund for Scientific Research (F.N.R.S., Belgium, Conventions des Fonds de la Recherche Scientifique Médicale 3.4.529.07.F). S.Goursaud is recipient of a post-doctoral fellowship from the F.N.R.S and from the Université catholique de Louvain. E. Hermans is Research Director of the F.N.R.S. (Belgium).

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References
  • Arriza J. L., Fairman W. A., Wadiche J. I., Murdoch G. H., Kavanaugh M. P. and Amara S. G. (1994) Functional comparisons of three glutamate transporter subtypes cloned from human motor cortex. J. Neurosci. 14, 55595569.
  • Beart P. M. and O’shea R. D. (2007) Transporters for L-glutamate: an update on their molecular pharmacology and pathological involvement. Br. J. Pharmacol. 150, 517.
  • Beckman M. L., Bernstein E. M. and Quick M. W. (1999) Multiple G protein-coupled receptors initiate protein kinase C redistribution of GABA transporters in hippocampal neurons. J. Neurosci. 19, 16.
  • Bonde C., Sarup A., Schousboe A., Gegelashvili G., Zimmer J. and Noraberg J. (2003) Neurotoxic and neuroprotective effects of the glutamate transporter inhibitor DL-threo-beta-benzyloxyaspartate (DL-TBOA) during physiological and ischemia-like conditions. Neurochem. Int. 43, 371380.
  • Brenneman D. E. (2007) Neuroprotection: A comparative view of vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide. Peptides. 28, 17201726.
  • Brenneman D. E., Hill J. M., Gozes I. and Phillips T. M. (1996) Vasoactive intestinal peptide releases interleukin-1 from astrocytes. Ann. NY Acad. Sci. 805, 280287.
  • Brenneman D. E., Hauser J., Spong C. Y. and Phillips T. M. (2000) Chemokines released from astroglia by vasoactive intestinal peptide. Mechanism of neuroprotection from HIV envelope protein toxicity. Ann. NY Acad. Sci. 921, 109114.
  • Brenneman D. E., Phillips T. M., Hauser J., Hill J. M., Spong C. Y. and Gozes I. (2003) Complex array of cytokines released by vasoactive intestinal peptide. Neuropeptides 37, 111119.
  • Brown D. R. (2000) Neuronal release of vasoactive intestinal peptide is important to astrocytic protection of neurons from glutamate toxicity. Mol. Cell. Neurosci. 15, 465475.
  • Conradt M. and Stoffel W. (1997) Inhibition of the high-affinity brain glutamate transporter GLAST-1 via direct phosphorylation. J. Neurochem. 68, 12441251.
  • Conradt M., Storck T. and Stoffel W. (1995) Localization of N-glycosylation sites and functional role of the carbohydrate units of GLAST-1, a cloned rat brain L-glutamate/L-aspartate transporter. Eur. J. Biochem. 229, 682687.
    Direct Link:
  • Danbolt N. C. (2001) Glutamate uptake. Prog. Neurobiol. 65, 1105.
  • Dejda A., Sokolowska P. and Nowak J. Z. (2005) Neuroprotective potential of three neuropeptides PACAP, VIP and PHI. Pharmacol. Rep. 57, 307320.
  • Dickinson T. and Fleetwood-Walker S. M. (1999) VIP and PACAP: very important in pain? Trends Pharmacol. Sci. 20, 324329.
  • Duan S., Anderson C. M., Stein B. A. and Swanson R. A. (1999) Glutamate induces rapid upregulation of astrocyte glutamate transport and cell-surface expression of GLAST. J. Neurosci. 19, 1019310200.
  • Figiel M. and Engele J. (2000) Pituitary adenylate cyclase-activating polypeptide (PACAP), a neuron-derived peptide regulating glial glutamate transport and metabolism. J. Neurosci. 20, 35963605.
