SEARCH

SEARCH BY CITATION

Keywords:

  • antipsychotics;
  • astrocyte;
  • inflammation;
  • microglia;
  • neuroprotection;
  • spiperone

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Glial activation and neuroinflammatory processes play an important role in the pathogenesis of neurodegenerative diseases such as Alzheimer’s disease, Parkinson’s disease, and HIV dementia. Activated glia cells can secrete various proinflammatory cytokines and neurotoxic mediators, which may influence neuronal cell survival. Recent studies have demonstrated that glia cell-mediated neuroinflammation is also related to the pathophysiology of schizophrenia. In the present study, anti-inflammatory and neuroprotective effects of antipsychotics were investigated using cultured brain cells as a model. The results showed that spiperone significantly decreased the production of nitric oxide in lipopolysaccharide-stimulated BV-2 microglia cells, primary microglia and primary astrocyte cultures. Spiperone also significantly inhibited nitric oxide production in adenosine 5′-triphosphate (ATP)-stimulated primary microglia cultures. Spiperone markedly decreased the production of tumor necrosis factor-alpha in BV-2 microglia cells. Spiperone attenuated the expression of inducible nitric oxide synthase and proinflammatory cytokines such as interleukin-1β and tumor necrosis factor-alpha at mRNA levels in BV-2 microglia cells. Spiperone inhibited nuclear translocation and DNA binding of the p65 subunit of nuclear factor kappa B (NF-κB), inhibitor of kappa B (IκB) degradation, and phosphorylation of p38 mitogen-activated protein kinase in the lipopolysaccharide-stimulated BV-2 microglia cells. Moreover, spiperone was neuroprotective, as the drug reduced microglia-mediated neuroblastoma cell death in the microglia/neuron co-culture. These results imply that the antipsychotic spiperone has anti-inflammatory and neuroprotective effects in the central nervous system by modulating glial activation.

Abbreviations used
EGFP

enhanced green fluorescent protein

HAPI

highly aggressive proliferating

IFN

interferon

IκB

inhibitor of kappa B

IL

interleukin

iNOS

inducible nitric oxide synthase

LPS

lipopolysaccharide

NF-κB

nuclear factor kappa B

NO

nitric oxide

PBS

phosphate-buffered saline

TNF-α

tumor necrosis factor-α

Neuroinflammation is actively involved in the pathogenesis of several neurodegenerative diseases such as Alzheimer’s disease, Parkinson’s disease, multiple sclerosis, and HIV-associated dementia (Block et al. 2007). Neuroglia including microglia and astrocytes are non-neuronal cells that play an important role in the homeostatic control of the neuronal extracellular environment (Chen and Swanson 2003). Microglia, which constitute about 10% of all glial cells, participate in the innate immunity in the brain, and they are also considered as the major cell type responsible for inflammation-mediated neurotoxicity (Liu and Hong 2003). Activation of microglia is observed after the exposure to lipopolysaccharide (LPS), interferon (IFN)-γ, β-amyloid or adenosine 5′-triphosphate (ATP). Activated microglia have the capability of secreting proinflammatory cytokines and neurotoxic mediators such as tumor necrosis factor-α (TNF-α), prostaglandin E2, interleukin (IL)-1β, IL-6, and free radicals such as nitric oxide (NO) and superoxide anion (Giulian et al. 1994; Zielasek and Hartung 1996). These proinflammatory cytokines and neurotoxic mediators are thought to contribute to neuronal injury and pathogenesis of the neuroinflammatory diseases (Minghetti and Levi 1998; Gonzalez-Scarano and Baltuch 1999). Over-activation of astrocytes also facilitates ongoing neurodegeneration by producing various neurotoxic factors such as NO and TNF-α (Suk 2005; Farina et al. 2007).

Although the pathological mechanisms of schizophrenia remain unclear, there is growing evidence that neuroinflammation is related to pathophysiology of schizophrenia (Steiner et al. 2006; Kato et al. 2007). Activation or increased number of microglia has been observed in postmortem brain of patients with schizophrenia (Bayer et al. 1999; Radewicz et al. 2000; Steiner et al. 2008). An increased microglia activation was also found in brain of patients with schizophrenia using technique of positron emission tomography with [11C] PK11195 radioligand, which specifically binds to the peripheral benzodiazepine-binding site (van Berckel et al. 2005,Cagnin et al. 2006). Recent studies have suggested that abnormal inflammatory and immune responses are also associated with pathogenesis of schizophrenia (Bernstein et al. 2005; Drzyzga et al. 2006). The beneficial effect of anti-inflammatory drugs celecoxib and minocycline, which are potent inhibitors of microglia activation, has been reported in patients with schizophrenia (Akhondzadeh et al. 2007; Miyaoka et al. 2007). Taken together, as inflammatory activation of microglia is actively involved in the pathogenesis of several neurodegenerative diseases and psychiatric disorders, inhibition of glial activation and subsequent neuroinflammation may be an effective therapeutic approach against these diseases.

