SEARCH

SEARCH BY CITATION

Keywords:

  • amyotrophic lateral sclerosis;
  • ceftriaxone;
  • excitatory amino acid transporter;
  • glutathione;
  • Nrf2;
  • xCT

Abstract

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References
  8. Supporting Information

In amyotrophic lateral sclerosis, down-regulation of the astrocyte-specific glutamate excitatory amino acid transporter 2 is hypothesized to increase extracellular glutamate, thereby leading to excitotoxic motor neuron death. The antibiotic ceftriaxone was recently reported to induce excitatory amino acid transporter 2 and to prolong the survival of mutant superoxide dismutase 1 transgenic mice. Here we show that ceftriaxone also protects fibroblasts and the hippocampal cell line HT22, which are not sensitive to excitotoxicity, against oxidative glutamate toxicity, where extracellular glutamate blocks cystine import via the glutamate/cystine-antiporter system xc. Lack of intracellular cystine leads to glutathione depletion and cell death because of oxidative stress. Ceftriaxone increased system xc and glutathione levels independently of its effect on excitatory amino acid transporters by induction of the transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2), a known inducer of system xc, and the specific xc subunit xCT. No significant effect was apparent in fibroblasts deficient in Nrf2 or xCT. Similar ceftriaxone-stimulated changes in Nrf2, system xc, and glutathione were observed in rat cortical and spinal astrocytes. In addition, ceftriaxone induced xCT mRNA expression in stem cell-derived human motor neurons. We conclude that ceftriaxone-mediated neuroprotection might relate more strongly to activation of the antioxidant defense system including Nrf2 and system xc than to excitatory amino acid transporter induction.

Abbreviations used
β-ME

β-mercaptoethanol

ALS

amyotrophic lateral sclerosis

ARE

antioxidant-response element

CM-H2DCFDA

5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate

DMEM

Dulbecco’s modified Eagle medium

EAAT

excitatory amino acid transporter

EGFP

enhanced green fluorescent protein

FACS

fluorescence-activated cell sorting

FCS

fetal calf serum

hESC

human embryonic stem cells

KO

knock-out

MEFs

mouse embryonic fibroblasts

MTT

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

Nrf2

nuclear factor erythroid 2-related factor 2

PBS

phosphate buffered saline

SOD-1

superoxide dismutase 1

tBHQ

tert-butyl hydroquinone

TBOA

DL-threo-β-benzyloxyaspartic acid

tBOOH

tertiary-butylhydroperoxide

TEAC

Trolox equivalent activity concentration

WT

wild-type

Excitatory amino acid transporters (EAATs) mediate the re-uptake of glutamate released by synaptic activity in the central nervous system (Sheldon and Robinson 2007). This attenuates excitotoxicity, a process that causes neuronal death because of over-stimulation of ionotropic glutamate receptors (Choi 1992). In amyotrophic lateral sclerosis (ALS), loss of motor neurons is associated with a reduction in the astrocytic EAAT2 in the spinal cord (Rothstein et al. 1995). Down-regulation of EAAT2 has also been described in other neurological diseases including Alzheimer’s disease, epilepsy, HIV-dementia, cerebral ischemia, hepatic encephalopathy, multiple sclerosis, and Huntington’s disease and can result in excitotoxic neuronal death (Sheldon and Robinson 2007). Thus, substances that increase EAAT2 expression might be of broad therapeutic value. Ceftriaxone (Cef), a recently identified EAAT inducer (Rothstein et al. 2005), is protective in experimental models of ALS, ischemic stroke, HIV-dementia, Huntington’s disease, and multiple sclerosis (Rothstein et al. 2005; Chu et al. 2007; Lipski et al. 2007; Ouyang et al. 2007; Rumbaugh et al. 2007; Melzer et al. 2008; Miller et al. 2008) and is currently being tested in clinical trials of ALS and psychiatric disorders (see http://www.clinicaltrials.gov).

