Gene expression in the rat brain during prostaglandin D2 and adenosinergically-induced sleep

Authors

  • Akira Terao,

    1. Biosciences Division, SRI International, Menlo Park, California, USA
    Search for more papers by this author
    • 1

      The present address of A. Terao is the Laboratory of Biochemistry, Department of Biomedical Sciences, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-0818, Japan.

    • 3

      These authors contributed equally to the work.

  • Zhi-Li Huang,

    1. Department of Molecular Behavioral Biology, Osaka Bioscience Institute, Suita, Osaka, Japan
    Search for more papers by this author
    • 3

      These authors contributed equally to the work.

  • Jonathan P. Wisor,

    1. Biosciences Division, SRI International, Menlo Park, California, USA
    Search for more papers by this author
  • Takatoshi Mochizuki,

    1. Department of Molecular Behavioral Biology, Osaka Bioscience Institute, Suita, Osaka, Japan
    Search for more papers by this author
    • 2

      The present address of T. Mochizuki is the Beth Israel Deaconess Medical Center, Boston, MA 02115, USA.

  • Dmitry Gerashchenko,

    1. Biosciences Division, SRI International, Menlo Park, California, USA
    Search for more papers by this author
  • Yoshihiro Urade,

    1. Department of Molecular Behavioral Biology, Osaka Bioscience Institute, Suita, Osaka, Japan
    Search for more papers by this author
  • T. S. Kilduff

    1. Biosciences Division, SRI International, Menlo Park, California, USA
    Search for more papers by this author

Address correspondence and reprint requests to Dr Thomas S. Kilduff, Biosciences Division, SRI International, 333 Ravenswood Avenue, Menlo Park, CA 94025, USA. E-mail: thomas.kilduff@sri.com

Abstract

Previous studies have supported the hypothesis that macromolecular synthesis occurs in the brain during sleep as a response to prior waking activities and that prostaglandin D2 (PGD2) is an endogenous sleep substance whose effects are dependent on adenosine A2a receptor-mediated signaling. We compared gene expression in the cerebral cortex, basal forebrain, and hypothalamus during PGD2-induced and adenosinergically-induced sleep to results from our previously published study of recovery sleep (RS) after sleep deprivation (SD). Immediate early gene expression in the cortex during sleep induced by PGD2- or by the selective adenosine A2a agonist CGS21680 showed limited similarity to that observed during RS while, in the basal forebrain and hypothalamus, widespread activation of immediate early genes not seen during RS occurred. In all three brain regions, PGD2 and CGS21680 reduced the expression of arc, a transcript whose expression is elevated during SD. Using GeneChips®, the majority of genes induced by either PGD2 or CGS21680 were induced by both, suggesting activation of the same pathways. However, gene expression induced in the brain after PGD2 or CGS21680 treatment was distinct from that described during RS after SD and apparently involves glial cell gene activation and signaling pathways in neural-immune interactions.

Abbreviations used
6FAM

6-carboxyfluorescein

Avg Diff

average difference

BF

basal forebrain

Cx

cerebral cortex

EEG

electroencephalogram

EMG

electromyogram

EST

expressed sequence tag

GFAP

glial fibrillary acidic protein

HSP

heat-shock protein

Hy

hypothalamus

IEG

immediate early gene

IGF

insulin-like growth factor

MIP-3-alpha

macrophage inflammatory protein 3 alpha

MT

metallothionein

NFκB

nuclear factor κB

NREMS

non-rapid eye movement sleep

PBR

peripheral benzodiazepine receptor

PGD2

prostaglandin D2

qPCR

quantitative PCR

REMS

rapid eye movement sleep

RNU34

rat neurobiology U34

RS

recovery sleep

SD

sleep deprivation

SZ

sleep-promoting zone

TAMRA

6-carboxy-N,N,N′,N′-tetrachlorofluorescein

TNF

tumor necrosis factor

ZT

Zeitgeber time

A number of chemical agents are known to induce sleep or a sleep-like state, but questions regarding the similarity of this state to physiologically normal sleep invariably arise. For example, benzodiazepines are soporific in both humans and rats but also have distinct-effects on the electroencephalogram (EEG) during sleep, including dose-dependent increases in non-rapid eye movement sleep (NREMS) and, paradoxically, reductions in slow wave (0.5–4 Hz) activity and increases in higher frequency EEG oscillations (Achermann and Borbely 1987). In contrast to synthetic compounds, a variety of studies have demonstrated that prostaglandin D2 (PGD2) is an endogenous sleep-promoting substance. Intracerebral administration of PGD2 induces sleep, especially slow wave sleep, in rats and monkeys (Onoe et al. 1988). Inhibition of the enzyme responsible for PGD2 synthesis, PGD synthase (PGDS), with selenium compounds administered either intracerebroventricularly (Matsumura et al. 1991) or intravenously (Takahata et al. 1993) markedly suppresses sleep and blockade of PGD2 receptors inhibits physiological sleep (Qu et al. 2006). The level of PGD2 in the CSF of rats undergoes significant modulation by time of day, with a daytime peak and a nighttime trough (Pandey et al. 1995). CSF levels of PGD2 in rats increase during sleep deprivation (SD) and tend to increase along with an increasing propensity toward sleep under normal conditions (Ram et al. 1997).

The site of action for PGD2 has been identified as a sleep-promoting zone (PGD2-SZ) located on ventral surface of the rostral basal forebrain (BF) outside the brain parenchyma (Matsumura et al. 1994; Gerashchenko et al. 1998). A number of lines of evidence implicate signaling by the A2a-adenosine receptor within the brain in the sleep-promoting mechanism of PGD2 (Satoh et al. 1996). Administration of a selective A2a-adenosine agonist (CGS21680), but not the selective A1-adenosine agonist cyclohexyladenosine, markedly induces sleep when administered to the PGD2-SZ (Satoh et al. 1996). The slow wave sleep-promoting effect of PGD2 is inhibited by pre-treatment with KF17837, a highly selective A2a-adenosine antagonist (Satoh et al. 1996) and is blunted in adenosine A2a receptor-deficient mice (Urade et al. 2003). It is therefore hypothesized that PGD2 is coupled to A2a-adenosinergic signaling via the brain parenchyma and that the PGD2-SZ plays an important role as an interface between these two systems.

Widespread changes in gene expression have been documented within the brain in conjunction with changes in behavioral states (Cirelli 2002; Cirelli et al. 2004). The expression of a number of genes is up-regulated during recovery sleep (RS) after SD (Terao et al. 2003b, 2006). Pharmacological manipulations that induce sleep might also be expected to induce changes in gene expression and, indeed, both PGD2 (Scammell et al. 1998) and adenosinergically-induced sleep (Scammell et al. 2001) are associated with changes in the expression of the immediate early gene (IEG) c-fos. If PGD2 and adenosinergic signaling induce physiological sleep, administration of these compounds should have transcriptional effects similar to those of RS. Identification of the molecular responses common to RS and pharmacologically-induced sleep might provide insights into the biochemical and functional consequences of sleep. Therefore, in the current study, we tested the hypothesis that some transcriptional effects are common to natural and chemically-induced sleep using the real-time quantitative PCR (qPCR) to assess the degree to which PGD2- and CGS21680-induced changes in gene expression parallel those known to occur during RS (Terao et al. 2003b, 2006). To identify additional genes regulated by PGD2 and CGS21680, we used high density oligonucleotide arrays. We find that gene expression in the cerebral cortex (Cx) during PGD2- and CGS21680-induced sleep shows surprisingly limited similarity to that observed during RS, and that BF and hypothalamus (Hy) gene expression is similar to that observed during SD, probably because of activation of adenosine A2a receptors by the PGD2 and adenosine signaling pathways in these regions.

Materials and methods

Animal surgery

The methods used in these experiments were similar to those used in previous studies (Matsumura et al. 1994; Satoh et al. 1996, 1999; Mizoguchi et al. 2001). Under pentobarbital anesthesia (50 mg/kg), 18 male Wistar rats were instrumented for standard recording of the EEG and electromyogram (EMG) and implanted with a stainless steel cannula (0.35 mm OD) for drug infusions in a midline position, 1.1 mm anterior to bregma, to a depth of 7.8 mm below the dura (Scammell et al. 1998). The cannulae thus were directed at the subarachnoid space under the rostral BF, the area defined as a PGD2-sensitive SZ.