  • Fukushima H., Jimi E., Kajiya H., Motokawa W. and Okabe K. (2005) Parathyroid-hormone-related protein induces expression of receptor activator of NF-{kappa}B ligand in human periodontal ligament cells via a cAMP/protein kinase A-independent pathway. J. Dent. Res. 84, 329334.
  • Gonzalez M. I., Lopez-Colom A. M. and Ortega A. (1999) Sodium-dependent glutamate transport in Muller glial cells: regulation by phorbol esters. Brain Res. 831, 140145.
  • Grimaldi M. and Cavallaro S. (1999) Functional and molecular diversity of PACAP/VIP receptors in cortical neurons and type I astrocytes. Eur. J. Neurosci. 11, 27672772.
  • Guillet B. A., Velly L. J., Canolle B., Masmejean F. M., Nieoullon A. L. and Pisano P. (2005) Differential regulation by protein kinases of activity and cell surface expression of glutamate transporters in neuron-enriched cultures. Neurochem. Int. 46, 337346.
  • Harmar A. J., Arimura A., Gozes I. et al. (1998) International Union of Pharmacology. XVIII. Nomenclature of receptors for vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide. Pharmacol. Rev. 50, 265270.
  • Hazell A. S., Itzhak Y., Liu H. and Norenberg M. D. (1997) 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) decreases glutamate uptake in cultured astrocytes. J. Neurochem. 68, 22162219.
  • Kanai Y. and Hediger M. A. (1992) Primary structure and functional characterization of a high-affinity glutamate transporter. Nature 360, 467471.
  • Kimmich G. A., Roussie J., Manglapus M. and Randles J. (2001) Characterization of Na+-coupled glutamate/aspartate transport by a rat brain astrocyte line expressing GLAST and EAAC1. J. Membr. Biol. 182, 1730.
  • Kosugi T. and Kawahara K. (2006) Reversed actrocytic GLT-1 during ischemia is crucial to excitotoxic death of neurons, but contributes to the survival of astrocytes themselves. Neurochem. Res. 31, 933943.
  • Lievens J. C., Bernal F., Forni C., Mahy N. and Kerkerian-Le Goff L. (2000) Characterization of striatal lesions produced by glutamate uptake alteration: cell death, reactive gliosis, and changes in GLT1 and GADD45 mRNA expression. Glia 29, 222232.
  • MacKenzie C. J., Lutz E. M., Johnson M. S., Robertson D. N., Holland P. J. and Mitchell R. (2001) Mechanisms of phospholipase C activation by the vasoactive intestinal polypeptide/pituitary adenylate cyclase-activating polypeptide type 2 receptor. Endocrinology 142, 12091217.
  • Nanmoku T., Takekoshi K., Fukuda T., Ishii K., Isobe K. and Kawakami Y. (2005) Stimulation of catecholamine biosynthesis via the PKC pathway by prolactin-releasing peptide in PC12 rat pheochromocytoma cells. J. Endocrinol. 186, 233239.
  • Pilzer I. and Gozes I. (2006) VIP provides cellular protection through a specific splice variant of the PACAP receptor: a new neuroprotection target. Peptides 27, 28672876.
  • Pines G., Danbolt N. C., Bjoras M., Zhang Y., Bendahan A., Eide L., Koepsell H., Storm-Mathisen J., Seeberg E. and Kanner B. I. (1992) Cloning and expression of a rat brain L-glutamate transporter. Nature 360, 464467.
  • Rangon C. M., Goursaud S., Medja F., Lelievre V., Mounien L., Husson I., Brabet P., Jegou S., Janet T. and Gressens P. (2005) VPAC2 receptors mediate vasoactive intestinal peptide-induced neuroprotection against neonatal excitotoxic brain lesions in mice. J. Pharmacol. Exp. Ther. 314, 745752.
  • Robinson M. B. (2002) Regulated trafficking of neurotransmitter transporters: common notes but different melodies. J. Neurochem. 80, 111.
  • Rossi D. J., Oshima T. and Attwell D. (2000) Glutamate release in severe brain ischaemia is mainly by reversed uptake. Nature 403, 316321.