Antipsychotics are broadly divided into two groups, the typical or first-generation antipsychotics and the atypical or second-generation antipsychotics. Haloperidol, chlorpromazine, and spiperone belong to the typical antipsychotics, while clozapine, rimcazole, and olanzapine belong to the atypical antipsychotics. Almost all antipsychotics have a property that antagonizes dopamine D2 receptor and subsequently blocks dopamine pathway in brain (Ereshefsky 1999). Recently, several studies have demonstrated that antipsychotic drugs have an effect that is related to the modulation of inflammatory responses (Drzyzga et al. 2006). Olanzapine reduced NO production in LPS-stimulated N9 microglia cells (Hou et al. 2006). Atypical antipsychotics such as risperidone, perospirone, ziprasidone, quetiapine, and aripprazole significantly suppressed IFN-γ or LPS-induced NO or TNF-α production in murine 6-3 microglia cells (Kato et al. 2007, 2008; Bian et al. 2008). Flupentixol and trifluperidol reduced the IL-1β, IL-2, TNF-α and NO release in LPS-stimulated mixed glia and microglia cultures (Kowalski et al. 2003, 2004). It has been also reported that chlorpromazine and loxapine reduced LPS-induced IL-1β and IL-2 secretion in rat mixed glia and microglia cultures (Labuzek et al. 2005).

Although previous studies have demonstrated anti-inflammatory effects of antipsychotics in glia, the detailed molecular mechanisms underlying the anti-inflammatory effects are not completely understood. Furthermore, effects of antipsychotics on glial neurotoxicity have not been investigated. Here, the effect of several antipsychotics on the inflammatory activation and neurotoxicity of microglia, as well as astrocytes, has been determined. This study showed that spiperone and olanzapine inhibited LPS-induced production of NO, TNF-α, and their gene expression in microglia. Particularly, a butyrophemone derivative spiperone suppressed NF-κB and p38 MAPK activation in LPS-stimulated microglia cells. The anti-inflammatory effect of spiperone was also found in astrocytes and macrophage. Lastly, spiperone showed neuroprotective effect by attenuating microglia neurotoxicity in a microglia-neuroblastoma co-culture model.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Reagents and cell cultures

Bacterial lipopolysaccharide (LPS) (E. coli serotype 055:B5), adenosine 5′-triphosphate disodium salt, spiperone, haloperidol, olanzapine, rimcazole, chlorpromazine, clozapine, SB203580 (4-(4-fluorophenyl)-2-(4-methylsulphinylphenyl)-5-(4-pyridyl) imidazole), and PDTC (pyrrolidinecarbodithoic acid) were purchased from Sigma-Aldrich (St. Louis, MO, USA). The drugs were dissolved in phosphate-buffered saline (PBS; 150 mM NaCl, 5 mM phosphate, pH 7.4). Recombinant mouse IFN-γ was purchased from R&D Systems (Minneapolis, MN, USA). A BV-2 murine microglia cell line (Bocchini et al. 1992) was grown and maintained in Dulbecco’s modified Eagle’s medium supplemented with 5% heat-inactivated fetal bovine serum, gentamicin (50 μg/mL) at 37°C, 5% CO2. B35 rat neuroblastoma (ATCC, CRL-2754) (Schubert et al. 1974), highly aggressive proliferating (HAPI) rat microglia (Cheepsunthorn et al. 2001), and RAW 264.7 macrophage cell lines (ATCC, TBI-71) were grown and maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% heat-inactivated fetal bovine serum, penicillin (10 U/mL) and streptomycin (10 μg/mL) at 37°C, 5% CO2. Mouse primary microglia and astrocytes cultures were prepared by mild trypsinization as described previously with minor modifications (Saura et al. 2003). In brief, the forebrains of newborn Institute of Cancer Research mice were chopped and dissociated by mechanical disruption using a nylon mesh. The cells were seeded in poly d-lysine-coated flasks. After in vitro culture for 10–14 days, microglia cells were isolated from mixed glia cultures by mild trypsinization. Mixed glia cultures were incubated with a trypsin solution (0.25% trypsin, 1 mM EDTA in Hank’s balanced salt solution) diluted 1 : 4 in PBS containing 1 mM CaCl2 for 30–60 min. This resulted in the detachment of an upper layer of astrocytes in one piece, whereas microglia remained attached to the bottom of the culture flask. The detached layer of astrocytes was aspirated, and the remaining microglia were used for experiments. The prepared primary microglia cultures were more than 95% pure, as determined by isolectin B4 staining (data not shown). Astrocytes were isolated by shaking mixed glia cultures at 250 rpm overnight and then the culture medium was discarded. The purity of astrocyte cultures was greater than 95% as determined by glial fibrillary acidic protein immunocytochemical staining (data not shown). Animals used in the current research were acquired and cared for in accordance with the guidelines published in the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The study was approved by Institutional Review Board of Kyungpook National University School of Medicine.