Sleep recording

After surgery, each rat was allowed at least a 7-day recovery period before being placed in the experimental chamber where EEG/EMG recording and continuous infusion of sterile physiological saline into the brain through the cannula at a rate of 0.2 μL/min occurred. Animals were maintained under an LD 12 : 12 light cycle. After an acclimation period of 4 days, 24-h baseline recordings were collected for each animal beginning at light offset (20:00 h). On the following day, the saline was replaced by infusion of one of the test solutions and animals were infused with either saline, PGD2 (200 pmol/min) or CGS21680 (20 pmol/min; n = 5–7 animals/treatment) at a rate of 0.2 μL/min for a 2 h period beginning at light offset and the effects on sleep and wakefulness were assessed. Behavioral states were classified in 10 s epochs as either waking (W), NREMS, or rapid eye movement sleep (REMS) as described previously (Matsumura et al. 1994; Satoh et al. 1999; Mizoguchi et al. 2001).

At the end of the infusion period (ZT14), rats were killed by injection of a lethal dose of pentobarbital. The brains were rapidly removed and the Cx, BF, and Hy were dissected, frozen on dry ice and stored at −70°C. These brain regions were chosen because of the putative involvement of BF and Hy structures in sleep regulation and the role of the Cx in generation of EEG rhythms. Dissection of the brain regions, total RNA isolation from the BF, Cx, and Hy of each of the 18 experimental animals, and cDNA synthesis from these samples occurred as described previously (Terao et al. 2006).

All animal experiments were carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Animal Care and Use Committees at SRI International and at Osaka Bioscience Institute and all efforts were made to minimize the number of animals used and their suffering.

Assessment of the expression of candidate genes by qPCR

The primer and probe sequences for the genes listed in Table 1 along with that of glyceraldehyde-3-phosphate dehydrogenase and the methods used to measure mRNA levels using real-time amplification kinetics have been described previously (Terao et al. 2003a,b, 2006).

Table 1.   Candidate gene expression during RS* and PGD2- and CGS21680-induced sleep
GeneCerebral cortexBasal forebrainHypothalamus
RSPGD2CGSRSPGD2CGSRSPGD2CGS
  1. Number of arrows indicates x-fold change as determined by real-time RT-PCR analysis: ↑ indicates gene is significantly up-regulated but the magnitude is 1.5-fold or less; ↑↑ indicates gene is significantly up-regulated and the magnitude is 1.5- to 2.5-fold; ↑↑↑ indicates gene is significantly up-regulated and the magnitude is 2.5- to 3.5-fold; ↑↑↑↑ indicates gene is significantly up-regulated and the magnitude is 3.5- to 4.5-fold; ↑↑↑↑↑ indicates gene is significantly up-regulated and the magnitude is 4.5- to 5.5-fold; ↑↑↑↑↑↑ indicates gene is significantly up-regulated and the magnitude is 5.5- to 6.5-fold; ↓ indicates gene is significantly down-regulated but the magnitude is 1.5-fold or less; ↓↓ indicates gene is significantly down-regulated and the magnitude is 1.5- to 2.5-fold; ↓↓↓ indicates gene is significantly down-regulated and the magnitude is 2.5- to 3.5-fold; – indicates no change relative to time-matched control. *Data from RS have been reported previously in Terao et al. (2006) and are included here for comparison. RS, recovery sleep; PGD2, prostaglandin D2; CGS, CGS21680.

arc↓↓↓↓↓↓↓↓↓↓↓↓
c-fos↑↑↑↑↑↑↑↑↑↑↑↑↑↑↑↑↑
c-jun↑↑↑↑↑↑↑↑
egr-3↑↑
fra-1↑↑↑↑
fra-2↑↑↑↑↑↑↑↑↑↑↑↑↑↑↑↑↑↑↑↑
grp78
grp94↑↑
jun-B↑↑↑↑↑↑↑↑↑↑↑↑↑↑↑↑↑
jun-D
ngfi-a↑↑
ngfi-b↑↑↑↑↑↑↑↑
nr4a3↑↑↑↑↑

Affymetrix GeneChip® hybridization and GeneChip® data analysis

For cDNA synthesis, 5 μg aliquots of total RNA isolated from five to seven animals in each experimental condition were combined to create nine RNA pools (three brain regions – BF, Cx, and Hy – from the three experimental conditions). The cDNA pools were used to synthesize cRNA probes which were then hybridized to replicate Affymetrix Rat Neurobiology U34 (RNU34) GeneChips® (Affymetrix, Santa Clara, CA, USA), resulting in a total of 18 GeneChip® hybridizations.

Data were analyzed with Microarray Suite 4.0 (Affymetrix) and GeneSpring (version 4.1.3; Silicon Genetics, Redwood City, CA, USA). Hybridization signal was measured for the 1322 gene elements on the Affymetrix RNU34 GeneChip®. Hybridization signal for each gene element on a GeneChip® is reported as an average difference (Avg Diff) value. The Avg Diff value was calculated by subtracting the background signal and the non-specific hybridization signal from the specific hybridization signal for each gene element. Some genes are represented by more than one gene element on the array, hence the use of the term gene element rather than gene in the Results section. The Affymetrix software automatically labels each gene element as being ‘present,’‘marginal,’ or ‘absent’ based on the Avg Diff value.

Two methods were used to identify gene elements exhibiting sleep state-dependent changes in expression. To evaluate qualitative (all or none) changes in expression between conditions within a brain region, gene elements were identified that met one of four criteria: (i) scored ‘present’ in both GeneChips® hybridized with cRNA synthesized from the saline-infused animals (control GeneChips®) and absent in both PGD2 GeneChips®; (ii) scored ‘present’ in both control GeneChips® and absent in both ‘CGS21680 GeneChips®’; (iii) scored ‘absent’ in both control GeneChips® and present in both PGD2 GeneChips®; (iv) scored ‘absent’ in both control GeneChips® and present in both CGS21680 GeneChips®. To evaluate quantitative changes in expression between conditions, the Cross Gene Error Model (http://www.silicongenetics.com/Support/GeneSpring/GSnotes/analysis_guides/error_model.pdf) of GeneSpring was used to identify those gene elements that were expressed at a level of intensity sufficient to be considered reliable in all six GeneChips® from a given brain region. Subsequent analyses were limited to the subset of gene elements identified by either of these two procedures.

Data values less than 0.01 were assigned a value of 0.01. The expression level for each gene element was normalized to the 50th percentile of the expression level of all gene elements on the same GeneChip® and, subsequently, to the median percentile of expression for that gene element across all GeneChips® from the same brain region (as per GeneSpring recommended normalization procedures). Avg Diff values for the two control GeneChips® for each brain region and the two replicate GeneChips® hybridized in each experimental condition/brain region group were then averaged to provide expression level values for each gene element in each condition for each brain region. These Avg Diff values were used to calculate the percent change value between the pooled experimental and the pooled control group (drug infusion vs. saline control infusion). We report here all genes that show qualitative (all or none) changes across experimental conditions and those that are up- or down-regulated by at least 50% during either PGD2 or CGS21680 infusion when compared with the pooled saline-infusion control group in any of the three brain regions studied. The 50% threshold was empirically determined to be the minimum value required to identify genes commonly expressed in response to the experimental manipulations across all three brain regions examined. Fold difference data presented in the supplementary tables represent the fold difference between the means of each replicate pair in the control and treatment conditions.

Those genes that were up- or down-regulated in response to PGD2 or CGS21680 were subsequently categorized according to function in a modified version of the GeneSpring ontological structure for gene categorization (Ashburner et al. 2000). The analyses presented herein are based on hybridizations to the probesets on the Affymetrix RNU34 GeneChip®, each of which was designed to correspond to a particular GenBank accession number. In some cases, the GenBank accession numbers represent expressed sequence tags (ESTs). To identify the genes to which each of the ESTs actually correspond, we utilized the GeneSpider function of GeneSpring, which integrates the UniGene, GenBank, and Locus Link databases. As these databases have not been fully curated to eliminate redundancies, our analyses based on probe sets may identify two or more genetic elements as unique entities that, in fact, correspond to the same gene. Based on our knowledge of the literature, we have made every effort to eliminate such redundancies. For example, egr-1 (GenBank M18416) is recognized as being synonymous with krox-24, but it is possible that there may still be other synonyms in our gene lists.