  • Rothstein J. D., Martin L. J. and Kuncl R. W. (1992) Decreased glutamate transport by the brain and spinal cord in amyotrophic lateral sclerosis. N. Engl. J. Med. 326, 14641468.
  • Sassone-Corsi P., Visvader J., Ferland L., Mellon P. L. and Verma I. M. (1988) Induction of proto-oncogene fos transcription through the adenylate cyclase pathway: characterization of a cAMP-responsive element. Genes Dev. 2, 15291538.
  • Schluter K., Figiel M., Rozyczka J. and Engele J. (2002) CNS region-specific regulation of glial glutamate transporter expression. Eur. J. Neurosci. 16, 836842.
  • Sherwood N. M., Krueckl S. L. and McRory J. E. (2000) The origin and function of the pituitary adenylate cyclase-activating polypeptide (PACAP)/glucagon superfamily. Endocr. Rev. 21, 619670.
  • Storck T., Schulte S., Hofmann K. and Stoffel W. (1992) Structure, expression, and functional analysis of a Na(+)-dependent glutamate/aspartate transporter from rat brain. Proc. Natl Acad. Sci. USA 89, 1095510959.
  • Susarla B. T., Seal R. P., Zelenaia O., Watson D. J., Wolfe J. H., Amara S. G. and Robinson M. B. (2004) Differential regulation of GLAST immunoreactivity and activity by protein kinase C: evidence for modification of amino and carboxyl termini. J. Neurochem. 91, 11511163.
  • Swanson R. A., Liu J., Miller J. W., Rothstein J. D., Farrell K., Stein B. A. and Longuemare M. C. (1997) Neuronal regulation of glutamate transporter subtype expression in astrocytes. J. Neurosci. 17, 932940.
  • Tatemoto K. and Mutt V. (1981) Isolation and characterization of the intestinal peptide porcine PHI (PHI-27), a new member of the glucagon--secretin family. Proc. Natl Acad. Sci. USA 78, 66036607.
  • Trotti D., Aoki M., Pasinelli P., Berger U. V., Danbolt N. C., Brown Jr R. H. and Hediger M. A. (2001) Amyotrophic lateral sclerosis-linked glutamate transporter mutant has impaired glutamate clearance capacity. J. Biol. Chem. 276, 576582.
  • Tse D. L., Pang R. T., Wong A. O., Chan S. M., Vaudry H. and Chow B. K. (2002) Identification of a potential receptor for both peptide histidine isoleucine and peptide histidine valine. Endocrinology 143, 13271336.
  • Tsuda T., Fukumoto Y., Hamamori Y., Yamashita T. and Takai Y. (1987) Involvement of two intracellular messenger systems, protein kinase C and cyclic AMP, in the regulation of c-fos gene expression in human promyelocytic leukemia (HL-60) cells. J. Biochem. (Tokyo) 102, 15791583.
  • Vaudry D., Gonzalez B. J., Basille M., Yon L., Fournier A. and Vaudry H. (2000) Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharmacol. Rev. 52, 269324.
  • Vermeiren C., Najimi M., Maloteaux J. M. and Hermans E. (2005a) Molecular and functional characterisation of glutamate transporters in rat cortical astrocytes exposed to a defined combination of growth factors during in vitro differentiation. Neurochem. Int. 46, 137147.
  • Vermeiren C., Najimi M., Vanhoutte N., Tilleux S., De H. I., Maloteaux J. M. and Hermans E. (2005b) Acute up-regulation of glutamate uptake mediated by mGluR5a in reactive astrocytes. J. Neurochem. 94, 405416.
  • Zanassi P., Paolillo M., Feliciello A., Avvedimento E. V., Gallo V. and Schinelli S. (2001) cAMP-dependent protein kinase induces cAMP-response element-binding protein phosphorylation via an intracellular calcium release/ERK-dependent pathway in striatal neurons. J. Biol. Chem. 276, 1148711495.