Cell viability test

Cell viability was determined by 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. Microglia, astrocytes or RAW 264.7 macrophages were seeded in triplicate at the density of 8 × 104 cells/well on 96-well plate. The cells were treated with spiperone and LPS for 24 h. 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide was added to each well and incubated for 4 h at 37°C. After culture media were discarded, dimethyl sulfoxide was added to dissolve the formazan dye. The optical density was measured at 540 nm.

Nitrite quantification

NO secreted in glial culture supernatants was measured by Griess reagent as described (Lee and Suk 2007). After microglia, astrocytes, or RAW 264.7 macrophages were treated with stimulating agents in 96-well plates, NO2 concentration in culture supernatants was measured to assess NO production. Fifty microliters of sample aliquots were mixed with 50 μL of Griess reagent (1% sulfanilamide/0.1% naphthylethylene diamine dihydrochloride/2% phosphoric acid) in a 96-well plate and incubated at 25°C for 10 min. The absorbance at 550 nm was measured on a microplate reader. NaNO2 was used as the standard to calculate NO2 concentrations.

Enzyme-linked immunosorbent assay

Tumor necrosis factor-α secreted in microglial culture supernatants was measured as described (Zheng et al. 2008) by specific enzyme-linked immunosorbent assay (ELISA) using rat monoclonal anti-mouse TNF-α antibody as capture antibody and goat biotinylated polyclonal anti-mouse TNF-α antibody as detection antibody (ELISA development reagents; R&D Systems). The biotinylated anti-TNF-α antibody was detected by sequential incubation with streptavidin-horseradish peroxidase conjugate and chromogenic substrates.

Reverse transcription-polymerase chain reaction

Total RNA was isolated using TRIzol reagent (Molecular Research Center Inc, Cincinnati, OH, USA) according to the manufacturer’s instruction. Reverse transcription was carried out using a Moloney murine leukemia virus and oligo(dT) primer. PCR amplification using primer sets specific for inducible nitric oxide synthase (iNOS), TNF-α, IL-1β or β-actin was carried out at 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, and repeated 23 cycles followed by incubation at 72°C for 7 min. Nucleotide sequences of the primers were based on published cDNA sequences of mouse iNOS, TNF-α, IL-1β, or β-actin: iNOS forward, CCCTTCCGAAGTTTCTGGCAGCAGC; iNOS reverse, GGCTGTCAGAGCCTCGTGGCTTTGG; TNF-α forward, CATCTTCTCAAAATTCGAGTGACAA; TNF-α reverse, ACTTGGGCAGATTGACCTCAG; IL-1β forward, GCAACTGTTCCTGAACTC; IL-1β reverse, CTCGGAGCCTGTAGTGCA; β-actin forward, ATCCTGAAAGACCTCTATGC; β-actin reverse, AACGCAGCTCAGTAACAGTC. The β-actin was used as an internal control to evaluate relative expression of iNOS, TNF-α and IL-1β.

Immunofluorescence assay

For the detection of the intracellular location of p65 subunit of NF-κB, BV-2 microglia cells (1 × 105 cells/well in 24-well plates) were cultured on sterile cover slips in 24-well plates and treated with drugs and LPS. At 1 h after the LPS stimulation, the cells were fixed with methanol for 20 min at −20°C and washed with PBS for 5 min. The fixed cells were then permeabilized with 0.5% Triton X-100 in PBS for 1 h at 25°C, washed with 0.05% Tween-20 in PBS for 10 min and 0.05% Tween-20/1% bovine serum albumin in PBS for 5 min. The permeabilized cells were then treated with 1 μg/mL of mouse monoclonal anti-human NF-κB p65 (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) for 1 h at 25°C, washed with 0.05% Tween-20/1% bovine serum albumin in PBS for 5 min. Cells were then incubated in a 1 : 2000 dilution of Alexa Fluor 488-labeled goat anti-mouse IgG antibody (Molecular Probes Inc., Eugene, OR, USA) for 1 h at 25°C, and washed with 0.05% Tween-20 in PBS for 5 min and PBS for 5 min. Cells were then stained with 0.5 μg/mL of Hoechst staining solution (Molecular Probes) for 20 min at 37°C and then washed. Finally, the cover slips with cells were dried in a 37°C oven for 45 min and mounted in a 1 : 1 mixture of xylene and malinol. The number of cells with p65 nuclear translocation was determined under a fluorescence microscope. More than 100 cells with p65 translocation were counted.