Confirmation of results from GeneChip® studies

On the basis of the GeneChip® results, several genes were selected for further analysis using the real-time fluorescence detection method as described above. The primer and probe sequences were chosen from the coding regions of the following genes using Primer Express v.1.0 Software (Perkin-Elmer Applied Biosystems, Foster City, CA, USA): (i) complement component 3 (c3; GenBank accession M29866): forward primer GGTAAGGGTGGAACTGTTGCA; TaqMan® probe (Qiagen, Valencia, CA, USA) 6-carboxyfluorescein (6FAM) 5′-CCAGCCTTCTGCAGCATGGCC-3′ 6-carboxy-N,N,N′,N′-tetrachlorofluorescein (TAMRA); reverse primer TGGTCTGGTAGTACCGCTTCTTG (amplicon size = 74 bp); (ii) the alpha 5 subunit of the GABAA receptor (gabra5; X51992): forward primer CAGCTAGGACAGTTTTTGGAGTGA; TaqMan® probe 6FAM 5′-CACAGTGCTGACCATGACAACCCTCA-3′ TAMRA; reverse primer CGAATTCCGGGCACTGAT (amplicon size = 71 bp); (iii) glial fibrillary acidic protein (GFAP; NM_017009): forward primer CCTTGACCTGCGACCTTGAG; TaqMan® probe 6FAM 5′-TTGCGCGGCACGAACGAGTC-3′ TAMRA; reverse primer GCGCATTTGCCTCTCCAA (amplicon size = 62 bp); (iv) heat-shock 27 kDa protein (HSP27; AA998683; AI176658): forward primer ATCAGCGGAGATCACCATTCC; TaqMan® probe 6FAM 5′-TCACTTTCGAGGCCCGTGCCC-3′ TAMRA; reverse primer CGACTCTGGGCCTCCAATT (amplicon size = 64 bp); (v) insulin-like growth factor II (IGF-II; X51992): forward primer CGGCAGCTCAGATTTTGGAA; TaqMan® probe 6FAM 5′-AGTGTGTGTGCCCCAAACACGCAC-3′ TAMRA; reverse primer CCGCCGCGCAGTGT (amplicon size = 62 bp); (vi) metallothionein-1 and -2 (MT-1; M11794; AI102562): forward primer CGTGCTGTGCCTGAAGTGA; TaqMan® probe 6FAM 5′-AACAGTGCTGCTGCCCTCAGGTGTAAA-3′ TAMRA; reverse primer GACTCTGAGTTGGTCCGGAAAT (amplicon size = 72 bp); and (vii) peripheral benzodiazepine receptor (PBR; NM_012515): forward primer TTTGGTGCCCGGCAGAT; TaqMan® probe 6FAM 5′-CTGGGCTTTGGTGGACCTCAT-3′ TAMRA; reverse primer TTGCCACCCCACTGACAAG (amplicon size = 61 bp). To confirm the specificity of the nucleotide sequences chosen for the primers and probes and the absence of DNA polymorphisms, BLASTN searches were conducted against the dbEST and non-redundant set of GenBank, EMBL, and DDBJ databases.

Statistical analyses

Sleep state and real-time qPCR measurements were analyzed using statview 5.0 (Abacus Concepts, Berkeley, CA, USA). Data were initially analyzed by anova with alpha set at 0.05 to determine whether significant effects occurred in any of the parameters. Significant main effects determined by anova were followed by the Tukey–Kramer post hoc test to determine whether experimental values differed from saline control values.

Results

Sleep physiology

On the pre-treatment baseline day (p > 0.4; Fig. 1), the amount of time spent in wake, NREMS or REMS did not differ among treatment groups during 2 h corresponding to the infusion period on the experimental day. On the day of treatment, rats treated with PGD2 or CGS21680 spent less time awake [F(2,15) = 24.66, p < 0.001] and more time in NREMS [F(2,15) = 24.49, p < 0.001] during the infusion period (ZT12–14) relative to the saline control group (Fig. 1). NREMS time was increased by roughly twofold in PGD2-treated rats and threefold in CGS21680-treated rats (Fig. 1a). Similarly, REMS relative to baseline was dependent on treatment [F(2,15) = 7.46, p = 0.006]. Infusion of CGS21680 or PGD2 increased REMS by approximately twofold relative to baseline (Fig. 1b), while saline infusion did not significantly affect REMS.

Figure 1.

 Amounts of NREM (a) and REM (b) sleep during the 2-h infusion period in each of the three groups relative to the baseline day. Open bars: baseline and solid bars: experimental recording (2 h). *< 0.05; by paired t-test.

TaqMan® analyses of candidate genes

As the effects of PGD2 and CGS21680 on sleep states from ZT12 to ZT14 were roughly equivalent in magnitude to those observed during RS from ZT6 to ZT8 after SD (Terao et al. 2006), we determined whether these pharmacological treatments had effects on gene expression in the Cx similar to those previously reported during RS (Terao et al. 2006). From our previous studies of RS (Terao et al. 2003a,b, 2006), 13 genes were selected for qPCR analysis including several transcription factors (c-fos, c-jun, egr-3, fra-1, fra-2, jun-B, jun-D, ngfi-a, ngfi-b, and nr4a3), HSP family members (grp78 and grp94), a gene associated with synaptic plasticity (arc), and glyceraldehyde-3-phosphate dehydrogenase which was used as a denominator in the calculation of relative expression levels for these genes. As indicated in Table 1, five of these genes (egr-3, fra-2, grp78, grp94, and nr4a3) had increased expression and eight genes had unchanged expression in the Cx during RS (Terao et al. 2006). However, none of these five genes showed increased expression in the Cx during PGD2-induced sleep and only grp94 showed increased expression during CGS21680-induced sleep (Fig. 2a). In contrast, both PGD2 and CGS21680 reduced the expression of arc in the Cx (Fig. 2b), a gene whose expression increased during SD (Terao et al. 2006). Increased expression of c-jun occurred in the Cx during CGS21680-induced sleep (Fig. 2c) without any significant change during RS or PGD2-induced sleep (Table 1).

Figure 2.

 Expression of (a) grp94, (b) arc, and (c) c-jun in the cerebral cortex (Cx) during RS and PGD2- or CGS21680-induced sleep. (d–f) Comparison of fra-2 expression in the Cx (e), basal forebrain (BF) (e), and hypothalamus (Hy; f) across the three conditions. Numbers within each panel refer to the p value calculated based on anova; *Indicates < 0.05 by Tukey–Kramer post hoc test.

When the candidate gene analyses were expanded to the BF and Hy, one gene, fra-2, showed consistent up-regulation during RS-, PGD2-, and CGS21680-induced sleep (Table 1 and Fig. 2d–f). As in the Cx, arc expression was significantly reduced during both PGD2- and CGS21680-induced sleep in the BF and Hy without any corresponding change during RS (Table 1). Three genes, c-fos, c-jun, and jun-B, were significantly up-regulated in BF and Hy during both PGD2- and CGS21680-induced sleep without any corresponding change during RS (Table 1). Two genes, fra-1 and ngfi-b, were up-regulated in both brain regions in CGS21680-induced sleep without any corresponding change in PGD2-induced sleep or RS (Table 1). Lastly, the expression of two genes, ngfi-a and nr4a3, was increased during CGS21680-induced sleep only in the Hy (Table 1).

Affymetrix GeneChip® hybridizations

Comparisons of PGD2- and CGS21680-induced sleep with saline-treated animals

Affymetrix GeneChips® were used to assess the expression of 1322 gene elements in the BF, Cx, and Hy of PGD2- versus saline-treated rats (Fig. 3a) and in CGS21680- vs. saline-treated rats (Fig. 3b). To identify candidate genes for further studies, we defined those gene elements that exhibited at least 1.5-fold greater signal in a treatment group (PGD2 or CGS21680) relative to saline as being up-regulated, and those that exhibited at least 1.5-fold greater signal in the saline group relative to a treatment group (PGD2 or CGS21680) as being down-regulated in that treatment group. By these criteria, considerably more gene elements were up-regulated than down-regulated in the two treatment groups relative to saline controls in the BF and Hy: 143 gene elements were up-regulated in BF and/or Hy by PGD2 (Fig. 4a, Table S1) and 98 were down-regulated (Fig. 4b, Table S2); 144 gene elements were up-regulated in BF and/or Hy by CGS21680 (Fig. 4a, Table S3) and 109 were down-regulated (Fig. 4b, Table S4). In contrast, the numbers of genes up-regulated in the Cx were less than (PGD2) or equal to (CGS21680) those down-regulated by the infusions (Fig. 4a vs. b).

Figure 3.

 (a) Comparison of gene expression values obtained in PGD2-treated versus saline control groups in the cerebral cortex (Cx), basal forebrain (BF), and hypothalamus (Hy). (b) Comparison of gene expression values obtained in CGS21680-treated versus saline control groups in three brain regions. Control groups are on the abscissa. Points that lie above the leftmost dotted line in each graph were expressed at 1.5-fold higher levels in the experimental condition relative to the control condition. Points that lie below the rightmost dotted line were expressed at 1.5-fold higher levels in the control condition relative to the experimental condition.

Figure 4.

 Venn diagrams illustrating the number of genes up-regulated (a) or down-regulated (b) by at least 50% in each of the three brain regions by PGD2 treatment (left) and CGS21680 treatment (right) during ZT12–14. Abbreviations: BF, basal forebrain; Cx, cortex; Hy, hypothalamus.