In addition to excitotoxicity, oxidative stress plays a role in all of these diseases and neuronal cell death because of oxidative stress can be studied in vitro using oxidative glutamate toxicity, a form of glutamate-induced cell death distinct from excitotoxicity (Tan et al. 2001). In this model, increased extracellular glutamate depletes cells of cystine by blocking the cystine/glutamate antiporter system xc, which imports cystine in exchange with intracellular glutamate (Bannai 1986). System xc consists of two subunits, xCT and a non-specific 4F2 heavy chain (Sato et al. 1999). Cysteine, the reduced form of cystine, is required for the synthesis of GSH, the most important antioxidant in the brain (Dringen 2000; Schulz et al. 2000). System xc inhibition results in GSH depletion, oxidative stress, and ultimately cell death (Tan et al. 2001). Oxidative glutamate toxicity has been described in neuronal cell lines (Miyamoto et al. 1989; Murphy et al. 1989; Tan et al. 2001), and immature primary neurons (Murphy et al. 1990; Davis and Maher 1994; Ratan et al. 1994). Mice lacking system xc activity show redox imbalance (Sato et al. 2005) and brain atrophy (Shih et al. 2006), which strongly suggests that system xc is important for antioxidant defense in the brain.

We recently reported that EAATs might support system xc activity, and thereby GSH synthesis, by both increasing intracellular and decreasing extracellular glutamate and thus protecting against oxidative glutamate toxicity (Lewerenz et al. 2006). Therefore, we investigated whether Cef induces EAATs in HT22 cells, which lack ionotropic glutamate receptors (Maher and Davis 1996), thereby modulating system xc activity and protecting against oxidative glutamate toxicity. Here, we report that Cef acts as an inducer of system xc in glial and neuronal cells.

Experimental procedures

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References
  8. Supporting Information

Materials

Tissue culture dishes were from Greiner BIO-ONE and NUNC; fetal calf serum (FCS) was obtained from Hyclone, l-glutamine, penicillin/streptomycin, 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H2DCFDA), high-glucose Dulbecco’s modified Eagle medium (DMEM), Alpha-MEM, trypsin/EDTA, and TriZol reagent for RNA purification and fluorescent secondary antibodies were from Invitrogen, Carlsbad, CA, USA; acivicin, bovine serum albumin, l-cystine, l-glutamate, HEPES, glutathione reductase, sulfasalicylic acid, 5,5-dithiobis(2-nitrobenzoic acid), homocysteic acid, β-mercaptoethanol (β-ME), reduced NADPH, and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were from Sigma, St Louis, MO, USA. DL-threo-β-benzyloxyaspartic acid (TBOA) was from Tocris Cookson, Ballwin, MO, USA. Ceftriaxone-Na+ was from Ratiopharm and Sigma-Aldrich. l-[35S]-Cystine (specific activity 40–250 mCi/mmol) and l-[3H]-glutamate were obtained from Perkin Elmer NEN, Waltham, MA, USA. Oligonucleotides were synthesized by MWG Biotech AG. All other chemicals were obtained from Merck Eurolabs, Bruchsal, Germany. MTT was reconstituted in phosphate buffered saline (PBS), TBOA in dimethyl sulfoxide. For viability assays, TBOA was dissolved in DMEM and the pH re-adjusted.

HT22 cell culture and viability assays

HT22 cell culture and viability assays were essentially performed as described (Lewerenz et al. 2003, 2006). Experimental agents were added as indicated. TBOA was added immediately before the addition of glutamate. For long term Cef treatment, 1 × 106 HT22 cells were plated in 60 mm dishes with or without the indicated concentrations of Cef. After 2 days, the cells were re-plated once at the same density and Cef concentration. After another 2 days, the cells were seeded at a density of 5 × 105 cells and grown for another 3 days at the same Cef concentration. Frequent counting proved to be essential as HT22 cells grew slightly faster in Cef (data not shown).