Electrophoretic mobility shift assay

Nuclear extracts from control or drug-treated BV-2 cells were prepared as described previously (Woo et al. 2003). Nuclear extracts (5 μg) were mixed with double-stranded NF-κB oligonucleotide, which was end-labeled with [γ-32P] dATP. The binding reaction was performed at 37°C for 30 min in 30 μL of reaction buffer containing 10 mM Tris–HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 4% glycerol, 1 μg of poly(dI–dC) and 1 mM dithiothreitol. For the supershift assay, antibody against the p65 subunit of NF-κB (Santa Cruz Biotechnology) was co-incubated with nuclear extracts in the reaction mixture for 30 min at 4°C before adding the radiolabeled probe. The specificity of binding was examined by competition with the 80-fold unlabeled oligonucleotide. DNA–protein complexes were separated from the unbound oligonucleotide probe on native 5% polyacrylamide gels at 180 V in 0.5 × Tris Boric acid EDTA buffer. Gels were vacuum dried for 1 h at 80°C and exposed to X-ray film at −70°C for 24 h.

Western blot analysis

Cells were lysed in triple-detergent lysis buffer [50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.02% sodium azide, 0.1% sodium dodecyl sulfate, 1% Nonidet (Sigma, St. Louis, MO, USA) P-40, 0.5% sodium deoxycholate, 1 mM phenylmethylsulfonyl fluoride]. Protein concentration in cell lysates was determined using a protein assay kit (Bio-Rad, Hercules, CA, USA). An equal amount of protein from each sample was separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (12% gel) and transferred to Hybond ECL nitrocellulose membranes (Amersham Biosciences, Piscataway, NJ, USA). The membranes were blocked with 5% skim milk and sequentially incubated with primary antibodies [rabbit polyclonal anti-human IκB-α (Santa Cruz Biotechnology), rabbit polyclonal anti-human phospho-p38 MAPK (Cell Signaling Technology Inc., Beverly, MA, USA), monoclonal anti-α-tubulin clone B-5-1-2 mouse ascites fluid (Sigma)] and horseradish peroxidase-conjugated secondary antibodies (anti-rabbit and anti-mouse; Amersham Biosciences) followed by enhanced chemiluminescence detection (Amersham Biosciences).

Microglia/neuroblastoma co-culture

For the co-culture experiment, BV-2 microglia cells, HAPI rat microglia cells, or primary microglia cells were seeded in triplicate at the density of 1.5 × 104 cells/well in 96-well plate. Microglia cells were pre-treated with drugs for 30 min. Then, culture supernatants were discarded and 100 ng/mL of LPS was added together with B35 rat neuroblastoma cells stably expressing enhanced green fluorescent protein (EGFP) (3.75 × 104 cells/well), which was followed by the co-culture for 24 h. The numerical ratio of microglia to neuron was 1 : 2.5. Afterwards, the EGFP-positive cells were counted under a fluorescence microscope (Olympus IX 70, Tokyo, Japan). Images of three random fields per well were captured and analyzed by the MetaMorph imaging system (Universal Imaging Corp, West Chester, PA, USA). LPS alone did not affect B35 neuroblastoma cell viability (data not shown).

Statistical analysis

Results were expressed as mean ± SD. The data were analyzed by one-way anova and the Student-Newman-Keul’s post hoc analysis using SPSS program (version 12.0; SPSS Inc., Chicago, IL, USA). A value of < 0.01 was considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Inhibitory effects of antipsychotics on NO and TNF-α production in microglia

First, the effects of various antipsychotic drugs (7.5–30 μM) on NO production in LPS-stimulated BV-2 mouse microglia cell line were evaluated (Fig. 1a). Among the antipsychotics tested, spiperone (15, 30 μM), haloperidol (30 μM), rimcazole (15, 30 μM), chlorpromazine (15, 30 μM), olanzapine (15, 30 μM), and clozapine (15, 30 μM) strongly reduced LPS-induced NO production in the microglia cells. In order to rule out the possibility that the reduction of NO production may be because of the cytotoxicity of the drugs, cell viability was evaluated (Fig. 1b). Haloperidol (15, 30 μM), chlorpromazine (15, 30 μM), rimcazole (30 μM), and clozapine (15, 30 μM) showed a significant toxicity to BV-2 microglia cells, indicating that the NO inhibitory effects of these drugs were because of the cytotoxicity. Thus, spiperone and olanzapine inhibited microglial NO production in a dose-dependent manner without a significant cytotoxicity (Fig. 1a and b). The inhibitory effect of olanzapine on microglial NO production was consistent with a previous study (Hou et al. 2006). Further studies were focused on spiperone, whose anti-inflammatory effect has not been investigated. Effects of spiperone on NO production in LPS-stimulated primary microglia cultures or HAPI rat microglia cells were next evaluated. As shown in Fig. 2(a) and (b), the LPS-induced NO production was decreased by spiperone in mouse primary microglia cultures and HAPI rat microglia cells, indicating that the NO inhibitory effect of spiperone is not limited to BV-2 cells. Spiperone at the concentration tested did not affect the viability of primary microglia cultures or HAPI microglia cells (data not shown). The NO inhibitory effect of spiperone was also tested in ATP- or β-amyloid-stimulated primary microglia cultures. As shown in Fig. 2(c), the ATP-induced NO production was decreased by spiperone in the primary microglia cultures. These result indicated that the anti-inflammatory activity of spiperone is not limited to LPS stimulation. The β-amyloid peptide (0.1–10 μM) did not induce NO production in the mouse primary microglia cultures in our hand (data not shown). The anti-inflammatory activity of spiperone was further studied by evaluating the effect of the drug on the production of another inflammatory mediator TNF-α. Spiperone also decreased TNF-α production in LPS-stimulated BV-2 microglia cells (Fig. 3).