In PGD2-treated rats, gene elements classified as up-regulated were more common by roughly threefold in BF (n = 86) and Hy (n = 92) than in Cx (n = 32). In CGS21680-treated rats, the ‘responsiveness’ of brain regions, as determined by the numbers of mRNAs up-regulated subsequent to infusion, were comparable to PGD2 infusion, with the Cx being the least responsive (n = 40) and the BF exhibiting the largest number of increased mRNAs (n = 116), followed by the Hy (n = 70).

A number of gene elements were up-regulated in more than one brain region in PGD2- or CGS21680-treated rats (Fig. 4a, Table 2). Thirty-four gene elements were up-regulated in two of three brain regions by PGD2 (Table 2a), and a partially overlapping set of 34 gene elements was up-regulated in two of three brain regions by CGS21680 (Fig. 4a; Table 2B). Eleven gene elements representing nine distinct genes were commonly up-regulated across all three brain regions by PGD2 (Table 2A and Fig. 4a); these included complement component 3 (c3; GenBank accession M29866), HSP27 (AA998683; AI176658), and MT-1 (M11794; AI102562). Sixteen gene elements representing 14 distinct genes were commonly up-regulated across all three brain regions by CGS21680 (Table 2B and Fig. 4a); c3, hsp27, and mt-1 were also among these genes. Nine transcripts were up-regulated by both treatments in all three brain regions. As a result of redundancy among gene elements on the GeneChip®, these nine elements reduced to six independent genes: GFAP alpha and delta (AF028784), small inducible cytokine subfamily A20 (AF053312), peripheral-type benzodiazepine receptor (J05122), mt-1 (M11794; AI102562), c3 (M29866), and hsp27. In addition, other elements corresponding to hsp27 (M86389) and a MT-2-related transcript (AI176456) were up-regulated in two of three regions by both treatments, as were several other genes (see entries in bold in Table 3A and B).

Table 2.    (A) Thirty three distinct genes are commonly up-regulated by at least 50% in two or more brain regions in response to PGD2 and (B) 38 distinct genes are commonly up-regulated by at least 50% in two or more brain regions in response to CGS21680
Brain regionsProbeset nameGene nameGenBank number
  1. Entries in bold type are commonly up-regulated by both PGD2 and CGS21680 in at least two of the same brain regions.

(A)
 BF and Cx (n = 3)M54987_atRat corticotropin releasing hormone (CRH) gene, complete cds.M54987
X60769mRNA_atCCAAT/enhancer binding protein (C/EBP), beta (Cebpb)X60769
X87157_atNeurolysin (metallopeptidase M3 family) (Nln)X87157
 BF and Hy (n = 24)AF030091UTR#1_atCyclin L1 (Ccnl1)AF030091
AJ222813_s_atInterleukin 18 (Il18)AJ222813
D00913_atICAM-1; Rattus sp. mRNA for intercellular adhesion molecule-1, complete cdsD00913
D00913_g_atICAM-1; Rattus sp. mRNA for intercellular adhesion molecule-1, complete cdsD00913
J02722cds_atHeme oxygenase; Rat heme oxygenase gene, complete cdsJ02722
J04563_atPutative; Rat cAMP phosphodiesterase mRNA, 3′ end [Phosphodiesterase 4B (Pde4b)]J04563
M34253_atInterferon regulatory factor 1 (Irfl)M34253
M34253_g_atInterferon regulatory factor 1 (Irf1)M34253
M63122_atTumor necrosis factor receptor superfamily, member 1 a (Tnfrsf1a)M63122
M86389cds_s_atHeat-shock 27 kDa protein 1 (Hspb1)M86389
rc_AA945583_atHydroxysteroid (17-beta) dehydrogenase 10 (Hsd17b10)AA945583
rc_AI071965_s_atRattus norvegicus cDNA clone UI-R-C2-nl-e-03-0-UI 3′, mRNA sequence [heat-shock 70 kDa protein 1A (Hspa1a)]AI071965
rc_AI179610_atHeme oxygenase 1 (Hmoxl)AI179610
rc_AI236828_s_atSignal transducer and activator of transcription 3 (Stat3)AI236828
U14647_atCaspase 1 (Casp1)U14647
U14647_g_atCaspase 1 (Casp1)U14647
U42719_atComplement component 4a (C4a)U42719
U77777_s_atInterleukin 18 (Il 18)U77777
X03347cds_g_atFBR murine osteosarcoma, complete proviral sequence integrated in Rattus genomeX03347
X17053cds_s_atRat immediate-early serum-responsive JE gene.XI7053
XI 7053mRNA_s_atRat immediate-early serum-responsive JE geneXI7053
X54686cds_atR. norvegicus pJunB gene.X54686
X91810_atSignal transducer and activator of transcription 3 (Stat3)X91810
Z75029_s_atHeat-shock 70 kDa protein 1A (Hspa1a)Z75029
 Cx and Hy (n = 7)M58587_atInterleukin 6 receptor (Il6r)M58587
rc_AI146018_s_atTranscribed locus, highly similar to NP_004792.1 neurexin 1 [Homo sapiens]All46018
rc_AI170268_atBeta-2 microglobulin (B2m)AII70268
rc_AI176456_atTranscribed locus, highly similar to NP_032656.1 metallothionein-2 [Mus musculus]All76456
U31866_g_atTranscribed locus, moderately similar to NP_598738.1 transferrin [Mus musculus]U31866
U78090_s_atPotassium channel regulator 1 (LOC245960)U78090
X62952_atVimentin (Vim)X62952
 BF, Cx, and Hy (n = 11)AF028784 cds#1_s_atRattus norvegicus glial fibrillary acidic proteins alpha and delta (GFAP) geneAF028784
AF053312_s_atSmall inducible cytokine subfamily A20 [Chemokine (C-C motif) ligand 20 (Ccl20)]AF053312
J05122_atBenzodiazepin receptor, peripheral-type (Bzrp)J05122
LI 6764_s_atHeat-shock 70 kDa protein 1A (Hspa1a)LI6764
M11794cds#2_f_atRat metallothionein-2 and metallothionein-1 genes, complete cdsMl1794
 M29866_s_atComplement component 3 (C3)M29866
rc_AA998683_g_atHeat-shock 27 kDa protein 1 (Hspb1)AA998683
rc_AI102562_atMetallothioneinAll02562
rc_AI176658_s_atHeat-shock 27 kDa protein 1 (Hspb1)All76658
U48596_atMitogen-activated protein kinase kinase kinase 1 (Map3k1)U48596
X52477_atComplement component 3 (C3)X52477
(B)
 BF and Cx (n = 2)L16764_s_atHeat-shock 70 kDa protein 1A (Hspa1a)L16764
Y09507_atHypoxia inducible factor 1, alpha subunit (Hif1a)Y09507
 BF and Hy (n = 26)AF030091UTR#1_atCyclin L1 (Ccnl1)AF030091
AF030091UTR#1_g_atCyclin L1 (Ccnl1)AF030091
AJ222813_s_atInterleukin 18 (Il18)AJ222813
D00913_atICAM-1; Rattus sp. mRNA for intercellular adhesion molecule-1, complete cdsD00913
D00913_g_atICAM-1; Rattus sp. mRNA for intercellular adhesion molecule-1, complete cdsD00913
M17960_atInsulin-like growth factor 2 (IGF2)Ml7960
M26744_atInterleukin 6 (Il6)M26744
M63122_atTumor necrosis factor receptor super-family, member 1a (Tnfrsf1 a)M63122
M86389cds_s_atHeat-shock 27 kDa protein 1 (Hspb1)M86389
rc_AI071965_s_atRattus norvegicus cDNA clone UI-R-C2-nl-e-03-0-UI 3′, mRNA sequence [heat-shock 70 kDa protein 1A (Hspa1a)]AI071965
rc_AI1 37246_s_atIg VH193020 = anti-insulin 193020 monoclonal antibody heavy chain variable regionS65980
rc_AI1 76710_atNuclear receptor subfamily 4, group A, member 3 (Nr4a3)A1176710
S77528cds_s_atNFIL-6; Rattus sp. C/EBP-related transcription factor (Nfil6) mRNA, complete cdsS77528
U14647_g_atCaspase 1 (Casp1)U14647
U17254_atImmediate early gene transcription factor NGFI-B [nuclear receptor subfamily 4, group A, member 1 (Nr4a1)]U17254
U17254_g_atImmediate early gene transcription factor NGFI-B [nuclear receptor subfamily 4, group A, member 1 (Nr4a1)]Ul7254
U42719_atComplement component 4a (C4a)U42719
U48596_atMitogen-activated protein kinase kinase kinase 1 (Map3k1)U48596
U77777_s_atInterleukin 18 (Il18) U77777
X03347cds_g_atFBR murine osteosarcoma, complete proviral sequence integrated in Rattus genomeX03347
X06769cds_atUnnamed protein product; c-fos protein (AA 1–380); Rat c-fos mRNAX06769
X06769cds_g_atUnnamed protein product; c-fos protein (AA 1–380); Rat c-fos mRNAX06769
X17053mRNA_s_atRat immediate-early serum-responsive JE geneXI7053
X54686cds_atR. norvegicus pJunB geneX54686
X91810_atSignal transducer and activator of transcription 3 (Stat3)X91810
Z75029_s_atHeat-shock 70 kDa protein 1A (Hspa1a)Z75029
 Cx and Hy (n = 6)M54987_atRat corticotropin releasing hormone (CRH) gene, complete cdsM54987
rc_AA964003_s_atMHC class II RT1-D beta1 chain haplotype a [arrestin, beta 2 (Arrb2)]AA964003
rc_AI146018_s_atTranscribed locus, highly similar to NP_004792.1 neurexin 1 [Homo sapiens]AIl46018
rc_AI176456_atTranscribed locus, highly similar to NP_032656.1 metallothionein-2 [Mus musculus]AIl76456
U31866_g_atTranscribed locus, moderately similar to NP_598738.1 transferrin [Mus musculus]U31866
X62952_atVimentin (Vim)X62952
 BF, Cx, and Hy (n = 16)AF028784cds#1_s_atRattus norvegicus glial fibrillary acidic proteins alpha and delta (GFAP) geneAF028784
AF053312_s_atSmall inducible cytokine subfamily A20 [Chemokine (C-C motif) ligand 20 (Ccl20)]AF053312
J05122_atBenzodiazepin receptor, peripheral-type (Bzrp)J05122
M11794cds#2_f_atRat metallothionein-2 and metallothionein-1 genes, complete cdsMl1794
M23697_atPlasminogen activator, tissue (Plat)M23697
M29866_s_atComplement component 3 (C3)M29866
M34253_g_atInterferon regulatory factor 1M34253
M58587_atInterleukin 6 receptor (Il6r)M58587
rc_AA945583_atHydroxysteroid (17-beta) dehydrogenase 10AA945583
rc_AA998683_g_atHeat-shock 27 kDa protein 1AA998683
rc_AI102562_atMetallothioneinAIl02562
rc_AI176658_s_atHeat-shock 27 kDa protein 1All76658
U14647_atCaspase 1 (Casp1)U14647
X1 7053cds_s_atRat immediate-early serum-responsive JE geneX17053
X52477_atComplement component 3 (C3)X52477
X60769mRNA_atCCAAT/enhancer binding protein (C/EBP), beta (Cebpb)X60769
Table 3.   Eight genes are commonly down-regulated by at least 50% in two or more brain regions in response to PGD2 and (B) 20 distinct genes are commonly down-regulated by at least 50% in two or more brain regions in response to CGS21680
Brain regionsProbeset nameGene nameGenBank number
  1. Entries in bold type are commonly down-regulated by both PGD2 and CGS21680 in at least two of the same brain regions.