Mouse embryonic fibroblast culture and viability assays

Mouse embryonic fibroblasts (MEFs) derived from xCT knock-out mice (xCT KO) and nuclear factor erythroid 2-related factor 2 knock-out mice (Nrf2 KO), and respective control wild-type MEFs were a kind gift of Dr. Hideyo Sato, Yamagata University, Japan (Sasaki et al. 2002; Sato et al. 2005). Cells were cultivated at 37°C in a 10% CO2 atmosphere and DMEM containing 10% FCS, 2 mM glutamine, 10 mM HEPES, pH 7.4, 100 IU/mL penicillin, and 100 μg/mL streptomycin. Medium for xCT KO MEFs was supplement with 50 μM β-ME. For oxidative glutamate toxicity, MEFs were plated at a density of 105 cells/well in six-well plates. Nrf2 KO MEFs and wt-controls were grown with or without 300 μM Cef for 7 days. xCT KO-MEFs and wt-controls were grown to confluence in the presence of 50 μM β-ME for 5 days, washed twice with PBS and then treated for 7 days with or without 300 μM Cef without β-ME. Then, cell were harvested by trypsination and plated at a density of 2.5 × 105 cells/well into 96-well plates. After 24 h, indicated concentrations of glutamate were added and cell survival was monitored by the MTT assay after another 24 h.

Rat primary astrocytes and neuronal astrocytic co-cultures

Rat cortical astrocytes were prepared from E18 cortices as previously described (Krobert et al. 1997). Spinal astrocytes were prepared similarly. These cultures are essentially free of microglia and do not contain neurons or oligodendrocytes after the first passage. Astrocytes were grown to confluence in Alpha-MEM and 10% FCS for 2 weeks and then split 1 : 5 into 10 cm, 35 mm and 24 well dishes. For co-culture experiments, 1 × 106 and 4 × 106 freshly dissociated cortical neurons were seeded on top of astrocytes plated 24 h earlier in 24 well-plates and 35 mm-dishes, respectively. Astrocytes and co-cultures were grown for 1 week and then treated with the indicated concentrations of Cef for another week.

Human embryonic stem cell-derived motor neurons expressing SOD-1 and GFP

The human embryonic stem cell (hESC) line HSF-1 was obtained from WiCell (XY, 46, NIH No.UC01). Cells were transfected with the lentiviral E/Hb9 (3.6 kb) : P/hsp68 : EGFP vector that leads to motorneuron-specific expression of enhanced green fluorescent protein (EGFP) or E/Hb9 (3.6 kb) : P/hsp68 : EGFP : SOD-1 vectors that, in addition to EGFP, separately express either wild-type or mutant superoxide dismutase 1 (SOD-1) under the motorneuron specific Hb9 promoter. Cells were then differentiated using retinoic acid, sonic hedgehog and the growth factors brain-derived neurotrophic factor, glial cell line-derived neurotrophicfactor and ciliary neurotrophic factor as described (Karumbayaram et al. 2009). Thirty-five days after induction of differentiation by growths factors, transfected hESC cultures in 6-well dishes were treated with either 30 or 300 μM Cef for 7 days.

Uptake of radiolabeled amino acids

For uptake experiments, HT22 cells passaged with or without Cef for 7 days and seeded at a density of 3 × 104 cells per well in 24-well plates and grown for 1 day in the presence or absence of Cef or astrocytic cultures grown in 24-well plates for 1 week with or without Cef were used. System xc activity was performed using l-[35S]-cystine or in case of spinal astrocytes using l-[3H]-glutamate as described previously (Lewerenz and Maher 2009).

For measurement of EAAT activity, instead of sodium-free Hank’s buffered salt solution, sodium containing, chloride-free Hank’s buffered salt solution (choline chloride substituted by sodium gluconate, CaCl2 by calcium gluconate) was used. Uptake was performed for 20 min at 37°C with l-[3H]-glutamate diluted 1000-fold with cold l-glutamate to a final concentration of 10 μM. In addition, 100 μM TBOA or dimethyl sulfoxide were added just prior to the initiation of uptake. Samples were processed similarly as for measurement of system xc activity. EAAT activity was defined as TBOA-sensitive l-[3H]-glutamate uptake and determined by subtracting uptake in the absence of TBOA by uptake in parallel wells in the presence of TBOA.