image

Figure 1.  Effects of antipsychotic drugs on NO production in LPS-activated BV-2 mouse microglia cells. BV-2 microglia cells (8 × 104 cells per well in a 96-well plate) were incubated with 100 ng/mL of LPS in the presence or absence of antipsychotics (7.5–30 μM) for 24 h. The amounts of nitrite in the supernatants were measured using Griess reagent (a). Cell viability was determined by MTT reduction assays and the results were expressed as the percentage of surviving cells over control cells (b). The data were expressed as the mean ± SD (= 3), and are representative of results obtained from three independent experiments. *< 0.01; significantly different from the value in cells treated with LPS only.

Download figure to PowerPoint

image

Figure 2.  Effects of spiperone on NO production in the mouse primary microglia cultures or HAPI rat microglia cell line. Mouse primary microglia cultures (a, c) or HAPI rat microglia cells (b) (8 × 104 cells per well in a 96-well plate) were incubated with 100 ng/mL of LPS (a, b) or 2 mM of ATP (c) in the presence or absence of spiperone (30 μM) for 24 h. The amounts of nitrite in the supernatants were measured using Griess reagent. The values were expressed as a percentage of concentration in control group (none), which was set to 100%, and the data were expressed as the mean ± SD (= 3), and are representative of results obtained from three independent experiments. *< 0.01; significantly different from the value in cells treated with LPS only.

Download figure to PowerPoint

image

Figure 3.  Effects of spiperone on TNF-α production in LPS-stimulated BV-2 microglia cells. BV-2 microglia cells (8 × 104 cells per well in a 96-well plate) were incubated with 100 ng/mL of LPS in the presence or absence of spiperone (30 μM) for 24 h. The amounts of TNF-α in the supernatants were measured by ELISA. The data were expressed as the mean ± SD (= 3), and are representative of results obtained from three independent experiments. *< 0.01; significantly different from the value in cells treated with LPS only.

Download figure to PowerPoint

Spiperone inhibited the expression of iNOS, IL-1β, and TNF-α genes

In order to investigate the effects of spiperone on the gene expression of inflammatory mediators at the transcriptional level, the levels of iNOS, IL-1β, and TNF-α mRNA in the LPS-stimulated BV-2 microglia cells were determined by RT-PCR analysis. Spiperone inhibited the LPS-induced expression of iNOS, IL-1β, and TNF-α (Fig. 4).

image

Figure 4.  Effects of spiperone on iNOS and proinflammatory cytokine gene expression in LPS-simulated BV-2 microglia cells. BV-2 cells were treated with LPS (100 ng/mL) in the absence or presence of spiperone (30 μM), and total RNA was isolated at 6 h after the treatment. The levels of iNOS, IL-1β, and TNF-α mRNA were determined by RT-PCR with several dilutions (1 : 1, 1 : 2, or 1 : 4) of cDNA templates. β-actin was used as an internal control. The result is representative of three independent experiments.

Download figure to PowerPoint

Spiperone attenuated the LPS-induced NF-κB and p38 MAPK activation

NF-κB and p38 MAPK are key upstream regulators that induce proinflammatory cytokines and iNOS gene expression in glia cells (Jongeneel 1995; Da Silva et al. 1997) Therefore, it was determined whether the anti-inflammatory effects of the spiperone occurred through the blockade of NF-κB and p38 MAPK activation in BV-2 microglia cells. The processes of NF-κB activation include IκB degradation, a subsequent nuclear translocation of p65 subunit of NF-κB, and DNA binding of p65. LPS induced the translocation of p65 into the nucleus within 60 min after the stimulation, which was inhibited by spiperone as determined by an immunofluorescence assay (Fig. 5a) and subsequent enumeration of the cells with p65 translocation (Fig. 5b). Spiperone also inhibited LPS-induced DNA binding activity of NF-κB as determined by electrophoretic mobility shift assay (EMSA) (Fig. 5c). Western blot analysis further showed that degradation of IκB-α after 30 min stimulation with LPS, which was markedly inhibited by spiperone (Fig. 5d). After stimulation of BV-2 microglia cells with LPS for 30 min, activation of p38 MAPK was also observed as evidenced by western blot analysis using antibody specific for phospho-p38 MAPK. Spiperone significantly inhibited the phosphorylation of p38 MAPK (Fig. 5d). The effect of PDTC (NF-κB specific inhibitor) and SB203580 (p38 MAPK specific inhibitor) on NO production was examined in LPS-stimulated BV-2 microglia cells. As shown in Fig. 5(e), both PDTC (10 μM) and SB203580 (10 μM) significantly reduced LPS-induced NO production. These results indicated that the spiperone suppressed LPS-induced NF-κB and p38 MAPK activation in microglia, and that the inhibition of iNOS, IL-1β, and TNF-α gene expression by the spiperone was likely because of the blockade of NF-κB and p38 MAPK pathways.