(A)
 BF and CxAF042714_atNeurexophilin 4 (Nxph4)AF042714
U88036_atSolute carrier family 21 (organic anion transporter), member 5 (Slc21a5)U88036
 BF and HyAJ001029_atSRY-box containing gene 10 (Sox10)AJ001029
M59786_atCalcium channel, voltage-dependent, alpha 1C subunit (Cacna1c)M59786
XI7012mRNA_s_atRat IGFII gene for insulin-like growth factor IIX17012
 Cx and HyAF081365_s_atPotassium inwardly rectifying channel, subfamily J, member 1 (Kcnjl)AF081365
AFFX-DapX-M_at26.7% identity to the Escherichia coli bifunctional biotin operon represserL38424
 BF, Cx, and HyX51992_atGABAAreceptor, alpha 5 (Gabra5)X51992
(B)
 BF and CxU16845_atNeurotrimin (RNU16845)U16845
U73142_atMitogen-activated protein kinase 14 (Mapk14)U73142
XI5468cds_atRat mRNA for GABAA receptor beta-3 subunitX15468
Z11548_atGlutamate receptor, ionotropic, kainate 2 (Grik2)Z11548
 BF and HyAB016160_g_atGABAB receptor, 1 (Gabbrl)AB016160
M31076_atTransforming growth factor alpha (Tgfa)M31076
M32867_atPotassium voltage-gated channel, shaker-related subfamily, member 4 (Kcna4)M32867
rc_AA893870_g_atEST197673 normalized rat placenta; cDNA clone RPLAM86 3′ end, mRNA sequenceAA893870
rc_AI235758_s_atProtein kinase, cAMP-dependent regulatory, type II beta (Prkar2b)AI235758
S94371_g_atGluR-4c; glutamate receptor subunit 4cS94371
X1 2589cds_s_atPotassium channel protein (AA 1–495), voltage-dependentX12589
X14788_s_atCAMP responsive element binding protein 1 (Creb1)X14788
 Cx and HyAF021 935_atSer-Thr protein kinase related to the myotonic dystrophy protein kinase (Pk428)AF021935
M58040_atTransferrin receptor (Tfrc)M58040
M59980_s_atPotassium voltage-gated channel, Shal-related family, member 2 (Kcnd2)M59980
rc_AA925246_atCathepsin K (Ctsk)AA925246
S55933_i_atGABAA receptor alpha 4 subunit [rats, mRNA, 1843 nt],S55933
S94371_atGluR-4c; glutamate receptor subunit 4c (alternatively spliced)S94371
 BF, Cx, and HyX17012mRNA_s_atRat IGF-II gene for insulin-like growth factor IIX17012
U88036_atSolute carrier family 21 (organic anion transporter), member 5 (Slc21a5)U88036
X51992_atGABAAreceptor, alpha 5 (Gabra5)X51992

Down-regulated gene elements were more common in the BF in both PGD2-treated (n = 63) and CGS21680-treated rats (n = 77) than in either the Cx or Hy (Fig. 4b, Tables S2 and S4). Table 3A presents the eight gene elements down-regulated by at least 50% in more than one brain region in PGD2-treated rats. Only the alpha 5 subunit of the GABAA receptor (gabra5; X51992) was found to be down-regulated across all three brain regions in PGD2-induced sleep (Fig. 4b, Table 3A). Table 3B presents the 21 transcripts down-regulated by at least 50% in more than one brain region in CGS21680-treated rats; gabra5 was also down-regulated in all three brain regions during CGS21680-induced sleep, as was IGF-II (X51992) and the organic anion transporter, slc21a5 (Fig. 4b, Table 3B). In addition, seven transcripts were down-regulated in two of three regions by PGD2 (Table 3A) and 18 were down-regulated in two of three regions by CGS21680 (Table 3B).

As the GeneChip® analyses were based on pooled samples, the expression of seven of the above transcripts (c3, gabra5, gfap, hsp27, igf-II, mt-1, and pbr) was measured by TaqMan® analysis to confirm that their levels were significantly changed in all three brain areas by both treatments (Fig. 5). TaqMan® confirmed that the expression of the c3, gfap, hsp27, and mt-1 transcripts was significantly elevated in Cx, BF, and Hy of PGD2- and CGS21680-treated rats in comparison to saline controls (Fig. 5a–d). In contrast, pbr expression was significantly up-regulated only by CGS21680 in the BF and Hy (Fig. 5e). IGF-II expression was significantly down-regulated in all three regions by both treatments (Fig. 5f), but TaqMan® only confirmed down-regulation of gabra5 in the BF and Hy in both treatments (Fig. 5g). As 5 of the 30 gene × brain region × condition comparisons suggested as up-regulated by the Affymetrix analyses were not confirmed as significant by TaqMan® analyses (Fig. 5a–e), we estimate the False Discovery Rate to be at least 17% for up-regulated genes. Similarly, as 4 of the 12 genes suggested as down-regulated by the Affymetrix analyses were not confirmed as significant by TaqMan® analyses (Fig. 5f–g), we estimate the False Discovery Rate to be at least 33% for down-regulated genes.

Figure 5.

 TaqMan® analysis of seven genes identified as being significantly changed in three brain regions by PGD2 and CGS21680 infusion. (a) Complement component 3 (c3). (b) Heat-shock 27 kDa protein (hsp27). (c) Metallothionein-1 (mt-1) (d) Insulin-like growth factor II (igf-II). (e) The alpha 5 subunit of the GABAA receptor (gabra5). (f) Glial fibrillary acidic protein (gfap) and (g) Peripheral benzodiazepine receptor (pbr). Abbreviations: BF, basal forebrain; Hy, hypothalamus; Cx, cerebral cortex. Numbers within each panel refer to the p value calculated based on anova; *Indicates < 0.05 by Tukey–Kramer post hoc test.