Quantification of total GSH

About 3 × 105 HT22 cells passaged for 1 week with or without Cef were seeded in 60 mm-dishes with the same Cef concentration. After 24 h, the medium was exchanged to Cef-free medium with the indicated concentrations of glutamate for 6 h. MEFs were seeded in six-well plates as described for oxidative glutamate toxicity and astrocytes in 35 mm dishes and grown with or without Cef for 7 days. Cells were harvested, processed and total GSH was measured as described previously (Maher and Hanneken 2005). For measurement of GSH release, astrocytes were washed twice with PBS and then incubated with 750 μL cystine-free DMEM containing 10% FCS and 200 μM of the γ-glutamyl transpeptidase inhibitor acivicin to prevent the generation of mixed GSH disulfides with cystine or enzymatic breakdown of GSH by γ-glutamyl transpeptidase. After 4 h, medium was harvested, spun at 2000 × g for 1 min and 200 μL were processed similarly to cell extracts and similarly normalized to cellular protein measured by the bicinchoninic acid-based method (Micro BCA Protein Assay; Pierce, Rockford, IL, USA).

Immunocytochemistry

Differentiated and transfected hESC cultures were fixed in 4% paraformaldehyde for 20 min at 20°C. Fixed cells were permeabilized with 0.2% Triton in PBS and blocked with the appropriate blocking agents. Cells were incubated with primary C4F6 anti-G93A antibody (Urushitani et al. 2007) (gift from Dr. J-P Julien, Université Laval, Quebec, CA) overnight at 4°C and with secondary antibody for 1–2 h at 20°C. Cells were viewed under a confocal microscope (Zeiss, Thronwood, NY, USA).

Fluorescence-activated cell sorting

Differentiated and transfected hESC cultures were collected from the dishes by TrypLETM (Invitrogen) treatment and were washed twice with DMEM/F12 containing B27. The cells were collected in 5 mL tubes fitted with cell strainer caps (BD falcon-352235) and EGFP-expressing cell were isolated by fluorescence-activated cell sorting (FACS). Typically, cultures contained about 1% of EGFP-positive cells and approximately 10 000 cells were obtained per dish. The FACS-purified motor neurons were centrifuged at 1000 g for 5 min and the pellet was saved in RNAlater solution (Ambion, Austin, TX, USA) as prescribed.

Quantitative real-time PCR

Total RNA was extracted using the RNeasyTM kit (Qiagen, Valencia, CA, USA) following the manufacturer’s instructions and reverse transcribed with oligo(dT)-primers using the SUPERSRIPTTM first strand cDNA synthesis system (Invitrogen). Real-time PCR was performed using Taqman technology with Fam/Dark-quencher probes from the universal ProbelibraryTM (Roche Molecular Biochemicals, Indianapolis, IN, USA) or individually designed Fam/Tamra probes (MWG) on an ABI Prism 7500 Sequence Detection System using the thermocycling conditions proposed by the manufacturer. Real-time PCR reactions were carried out at a final concentration of 300 nM for forward and reverse primers, and 250 nM for the Taqman probes (for sequences see Appendix S2). Each reaction contained 2 μL containing about 60 ng of cDNA, 12.5 μL of the TaqMan universal PCR Master Mix (Abi) in an individual reaction volume of 20 μL. Glyceraldehydes 3-phosphate dehydrogenase (GAPDH) and hypoxanthine-guanine phosphoribosyltransferase (HPRT) served as endogenous control-genes and showed no differential expression after incubation with Cef. Relative differences in abundance were calculated by the ΔΔCT comparator method.

Cell fractionation, sodium dodecyl sulfate–polyacrylamide gel electrophoresis and immunoblotting

HT22 cells grown for 1 week with or without 300 μM ceftriaxone were plated at a density of 8.8 × 105 cells per 10 cm dish and prior growth conditions were continued for 24 h. Membrane, cytosolic and nuclear fractions of HT22 cells and pure astrocytes in 10 cm dishes were obtained by the differential detergent fractionation (Appendix S1). Astrocyte-neuron co-cultures in 35-mm dishes were directly lysed in 200 μL sodium dodecyl sulfate-sample buffer and boiled for 5 min. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis, western blotting and quantification was performed as previously describend (Lewerenz and Maher 2009). The primary antibodies used were: anti-Nrf2 (#SC13032; 1/1000) from Santa Cruz Biotechnology, Santa Cruz, CA, USA, anti-xCT (1/1000, a generous gift from Sylvia Smith, Medical College of Georgia), anti-EAAT2 (1/10 000, a generous gift from J. D. Rothstein, Johns Hopkins University), anti-β-actin (1/200 000, A5441) (Sigma).