image

Figure 5.  Blockade of NF-κB activation and p38 MAPK phosphorylation by spiperone. The BV-2 microglia cells were seeded at the density of 1 × 106 cells/well in a 6-well plate. The cells were stimulated with 100 ng/mL of LPS in the absence or presence of spiperone (30 μM) that had been added 30 min before the stimulation. At 1 h after the LPS addition, subcellular location of NF-κB p65 subunit was determined by an immunofluorescence assay. The p65 protein was detected using anti-p65 antibody conjugated with fluorescein isothiocyanate (FITC). Representative images of cells are shown (left) (a). Magnification, ×200; scale bar, 50 μm. Boxed rectangular regions were enlarged (right) (a). The number of cells with p65 nuclear translocation was determined and the percentage of cells with p65 translocation was calculated: more than 100 cells were counted (b). EMSA analysis of the nuclear extracts was conducted using a [32P]-labeled NF-κB oligonucleotide probe. Binding specificity was determined by supershift assay or using the unlabeled probe containing the NF-κB binding sequence to compete with the labeled oligonucleotide (c). Total cell lysates obtained 15, 30 and 60 min after the LPS stimulation were subjected to western blotting to assess the levels of IκB-α or phospho-p38 MAPK proteins (upper) (d). Quantification of IκB-α or phospho-p38 protein levels was performed by densitometric analysis (lower) (d). Detection of α-tubulin or total p38 was done to confirm the equal loading of the samples. The values were expressed as a percentage of maximal band intensity in the BV-2 cells treated with LPS alone, which was set to 100% (lane 3). BV-2 microglia cells (8 × 104 cells/well in a 96-well plate) were incubated with 100 ng/mL of LPS in the presence or absence of PDTC (10 μM) or SB203580 (10 μM) for 24 h. The amounts of nitrite in the supernatants were measured using Griess reagent (e). The data are the mean ± SD (= 3), and are representative of three or more independent experiments. *< 0.01; significantly different from the value in cells treated with LPS only.

Download figure to PowerPoint

Spiperone inhibited microglial neurotoxicity in a microglia/neuroblastoma co-culture model

To investigate potential neuroprotective effects of spiperone in vitro, a microglia/neuroblastoma co-culture model was used. As various proinflammatory mediators produced by activated microglia can induce neuronal cell death and amplify progression of neuronal degeneration (Stoll and Jander 1999; Streit et al. 1999), inhibition of microglial activation may be neuroprotective. Thus, microglial neurotoxicity and neuroprotective effects of a compound can be tested in a microglia and neuron co-cultures, where activated microglia may induce neuronal cell death. A compound can be considered neuroprotective, if it protects neuroblastoma cells against the cytotoxic effect of activated microglia in the co-culture of microglia and neuroblastoma cells. This possibility was tested for spiperone using a co-culture of B35 neuroblastoma cells with LPS-activated BV-2 microglia cells or primary microglia cultures. B35 neuroblastoma cells that have been stably transfected with EGFP expression construct were employed for the simple identification of neuroblastoma cells in the co-culture. BV-2 microglia cells or primary microglia cultures were activated with LPS plus or minus pre-treatment with spiperone, and then co-cultured with B35 neuroblastoma cells (see Fig. 6a for the co-culture scheme). The viability of B35 cells was measured by counting the EGFP-expressing cells after the co-culture under a fluorescence microscope, because B35 cells stably expressed EGFP. This co-culture system has been successfully used for the determination of microglial neurotoxicity (Kim et al. 2007). Spiperone significantly inhibited B35 cell death in the co-culture (Fig. 6b–d). The neuroprotective effect of spiperone was also examined in the co-culture of HAPI rat microglia cells and B35 rat neuroblastoma cells. A similar result of neuroprotection was obtained (data not shown). The results indicate that spiperone may be neuroprotective by suppressing microglial neurotoxicity.