Comparison of current results to prior study of recovery sleep

We compared the results of these GeneChip® studies to those of our previous report (Terao et al. 2006) to determine whether pharmacologically-induced sleep induced changes in gene expression similar to those that occur during SD and/or RS. Of the genes that were up-regulated in one or more brain regions by both PGD2 and CGS21680, 10 were also up-regulated during SD (Table 4A; Fig. 6a) and 5 during RS (albeit in a region-specific manner Table 4B; Fig. 7a). Both caspase 1 (U14647) and CCAAT/enhancer binding protein, beta (X60769) were up-regulated by SD, PGD2, and CGS21680 in more than one brain region (Table 4A). Although several gene elements were up-regulated region-specifically in common between RS and CGS21680 or between RS and PGD2 (Fig. 7a, Table 4B), none were up-regulated in common in more than one brain region in all three treatment groups. However, several gene elements were up-regulated in common in one brain region between SD and PGD2 (Table S5A), RS and PGD2 (Table S4C), SD and CGS21680 (Table S6A), or RS and CGS21680 (Table S5C).

Table 4.    (A) Genes commonly up-regulated at least 50% in response to CGS21680 and PGD2 and during sleep deprivation, (B) Genes are commonly up-regulated at least 50% in response to CGS21680 and PGD2 and during recovery sleep, and (C) Genes commonly down-regulated at least 50% in response to CGS21680 and PGD2 and during recovery sleep
Brain regionsProbeset nameGene nameGenBank number
  1. Entries in bold type were up-regulated by both PGD2 and CGS21680 and during both sleep deprivation in more than one brain region.

(A)
 BF (n = 4)rc_AA998683_g_atHeat-shock 27 kDa protein 1 (Hspb1)AA998683
U14647_atCaspase 1 (Casp1)U14647
U42719_atComplement component 4a (C4a)U42719
X60769mRNA_atCCAAT/enhancer binding protein (C/EBP), beta (Cebpb)X60769
 Cx (n = 3)M11794cds#2_f_atMetallothionein-2; metallothionein-1; Rat metallothionein-2 and metallothionein-1 genesM11794
rc_A1229237_atOpioid receptor-like (Oprl)AI229237
X60769mRNA_atCCAAT/enhancer binding protein (C/EBP), beta (Cebpb)X60769
 H (n = 5)J05122_atBenzodiazepin receptor, peripheral-type (Bzrp)J05122
rc_AI176456_atTranscribed locus, highly similar to NP_032656.1 metallothionein-2AI176456
U14647_atCaspase 1 (Casp1)U14647
U47031_atPurinergic receptor P2X, ligand-gated ion channel, 4 (P2rx4)U47031
X91810_atSignal transducer and activator of transcription 3 (Stat3)X91810
(B)
 BFU23056_atCEA-related cell adhesion molecule 10 (Ceacam 10)U23056
 CxM11794cds#2_f_atMetallothionein-2; metallothionein-1; Rat metallothionein-2 and metallothionein-1 genesM11794
 Hy (n = 3)AF027954_atBcl-2-related ovarian killer protein (Bok)AF027954
J05122_atBenzodiazepin receptor, peripheral-type (Bzrp)J05122
rc_AI176456_atTranscribed locus, highly similar to NP_032656.1 metallothionein-2AI176456
(C)
 BFAF005720mRNA#3_s_atCIC-2Sa; Rattus norvegicus chloride channel (ClC-2) gene, alternatively splicedAF005720
Figure 6.

 Venn diagrams illustrating the number of genes up-regulated (a) or down-regulated (b) in each of the three brain regions by PGD2 treatment, CGS21680 treatment, and sleep deprivation (Terao et al. 2006). Abbreviations: BF, basal forebrain; Cx, cortex; Hy, hypothalamus.

Figure 7.

 Venn diagrams illustrating the number of genes up-regulated (a) or down-regulated (b) in each of the three brain regions by PGD2 treatment, CGS21680 treatment, and recovery sleep (RS) (Terao et al. 2006). Abbreviations: BF, basal forebrain; Cx, cortex; Hy, hypothalamus.

Of the genes that were down-regulated in one or more regions of the brain by both PGD2 and CGS21680, only one was also found to be down-regulated during RS (albeit in a region-specific manner) in our previously reported study (Terao et al. 2006): in the BF (Fig. 7b, Table 4C), the clc-2sa transcript (AF005720), encoding a chloride channel, was down-regulated during RS and after both PGD2 and CGS21680 infusions. In neither the Cx nor the Hy were any gene elements uniformly down-regulated across the SD, PGD2, and CGS21680 GeneChips® (Fig. 6b) or across RS, PGD2, and CGS21680 GeneChips® (Fig. 7b). Several gene elements were, however, down-regulated in one region in common between SD and PGD2 (Table S5B), RS and PGD2 (Table S5D), SD and CGS21680 (Table S6B), or RS and CGS21680 (Table S6D).

Discussion

Methodological considerations and candidate gene studies

In recent years, two strategies have been used to compare the brain gene expression profile between sleep and wakefulness (Cirelli 2002; Terao et al. 2003a,b, 2006; Cirelli et al. 2004). One approach has been to kill groups of animals 12 h out of phase from one another when each group can be expected to have a different distribution of sleep/wake states (sleep history) in the hours prior to killing. The circadian confound in such comparisons of ‘spontaneous wake’ versus ‘spontaneous sleep’ is eliminated by comparison to a group of animals subjected to SD during the ‘spontaneous sleep’ period (Cirelli 2002; Cirelli et al. 2004). The second approach has been to impose SD during the first half of the light phase when sleep is normally at its maximal occurrence followed by an opportunity for RS during the second half of the light phase (Terao et al. 2003a,b, 2006). The expectation is that SD will exacerbate the drive to sleep that is normally high in the first half of the lights on period and that the subsequent RS will be characterized by increased sleep consolidation and intensity which will result in enhancement of the molecular concomitants of sleep, particularly those associated with the restorative aspects of sleep. Both of these approaches suffer from a reliance on SD (prolonged wakefulness) which is thought to be stressful to experimental subjects at both the system (Gip et al. 2004) and cellular (Terao et al. 2003b) levels.

In contrast to the above experimental paradigms, induction of sleep by pharmacological means is likely less stressful to experimental subjects. In the case of induction of sleep by infusion of PGD2 and CGS21680 in particular, sleep induction occurs by changing the perfusion from saline to one of the above drugs (dissolved in saline) from a remote location, without handling the animal (Matsumura et al. 1995). Thus, this experimental paradigm is conceivably a powerful tool for the analysis of gene expression that accompanies a change in arousal state. However, sleep is induced by chemical means rather than occurring spontaneously. Thus, the present study sought to address two questions: (i) what changes in gene expression occur after activation of the PGD2 and adenosine A2a signaling pathways? and (ii) how similar are these changes to those that occur during ‘normal’ sleep (specifically, RS after SD)?

To determine whether activation of the PGD2 and adenosine A2a signaling pathways results in molecular changes similar to those incurred during RS after SD, we compared the expression of 13 genes, primarily from the IEG and HSP families, that had been characterized during RS in both mouse (Terao et al. 2003a,b) and rat (Terao et al. 2006) brain. As indicated in Table 1, although five of these genes were up-regulated during RS in the rat Cx (Terao et al. 2006), none of these five genes changed its expression during PGD2-induced sleep and only one gene, grp94, was up-regulated in the Cx during CGS21680-induced sleep (Fig. 2a). Thus, on the basis of this admittedly small panel of biomarkers, we conclude that either (i) the molecular pathways that underlie PGD2- and CGS21680-induced sleep have little similarity to RS; (ii) that the gene expression profiles induced by PGD2- and CGS21680 are more similar to prolonged wakefulness; or (iii) that the elevated expression of these five biomarkers during RS are an artifact related to the SD which precedes the RS period. On the other hand, reduced levels of arc and IEGs have been reported in the cortex during spontaneous sleep (Cirelli et al. 2004). With respect to the third possibility, we (Wisor et al. 2006) have recently compared the expression of these same five genes in the Cx during RS to sleep induced by three systemically administered pharmacological agents known to affect different aspects of GABAergic neurotransmission: a GABAA agonist (zolpidem), a GABAA modulator (triazolam), and a GABAB agonist (gamma-hydroxybutyrate). Although SD and RS occurred in this study during the lights off period – 12 h out of phase from the previous gene expression study (Terao et al. 2006) – three of the five mRNAs (egr-3, grp78, and grp94) were still elevated during RS. Each of the drugs studied effectively induced sleep, but each drug induced only a subset of the molecular changes in the Cx associated with RS. We conclude that pharmacologically-induced sleep, whether induced by PGD2, CGS21680, or GABAergic agents, at most activates a subset of the molecular pathways that are activated during RS.