Reactive oxygen species measurement

HT22 cells were seeded onto 96-well black walled microtiter plates at a density of 5 × 103 cells per well. The next day, the cells were treated with different concentrations of ceftriaxone for 15 min, 1 h, 4 h or 6 h prior to replacing the medium with 100 μL loading medium (phenol red-free DMEM containing 25 mM HEPES, 2% dialysed FCS and 10 μM CM-H2DCFDA). As a positive control, 250 μM tertiary-butylhydroperoxide (tBOOH) was added to the cells for 15 min prior to the addition of CM-H2DCFDA to some wells. After 30 min in CM-H2DCFDA, the medium was replaced with fresh loading medium without CM-H2DCFDA and the fluorescence (λ excitation = 495 nm, λ emission = 525 nM) was determined using a Gemini fluorescent plate reader. Each treatment was done in quadruplicate. DCFDA fluorescence was normalized to control cells not exposed to ceftriaxone or tBOOH.

Determination of the Trolox equivalent activity concentration

Trolox equivalent activity concentration (TEAC) values were determined as described by (Re et al. 1999) but modified for a plate reader (Maher 2006).

Results

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References
  8. Supporting Information

Long-term ceftriaxone treatment protects HT22 cells against oxidative glutamate toxicity and induces EAAT expression and activity

In HT22 cells, 7 days of pre-treatment with Cef concentration-dependently protected against oxidative glutamate toxicity. Whereas all untreated cells succumbed to 10 mM glutamate, 7% of cells treated with 100 μM and 19% of cells treated with 300 μM Cef survived (Fig. 1a). Within the first 4 days, Cef-mediated protection was only minimal but continued to increase over time (Fig. 1b). As reported for glutamate-resistant HT22 cells (Lewerenz et al. 2006), wild type HT22 cells express EAAT1–3 but not EAAT4 or EAAT5 mRNA. EAAT1 was about 1000-fold more abundant than EAAT3 and EAAT2 about 32-fold more abundant than EAAT3 assuming equal PCR efficiency (Fig. 1c left panel). Cef increased mRNA expression of EAAT1, EAAT2 and EAAT3 2.3-, 1.5-, and 1.9-fold, respectively (Fig. 1c right panel). In line with these results, TBOA-sensitive EAAT activity was increased by 37% upon 300 μM Cef treatment for 7 days (Fig. 1d).

image

Figure 1.  Long-term ceftriaxone treatment protects HT22 cells against oxidative glutamate toxicity and induces EAAT expression and activity. (a) Cef concentration-dependently protects HT22 cells from oxidative glutamate toxicity. Cells were grown in medium containing Cef for 7 days and treated with glutamate in the absence of Cef for 24 h. Relative survival was measured by the MTT assay normalized to cells not treated with glutamate but with Cef. Graphs represent the mean ± SEM, n = 3 in triplicates, *p < 0.05, one-way anova with Dunnett post-hoc test. (b) Cef-induced protection against oxidative glutamate toxicity in HT22 cells increases over time. Cells were grown with or without 300 μM Cef for the indicated time periods and treated with 2.5 mM glutamate for 24 h. Relative protection is expressed as percent increase in relative survival compared to sister cultures passaged in the absence of Cef. Graph shows one representative experiment of two. (c) Absolute EAAT1–3 mRNA abundance quantitated by real-time RT-PCR and expressed as ΔCT values over GAPDH in HT22 cells treated with 300 μM Cef for 7 days (left) and relative EAAT1–3 mRNA abundance in Cef-treated cells compared to control cells compared to GAPDH and HPRT as endogenous controls (right graph). Graphs represent six independent PCR reactions on two independent cDNA preparations derived from independent Cef treatments. (d) Cef induces EAAT activity measured as chloride-independent, TBOA-sensitive 3H-glutamate uptake. HT22 cells were grown with or without 300 μM Cef for 7 days and uptake normalized to cell protein. Relative EAAT activity is expressed as the percent of activity in cells not treated with Cef. Graphs represent means ± SEM, n = 5 in duplicates, *p < 0.05, one sample t-test.