image

Figure 6.  Effects of spiperone on B35 rat neuroblastoma cell viability in a microglia-neuron co-culture. The BV-2 microglia cells or primary microglia cells were seeded in triplicate at the density of 1.5 × 104 cells/well in a 96-well plate. Microglia cells were pre-treated with spiperone (30 μM) for 30 min. Culture supernatants were discarded and stimulated with 100 ng/mL of LPS. At the same time, rat B35 neuroblastoma cells (3.75 × 104 cells/well) stably expressing EGFP were added onto BV-2 cells (c) or primary microglia cells (d), and then co-cultured for 24 h (a). After the co-culture of BV-2 and B35 cells for 24 h, the EGFP-positive cells were counted under a fluorescence microscope to evaluate B35 neuroblastoma cell death (b). Representative images of cells are shown (magnification, ×100); scale bar, 100 μm. The number of fluorescent cells in several randomly chosen microscopic fields per well was determined, and the data were expressed as the mean ± SD (= 3) (c, BV-2+ neuroblastoma; d, primary microglia + neuroblastoma). The data were expressed as the mean ± SD (= 3), and are representative of results obtained from three independent experiments. *< 0.01; significantly different from the value in cells treated with LPS only.

Download figure to PowerPoint

Effects of spiperone on the inflammatory activation of macrophages and primary astrocyte cultures

Effects of spiperone the NO production in RAW 264.7 macrophage cells and primary astrocyte cultures were tested. Spiperone significantly decreased NO production in LPS-stimulated RAW 264.7 macrophage cells (Fig. 7a) and primary astrocyte cultures (Fig. 7b). When astrocytes were stimulated with LPS plus IFN-γ, greater amounts of NO production were achieved, which were similarly inhibited by spiperone (Fig. 7c). These results indicated that spiperone has anti-inflammatory effects in peripheral macrophages and astrocytes as well.

image

Figure 7.  Effects of spiperone on NO production in RAW 264.7 macrophage cells or primary astrocyte cultures. Either RAW 264.7 macrophage cells or primary astrocyte cultures (8 × 104 cells/well in a 96-well plate) were incubated with 100 ng/mL of LPS or LPS/IFN-γ (50 Unit/mL) in the presence or absence of spiperone (30 μM) for 24 h. The amounts of nitrite in the supernatants were measured using Griess reagent (a, RAW 264.7 cells; b and c, primary astrocyte cultures). The data were expressed as the mean ± SD (= 3), and are representative of results obtained from three independent experiments. *< 0.01; significantly different from the value in cells treated with LPS only.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

In the present study, it has been demonstrated that antipsychotics such as spiperone and olanzapine inhibit inflammatory activation of glia cells. Particularly, spiperone significantly reduced NO or TNF-α production in LPS-stimulated microglia cell lines, primary microglia and astrocyte cultures. The RT-PCR analysis showed that spiperone markedly suppressed the iNOS, TNF-α, and IL-1β gene expression at the transcriptional level in BV-2 microglia cells. NF-κB and p38 MAPK pathways were at least partly involved in the anti-inflammatory mechanisms of spiperone in BV-2 cells. In addition, spiperone showed neuroprotective effects by attenuating microglial neurotoxicity in a microglia-neuron co-culture.

Activation of microglia is related to disease progression and pathology in several neurodegenerative diseases such as Alzheimer’s disease, Parkinson’s disease, and HIV dementia (Block et al. 2007). Recent studies have reported that microglia activation is also closely related to pathogenesis of schizophrenia (Muller and Ackenheil 1998; Bayer et al. 1999; Radewicz et al. 2000; Steiner et al. 2008). Under the neurodegenerative conditions, microglia are activated and release various inflammatory mediators including proinflammatory cytokines and free radicals such as NO and superoxide anion (Aloisi 2001). Because NO is one of the main proinflammatory mediators and plays an important role in neuroinflammatory diseases, the effects of the antipsychotics on the NO production in LPS-stimulated microglia cells were examined. Spiperone and olanzapine markedly reduced NO production in LPS-simulated microglia cells without a significant cytotoxicity (Fig. 1). TNF-α is another major proinflammatory mediator, which plays an important role in the process of neuroinflammatory diseases (Jongeneel 1995). Our results showed that the spiperone also inhibited TNF-α production in LPS-stimulated BV-2 microglia cells. These results are consistent with previous reports where olanzapine decreased NO and TNF-α production in rat primary microglia or N9 microglia cells (Wilms et al. 2003; Hou et al. 2006). In the subsequent studies that focused on spiperone, a strong inhibitory effect of the drug on the inflammatory gene expression and inflammatory signaling pathways was found. Spiperone, an antagonist of dopamine D2 receptor and serotonin 5-HT1A/5-HT2A receptor, is widely used as a pharmacological tool. Especially, the [3H]spiperone was long used as a radioligand to label the receptors such as dopamine D2 and serotonin 5-HT1A/5-HT2A receptors (Metwally et al. 1998). Now, the present studies indicate a novel role of spiperone as a potent inhibitor of neuroinflammation: spiperone not only inhibits the production and expression of inflammatory mediators in BV-2 microglia cells or primary microglia cells, but it also suppresses glial inflammatory signal transduction pathways. Moreover, spiperone also inhibited NO production in ATP-stimulated primary microglia cells. Recently, it has been reported that spiperone blocks dopamine-induced microglial chemotaxis (Mastroeni et al. 2008). In that report, spiperone has been used to antagonize the microglia-chemotactic action of dopamine in an attempt to explain the selective vulnerability of dopamine neurons in Parkinson’s disease. Although microglia cells expressed dopamine D receptors as determined by RT-PCR (Kato et al. 2008; Mastroeni et al. 2008), anti-inflammatory effects of the high-affinity dopamine D2 receptor partial agonist aripiprazole were apparently not mediated through dopamine D2 receptor in microglia cells (Kato et al. 2008). In that study, a full agonist of dopamine D2 receptor quinpirole did not show anti-inflammatory effects, while aripiprazole was anti-inflammatory by inhibiting IFN-γ induced elevation of [Ca2+] in microglia. Moreover, in the current study, not all D2 receptor antagonists showed anti-inflammatory effects. For example, haloperidol and chlorpromazine did not suppress NO production in LPS-stimulated microglia at non-toxic concentration (Fig. 1). Thus, it is suggested that spiperone exerts its anti-inflammatory effects on glia in a dopamine receptor-independent manner.