Table 1 provides other evidence that pharmacologically-induced sleep is distinct from RS. In the BF and Hy, although PGD2-induced sleep is accompanied by down-regulation of the expression of arc and up-regulation of c-fos, c-jun, and jun-B and CGS21680-induced sleep is characterized by these same changes plus up-regulation of ngfi-b in both regions and increased levels of ngfi-a and nr4a3 in the Hy, none of these changes occur in RS. It is likely that activation of these IEGs is due to the action of these compounds on adenosine A2a signaling pathways. On the other hand, one gene, fra-2, is up-regulated in BF and Hy during PGD2- and CGS21680-induced sleep as well as RS (Fig. 2d and Table 1). The expression of fra-2 in the Cx has been shown to be related to the amplitude of EEG delta power (Wisor et al. 2006), although there is no evidence of elevation of this transcript in the Cx after PGD2 or CGS21680 treatment (Table 1).

PGD2 and A2a signaling and GeneChip® studies

As stated above, the other goal of this study was to identify changes in gene expression that occur after activation of the PGD2 and adenosine A2a signaling pathways that result in sleep induction. Table 1 provides an initial glimpse into these pathways and indicates that such activation is likely to be brain-region specific, as the BF and Hy appear to be more similar in their expression patterns than either region is to the Cx. For a broader assessment, we conducted GeneChip® studies in which we compared the expression of 1322 gene elements during PGD2- and CGS21680-induced sleep across the three brain regions. Figure 4a demonstrates that this general trend holds true for up-regulated genes: the BF and Hy are more similar to each other than either area is to the Cx. However, this appears not to be the case for down-regulated genes (Fig. 4b): about 50% more transcripts are down-regulated in the BF than in either the Hy or Cx. Presumably, this reflects the proximity of the BF to the site of the infusion cannula that targeted the PGD2-SZ in the subarachnoid space.

As illustrated in Tables 2A and B, six genes were up-regulated in all three brain regions in response to both PGD2 and CGS21680 treatment: peripheral-type benzodiazepine receptor, c3, gfap, hsp27, mt-1, and small inducible cytokine subfamily A20. Up-regulation of three of these genes, c3, hsp27, and mt-1, was confirmed in all three regions by TaqMan® analysis (Fig. 5). The PBR is a mitochondrial protein, involved in the regulation of cholesterol transport from the outer to the inner mitochondrial membrane, the rate-determining step in steroid hormone biosynthesis (Papadopoulos 2004). The PBR is highly conserved across the animal kingdom and a PBR-homologous sequence also exists in Arabidopsis. PBRs are involved in a functional structure designated as the mitochondrial permeability transition pore which controls apoptosis (Jorda et al. 2005). The PBR has also been suggested as part of the mitochondrial membrane biogenesis process involved in increased cell proliferation (cancer and gliosis) and tissue repair (nerve damage and ischemia-reperfusion injury). Following various types of nerve injury, reactive gliosis is accompanied by high expression of the PBR, leading to the hypothesis that PBRs can be used as a sensitive marker for CNS injury (Gehlert et al. 1997). Complement component c3 is implicated in the pathogenesis of inflammatory disorders of the CNS such as multiple sclerosis, Alzheimer’s disease, and trauma (Boos et al. 2005). Complement c3 mRNA was up-regulated 2–28 days post-optic nerve crush, indicating local synthesis of complement in the optic nerve (Ohlsson et al. 2003). GFAP is a well-known astrocytic marker and astrocytes proliferate at sites of neural injury. Hsp27 shows a distinctive widespread spatial and temporal pattern of induction in CNS glial and neuronal cells following kainate administration (Akbar et al. 2001). HSP27 mRNA level was increased 2.5-fold in the medial septum and 15-fold in the hippocampus 3 days after fimbria-fornix lesions; this increase persisted for 10 days (Anguelova and Smirnova 2000). Three and 10 days after lesion, HSP27 protein levels were increased in the septum (4.5- and 5-fold, respectively) and hippocampus (65- and 10-fold, respectively). Interestingly, the morphology of the HSP27-positive cells was indistinguishable from that of GFAP-immunoreactive cells (Anguelova and Smirnova 2000), suggesting that these cells are glia. MT-1 and -2 are anti-inflammatory, neuroprotective, antioxidant proteins expressed during experimental autoimmune encephalitis and multiple sclerosis, in which they might play a protective role (Espejo et al. 2005). Several roles for MT action have been described in the CNS, including zinc metabolism, free radical scavenging, and protection and regeneration following neurological injury (Dittmann et al. 2005). According to SwissProt database, GenBank accession AF053312 described above as small inducible cytokine subfamily A20, has several other synonyms including CCL20, macrophage inflammatory protein 3 alpha (MIP-3-alpha), liver and activation-regulated chemokine (CC chemokine), beta chemokine exodus-1, and CC chemokine ST38. CC chemokine ST38 was originally identified through its up-regulation in ischemic brain tissue using a differential display technique (Utans-Schneitz et al. 1998). CCL20 is the only chemokine known to interact with receptor CCR6. Together, this ligand/receptor pair is responsible for the chemoattraction of immature dendritic cells, effector/memory T-cells and B-cells (Schutyser et al. 2003). MIP-3-alpha expression is under the direct control of nuclear factor (NFκB), a key transcription factor of immune and inflammatory responses (Sugita et al. 2002). In relapsing experimental autoimmune encephalitis, the major intracerebral sources of MIP-3-alpha/CCL20 are astrocytes (Ambrosini et al. 2003). Taken together, these results suggest a pattern of gene expression induced in the brain after PGD2 or CGS21680 treatment that is distinct from that previously described during RS after SD (Terao et al. 2006) and may involve glial cell gene activation and the signaling pathways involved in neural–immune interactions. Interestingly, glial cell activation has been observed in previous studies of ‘spontaneous sleep’ (Cirelli et al. 2004).

How do we integrate these results with our current understanding of the role of PGD2 and adenosine in sleep regulation? PGD2 and adenosine, a product of cellular metabolic activity, likely play key roles in the endogenous regulation of sleep, as demonstrated by the profound somnogenic effects evident in Fig. 1. The increases in NREMS and REMS that we observed after intracerebral PGD2 infusion replicate numerous reports that PGD2 induces physiologically normal sleep in a number of mammalian species (Hayaishi 2002; Huang et al. 2007). Sleep induction by intracerebral infusion of two other sleep-inducing factors, interleukin-1, and tumor necrosis factor-alpha (TNFα), may be dependent on the activation of prostaglandin synthesis (Terao et al. 1998a,b; Krueger et al. 2001). TNFα activates the NFκB (Paik et al. 2002), which in turn can activate PGD2 gene expression (Ward et al. 2004). This cascade of events provides a possible mechanism for the induction of sleep by TNFα (Krueger et al. 2001). As the expression of at least one of the genes up-regulated in all three brain regions in response to both PGD2 and CGS21680 treatment, MIP-3-alpha, is also under the direct control of NFκB (Sugita et al. 2002), this molecule may be a nexus of functional significance for cytokine-mediated sleep.

Activation of PGD2 receptors results in an increase in extracellular adenosine levels (Mizoguchi et al. 2001). Administration of a selective A2a-adenosine agonist (CGS21680), but not a selective A1-adenosine agonist (cyclohexyladenosine), results in increased sleep when administered to the PGD2-SZ (Satoh et al. 1996). The sleep-promoting effect of PGD2 was inhibited by pre-treatment with KF17837, a highly selective A2a-adenosine antagonist. Adenosine receptor activation induces NFκB expression (Basheer et al. 2004), providing a means for crosstalk between the adenosinergic and prostaglandin signaling systems. The complex interactions of the adenosine and PGD2 signaling systems may allow for redundancy in sleep regulatory systems, and thus provides an explanation for the relatively modest effects of gene inactivation in either of these two systems on sleep (Mizoguchi et al. 2001; Hayaishi 2002; Hayaishi and Urade 2002; Stenberg et al. 2003; Urade et al. 2003). These interactions also provide a basis for the strong similarities in gene profiles that were observed between PGD2 and CGS21680 treatment groups. The considerable overlap in genes up-regulated or down-regulated by CGS21680 and PGD2– the majority of genes induced by either agent were induced by both – further supports the contention that the effects of both of these agents ultimately converge on the same sleep regulatory pathways in the brain.