Download figure to PowerPoint

Ceftriaxone-induced protection in HT22 cells is associated with increased expression of xCT, increased activity of system xc, and induction of Nrf2

HT22 cells do not express ionotropic glutamate receptors (Maher and Davis 1996). Therefore, the protective effect of Cef cannot be explained by a reduction in excitotoxicity. Instead, we hypothesized that increased glutamate uptake would lead to an increase in cystine import through system xc and a subsequent increase in GSH by both increasing intracellular glutamate, the driving force for system xc-mediated cystine uptake, and decreasing inhibitory extracellular glutamate concentrations as recently described (Lewerenz et al. 2006). System xc exchanges intracellular glutamate with extracellular cystine, the major building block of the important antioxidant GSH (Bannai 1986). Indeed, in the absence of glutamate, GSH in Cef-treated HT22 cells was ∼42% higher compared to control cells and the absolute difference persisted following a 6 h-treatment with increasing concentrations of glutamate (Fig. 2a).

image

Figure 2.  Ceftriaxone-induced protection in HT22 cells is associated with increased expression of xCT, increased activity of system xc activity, and induction of Nrf2. (a) Cef increases the intracellular GSH concentration. HT22 cells were grown with or without 300 μM cef for 7 days and total GSH measured enzymatically and normalized to cell protein. Relative GSH is expressed as percent of GSH in cells not treated with glutamate and Cef. Graph represents mean ± SEM, = 6 in one replicate each, *< 0.05, one-way anova with Dunnett post-hoc test. (b) Cef-mediated protection is only attenuated but not inhibited by the EAAT-blocker TBOA. HT22 cells were propagated with 300 μM Cef for 7 days and treated with glutamate in the presence or absence of 1 mM TBOA for 24 h. Survival was measured by the MTT assay and normalized to cells treated with Cef and TBOA without glutamate. (c) Cef induces xCT mRNA and system xc activity in HT22 cells. xCT mRNA was quantitated by real-time RT-PCR using the ΔΔCT method with GAPDH and HPRT as endogenous controls in cells grown in the presence of 300 μM Cef for 7 days. Graphs represent the results of two PCR reactions with two cDNA preparations derived from independent Cef treatments (left panel). System xc activity was measured as sodium-independent, glutamate-sensitive 35S-cystine uptake, normalized to cell protein, and expressed as the percent of activity in control cells (right panel). Graphs represent means ± SEM, = 4 in duplicates, *< 0.05, two-tailed t-test. (d) Cef induces Nrf2 protein. Immunoblot shows Nrf2 and β-actin abundance in HT22 cells grown in the absence or presence of 300 μM Cef for 7 days. Molecular mass standards are indicated. The arrow indicates the band specific for Nrf2. Right panel shows densitometric quantification of eight immunoblots, *< 0.05, one-sample t-test.

Download figure to PowerPoint

If the protection was caused exclusively by an EAAT-driven increase in system xc-mediated cystine uptake, inhibition of glutamate uptake with the specific non-transportable EAAT inhibitor, TBOA, should abolish Cef-mediated protection. However, 1 mM TBOA only attenuated but did not abolish cell protection by Cef (Fig. 2b), suggesting additional, EAAT-independent effects of Cef. Because of its important role in oxidative glutamate toxicity and GSH synthesis, we quantified xCT mRNA expression by real-time PCR and measured system xc function directly as sodium-insensitive, glutamate-sensitive 35S-cystine uptake. Both methods showed a prominent induction of xCT mRNA expression (three-fold) and system xc activity (41%) in response to Cef treatment. As the sodium-free conditions used to measure system xc activity inactivate EAATs (Fig 2c), the increase in system xc activity upon Cef treatment can only be explained by up-regulation of system xc itself. Unfortunately, xCT protein, the specific subunit of system xc, is expressed at levels too low to be detected by western blotting in HT22 cells (not shown). We conclude that Cef not only induces EAATs but also xCT and system xc in HT22 cells.

xCT belongs to a family of phase II response genes involved in defense against oxidative stress (Sasaki et al. 2002) that contain an antioxidant-response element (ARE) in their promoter regions (Ishii et al. 2000). The nuclear factor erythroid 2-related factor 2 (Nrf2) binds to the ARE and activates transcription (Nguyen et al. 2003). Thus, we hypothesized that ceftriaxone increases nuclear Nrf2 protein levels. Western blot analysis of nuclear HT22 cell extracts showed that Cef significantly increased Nrf2 levels 1.8-fold compared to control cells (Fig 2d).