NF-κB is one of the major transcription factors that are activated by inflammatory signal transduction pathways. NF-κB plays a critical role in the expression of proinflammatory cytokines and enzymes including iNOS, IL-1β, and TNF-α, which are responsible for the innate and adaptive immune responses (Baeuerle and Henkel 1994). The molecular mechanisms of NF-κB activation have been well studied, and they involve a cascade activation of cytoplasmic proteins and the ultimate nuclear translocation and DNA binding of p65 subunit of NF-κB (Delhase et al. 2000; Karin and Ben-Neriah 2000). In the cytoplasm, NF-κB is bound and controlled by its inhibitory subunit, IκB. Inflammatory signals such as LPS stimulate the nuclear translocation and DNA binding of p65 subunit of NF-κB through IκB degradation. In the present study, it was found that spiperone inhibited IκB degradation and the subsequent nuclear translocation and DNA binding of p65 in BV-2 microglia cells (Fig. 5). Additionally, it was found that spiperone inhibited LPS-induced activation of p38 MAPK in BV-2 cells (Fig. 5d), which has been previously implicated in the signal transduction pathways responsible for the induction of iNOS and TNF-α gene expression in glia cells or macrophages (Bhat et al. 1998; Koistinaho and Koistinaho 2002). Taken together, our results indicated that NF-κB and p38 MAPK pathways might be involved in the suppressive effects of spiperone on the gene expression of iNOS, TNF-α, and IL-1β in BV-2 microglia cells.

Glial activation has both destructive and beneficial effects on neuronal survival (Block et al. 2007). Over-activation of glia, however, may contribute to neurodegenerative processes through the production of various neurotoxic factors including free radicals and proinflammatory cytokines (Klegeris et al. 2007). In fact, a number of anti-inflammatory agents, which inhibited glial activation or production of proinflammatory mediators, attenuated neuronal degeneration. Thus, it is suggested that a search for the efficient anti-inflammatory compounds that prevent glial activation may lead to an effective therapeutic approach against many inflammation-mediated neurodegenerative conditions. The current study showed that spiperone protected neuroblastoma cells against microglial toxicity in a microglia/neuron co-culture (Fig. 6). The neuroprotective effect of spiperone is likely because of the inhibition of microglia activation, but not a protective action on the neuroblastoma cells, because the spiperone-pretreated microglia cultures were washed before the addition of the neuroblastoma cells for the co-culture: the B35 neuroblastoma cells had not been exposed to spiperone. Although the co-culture of the LPS-stimulated microglia with neuroblastoma cell line may not be the same as the in vivo conditions, it partially reflects the pathological condition where activated microglia influence the survival of neuronal cells in neurodegenerative diseases. Further studies are, however, required to evaluate a neuroprotective property of the spiperone in the animal models of neurodegenerative diseases and to understand the precise molecular mechanisms of anti-inflammatory actions of the antipsychotics in vitro as well as in vivo. Nevertheless, the present study suggests the protective effects of the antipsychotics, spiperone in particular, against inflammation-mediated neurodegeneration. Future works along this line will clarify the detailed molecular mechanisms underlying the anti-inflammatory effects of spiperone on glia cells.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

This research was supported by Bio R&D program through the Korea Science and Engineering Foundation funded by the Ministry of Education, Science and Technology (2008-04090). KS is a recipient of the Korea Research Foundation Grant funded by the Korean Government (MOEHRD, Basic Research Promotion Fund) (KRF-2006-005-J04202). LTZ, JH, and JO were supported by the Brain Korea 21 Project in 2008. This work was supported by grant No. R01-2006-000-10314-0 from the Basic Research Program of the Korea Science & Engineering Foundation.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References