In contrast to the up-regulated genes, there was a more limited set of genes that were down-regulated by PGD2 and CGS21680 treatment (Table 3). Although gabra5 was the only transcript down-regulated on the GeneChips® in all three regions by both drugs, this down-regulation in the Cx was not confirmed by TaqMan® analysis (p = 0.08; Fig. 5g) although down-regulation of igf-II was confirmed (Fig. 5f). The alpha5 subunit of the GABAA receptor appears to be necessary for the development of tolerance to the sedative action of diazepam in mice, in contrast to alpha1-GABAA receptors which mediate the acute sedative action of diazepam (van Rijnsoever et al. 2004). IGF-II expression is normally restricted to the mesenchymal support structures of the brain, including the choroid plexus and leptomeninges (DeChiara et al. 1991) where its expression is coincident with that of IGF binding protein-2. In the chronic phase after CNS injury (7–14 days), an increase in both IGF-II mRNA and protein was observed specifically and focally in the marginal astrocytes forming the limiting glial membrane of the wound (Walter et al. 1999).

Comparison to previous GeneChip® studies of RS

Collectively, the current report and a previous report from our laboratory (Terao et al. 2006) have identified genes that are up-regulated in common among three conditions characterized by elevated levels of sleep and slow wave activity: (i) RS after SD, (ii) CGS21680 treatment, and (iii) PGD2 treatment. Given the elevated levels of sleep after these treatments, parallel changes in gene expression might be expected. On the other hand, as CNS concentrations of PGD2 (Ram et al. 1997) and adenosine (Porkka-Heiskanen et al. 1997; Basheer et al. 2004) are elevated during sustained wake (not during sustained sleep), experimentally induced increases in the levels of PGD2 or adenosinergic tone via CGS21680 infusion could induce changes in gene expression similar to those that occur during SD. Indeed, SD-up-regulated genes were more in common with those that were induced by drug treatment (Fig. 6) than were RS-up-regulated genes (Fig. 7), although the numbers are too small to provide firm conclusions. The up-regulation of metallothionein genes encoding metal chelators implicated in ion homeostasis and detoxification (Burdette and Lippard 2003) in Cx by SD, PGD2, and CGS21680 (Table 4A) indicates an effect of all three treatments on the disposition of ionic species in the brain. Sleep may serve to counteract wake-associated changes in ion compartmentalization, as previous studies have postulated (Benington and Heller 1995; Cirelli et al. 2005) and perhaps serves a detoxification role (Inoue et al. 1995).

In our previous report (Terao et al. 2006), we found that BF and Cx were more similar to each other in response to SD than either region was to the Hy. In the current study, changes in gene expression were more similar in comparisons of BF to Hy than in comparisons of either region to Cx by several criteria. First, the number of up-regulated genes was approximately two- to threefold greater in both Hy and BF than in Cx for both treatments (Fig. 4a). Second, up-regulated genes were more common than down-regulated genes in BF and Hy by at least 36%, whereas the numbers of genes up-regulated in the Cx were equal to or fewer than down-regulated genes for CGS21680 and PGD2 treatments, respectively (Fig. 4a vs. b). Third, while well over 20 gene elements were up-regulated in common in BF and Hy by either treatment, fewer than eight were up-regulated in common between Cx and either other region (Table 2). Finally, similarities in the functional categorization of genes affected by PGD2 or CGS21680, as delineated by GeneSpring ontological structure for gene categorization (Ashburner et al. 2000; Cirelli et al. 2004), are more common in comparisons between BF and Hy than in comparisons involving Cx (Table 5). Genes associated with induced cell growth (e.g. the immediate early serum-responsive JE gene and signal transducer and activator of transcription 3) or cell death (e.g. TNF receptor superfamily, member 1a and caspase 1) make up more than one-third of up-regulated transcripts in both BF and Hy in both treatment groups but less than one quarter of such transcripts in Cx.

Table 5.   Percent of genes in each functional category whose mRNA expression levels were changed by at least 50% after PGD2 or CGS21680 infusion
Biological process categoryNumber of genes on chipPercentage genes on chip% of mRNAs up-regulated by PGD2% of mRNAs up-regulated by CGS21680
BF (n = 86)Cx (n = 32)Hy (n = 92)BF (n = 116)Cx (n = 40)Hy (n = 70)
Cell Adhesion393635756
Cell maintenance, growth, and death49037512237452339
Neurotransmission29022199131786
Intracellular Signal132107611101
Physiology292334334
Other34226145639166344
   % of mRNAs down-regulated by PGD2% of mRNAs down-regulated by CGS21680
BF (n = 63)Cx (n = 42)Hy (n = 39)BF (n = 77)Cx (n = 40)Hy (n = 43)
Cell adhesion393200332
Cell maintenance, growth, and death49037333141344533
Neurotransmission29022302621223826
Intracellular signal132108101310512
Physiology292020052
Other3422627312631526

The similarity of measurements from BF and Hy in the current study may be a consequence of the infusion site. Infusions were delivered into the subarachnoid space, which is bordered by the BF, ventral Hy and only a small portion of the Cx. Thus, absent any widespread diffusion of PGD2 or CGS21680 in the ventricular system, the bulk of the direct physiological response to infusions would be expected to occur in BF and Hy. In addition, the sleep-promoting efficacy of adenosinergic agents (Satoh et al. 1999) and PGD2 (Matsumura et al. 1994) are greatest when they are targeted to the vicinity of BF and Hy. Therefore, the molecular response to PGD2 and CGS21680 might be expected to be most robust within BF and Hy. In contrast, any changes in gene expression in the Cx are likely to be secondary to the direct effects of these soporific agents on BF and Hy.

Limitations of the present study

Several limitations should be acknowledged in comparison of the present data with that from our previous study (Terao et al. 2006). First, the rats in the RS group (Terao et al. 2006) were instrumented only for EEG/EMG recording, whereas the rats in the PGD2- and CGS21680-treated groups were also prepared with intraparenchymal cannulae. Second, all animals (experimentals and controls) in the PGD2- and CGS21680-infusion experiment experienced an infusion during the experimental period, whereas the RS group did not. Third, the current study required no direct interactions between the experimenter and subjects during the experimental session (other than the moment when animals were killed) as infusions were performed remotely, whereas SD by gentle handling requires interaction between experimenter and subject. The differences between these two protocols in the amount of locomotor activity, stress, and sensory input experienced by the subjects are therefore not trivial. Also, the RS group was killed at ZT8 during the lights-on period, whereas the PGD2- and CGS21680-treated groups were killed at ZT14 during the dark period. The RS began at a time of day (ZT6) when the propensity to sleep is high, but sleep need (as reflected in EEG delta power and sleep consolidation) is low and approaching its daily nadir. On the other hand, at the time when PGD2 and CGS21680-infused rats were killed (ZT14), sleep propensity is low because of the circadian waking signal but, in control rats, sleep need is increasing because of the fact that rats are mostly awake between ZT12 and 14. Lastly, the amount of sleep differed between these groups: in the RS group, sleep duration increased approximately 16% whereas sleep duration doubled during either pharmacological treatment in the present study.

Other limitations apply to the molecular approaches used in the present study. First, the GeneChip® results reported here are based on replicate pooled samples from each brain region in each treatment condition and, thus, rigorous statistical analysis of the GeneChip® data was not possible. On the other hand, follow-up TaqMan® analyses of individual brain samples (Fig. 5) confirmed significant variation because of experimental treatment in 19 of the 21 comparisons (7 genes × 3 brain regions). Secondly, our analyses are based on brain regions and, consequently, may not have revealed nucleus- or cell type-specific changes in gene expression. Thirdly, the 50% threshold for inclusion of a gene in further analyses was arbitrary with no particular biological significance; there is no guarantee that a two- or threefold change has any biological meaning or that an expression change < 50% is not meaningful. The 50% criterion was chosen to be as inclusive as possible, although it is recognized that there are likely to be more false positives in the gene lists than there would be if the criterion were a threefold change. On the other hand, a more stringent criterion would increase the likelihood of false negatives, which would render screening by GeneChip® of limited utility. Fourth, most of our attention in the analyses has focused on genes that are commonly up- or down-regulated in all three brain regions. Our logic for this focus was based on the assumption that mRNAs that are particularly important in mediating the response to PGD2 or CGS21680 are likely to have altered expression throughout the brain. However, as discussed above, Table 1 and Fig. 4 indicate that the BF and Hy may be more similar than the Cx with respect to up-regulated genes whereas the Cx and Hy may be more similar than the BF with respect to down-regulated genes. Lastly, it should be noted that the present analyses are based on transcript levels whereas the great majority of important cellular activity is mediated at the protein level.

Acknowledgements

This research work was supported by NIH RO1 HL/MH59658 and by a Grant from the Genome Network Project from the Ministry of Education, Culture, Sports, Science and Technology, Japan.

Ancillary