Ceftriaxone-mediated increased glutathione content is independent of the induction of EAAT activity, but correlates with an increase in system xc activity

To verify the suspected EAAT-independent effects of Cef on system xc in primary cultures, we exploited the fact that astrocytes only express EAAT2 when co-cultured with neurons (Swanson et al. 1997). We first compared the effect of Cef on EAAT protein induction and function in rat cortical astrocytes co-cultured with primary cortical neurons with pure cortical astrocytes. As expected only astrocytes co-cultured with neurons exhibited the typical stellate phenotype and increased EAAT2 expression and activity measured as TBOA-sensitive 3H-glutamate uptake in response to 300 μM Cef (Fig. 3a). Cef had no effect on EAAT function in pure cortical astrocytes (Fig. 3b), although EAAT function could be induced by the known EAAT2-inducer dibutyryl cAMP (Fig. S1) as previously reported (Swanson et al. 1997). Moreover, EAAT activity in there cultures was not modified by the absence or presence of antibiotics in the culture medium (Fig. S1).

image

Figure 3.  Ceftriaxone-mediated increased glutathione content is independent of the induction of EAAT activity, but correlates with an increase in system xc activity. (a) Cortical astrocytes co-cultured with cortical neurons after 14 days in culture display a stellate morphology (note neuronal aggregates on top of the astrocytes, scale bar = 20 μm) and increased EAAT protein (insert) and activity measured as chloride-independent, TBOA-sensitive 3H-glutamate in response to Cef. Relative EAAT activity is expressed as the percent activity of control cultures. (b) Pure cortical astrocytes show a flat, fibroblast-like morphology (scale bar = 20 μm) and do not exhibit increased EAAT function in response to Cef. (c) Cef increases the intracellular GSH concentration and system xc activity in both culture systems. GSH was measured enzymatically and normalized to protein; relative GSH was calculated as a percent of the level in control cultures. System xc activity was measured as sodium-independent, glutamate-sensitive 35S-cystine uptake and relative activity expressed as the percent of the activity in control cultures. (d) Absolute values of EAAT and xc transport activity in Cef-treated pure cortical astrocytes and mixed cultures, *< 0.05, unpaired t-test. (e) Cef-treated pure cortical astrocytes release GSH. GSH was measured in cystine-free medium in the presence of acivicin for 4 h and normalized to cell protein in response to Cef. Relative GSH release was calculated as the percent of the release in control cultures. (f) Cef has the same effect in spinal astrocytes. EAAT function, system xc activity, intracellular GSH, and GSH release were quantitated and analyzed as described above. Graphs for uptake and GSH measurements represent means ± SEM from three experiments with independent primary cell preparations performed in triplicate for EAAT activity, in duplicate for GSH content and with one replicate for GSH release. *< 0.05, one-way anova and Dunnett’s multiple comparison post-test.

Download figure to PowerPoint

We then compared the effect of Cef on GSH content and system xc activity measured as glutamate-sensitive 35S-cystine uptake in these cultures. In both culture systems, Cef increased GSH content and system xc activity in a similar pattern. In mixed cultures, GSH content increased from ∼80% at 30 μM to ∼200% at 300 μM, which was paralleled by an increase in system xc activity from 16% at 30 μM to 84% at 300 μM Cef. In pure astrocytic cultures GSH content rose by 27% at 30 μM and 86% at 300 μM Cef, whereas system xc activity increased from 24% at 30 μM to 73% at 300 μM as compared to cultures not treated with Cef (Fig. 3c). In absolute values, the xc but not the EAAT transport activity was much enhanced in co-cultures as compared to pure astrocytic cultures (Fig. 3d). However, as these experiments were not conducted in parallel, the results should be interpreted with caution. To prove that the increase in GSH is because of increased synthesis and not decreased export of GSH, we measured GSH export in pure astrocyte cultures treated with Cef for 7 days. Treatment with 30 μM and 300 μM Cef actually increased GSH export by 32% and 94%, respectively (Fig. 3e). We also noticed that the effect on EAAT activity in astrocytes co-cultured with neurons was already saturated with 30 μM Cef consistent with the reported EC50 of 3.5 μM for EAAT2 induction in organotypic spinal cord slice cultures (Rothstein et al. 2005), whereas the effect on GSH content and system xc activity could be further increased by higher concentrations of Cef. The increase in GSH content at higher Cef concentrations therefore more closely resembles the pattern of system xc than EAAT activity induction. We conclude that in astrocytes the effect of Cef on GSH levels and system xc activity parallel each other and can occur in the absence of a functionally significant induction of EAAT function.

Ceftriaxone also increases system xc activity and intracellular and released GSH in spinal cord astrocytes

In human ALS and the animal model of ALS, mutant SOD-1 transgenic mice, motor neuron loss is most prominent in the spinal cord (Gurney et al. 1994; Bruijn et al. 2004). Non-neuronal cells that surround spinal cord motor neurons modulate neurodegeneration in SOD-1 transgenic mice (Clement et al. 2003). Pathways regulating astrocytic EAAT expression depend on the region of the central nervous system from which they are derived (Schluter et al. 2002). Therefore, we investigated the effect of Cef on system xc activity in primary spinal astrocyte monocultures. Again, Cef treatment for 7 days did not increase EAAT function, but did induce a significant increase in system xc activity, intracellular GSH, and GSH release even more robustly than in cortical cultures (Fig 3f).

Ceftriaxone induces xCT and Nrf2 protein and this induction mediates its activity in mouse embryonic fibroblasts

We next measured Nrf2 and xCT protein expression by immunoblotting in our two culture systems: cortical astrocytes differentiated by co-culture with neurons and pure cortical astrocytes. In both culture systems, 300 μM Cef prominently increased the expression of xCT and Nrf2 matching the results obtained functionally with GSH content and system xc activity. Cef increased xCT protein 9.3-fold and Nrf2 6.3-fold in mixed cultures and 2.9-fold (xCT) and 5.0-fold (Nrf2) in pure astrocytic cultures (Fig. 4a). To prove that these two proteins indeed participate in the protective function of Cef, we treated Nrf2 KO and control wild-type (WT) MEFs with or without 300 μM Cef for 7 days before monitoring GSH content and their sensitivity against oxidative glutamate toxicity. Cef significantly increased GSH content only in WT, but not in Nrf2 or xCT KO MEFs (Fig. 4b). Also, Cef significantly protected WT MEFs, but did not change the sensitivity of Nrf2 KO MEFs against oxidative glutamate toxicity (Fig. 4c). We therefore conclude that Cef protection against oxidative glutamate toxicity is probably caused by an up-regulated antioxidant defense mediated by Nrf2 and subsequent xCT expression, which then increases cystine import and glutathione synthesis and release.

image

Figure 4.  Ceftriaxone induces xCT and Nrf2 protein and this induction mediates its activity in mouse embryonic fibroblasts. (a) Cef induces xCT and Nrf2 protein in both culture systems: cortical astrocytes co-cultured with cortical neurons and pure cortical astrocytes. Band densities of xCT and Nrf2 immunoblots were normalized to β-actin staining of the same blot and control cultures. Upper panel shows representative blots, lower panel mean ± SEM, = 6 immunoblots of two independent cultures (neuron/astrocyte co-cultures) or three independent immunoblots of three independent cultures (pure astrocytes). *< 0.05, one-sample t-test. (b) No Cef-induced increase in intracellular GSH in the absence of xCT or Nrf2. KO and wild-type (WT) mouse embryonic fibroblasts were treated with Cef for 7 days. GSH was measured enzymatically and normalized to protein; relative GSH was calculated as percent of the level in control cells. Graphs represent mean ± SEM, = 3 in triplicates. *< 0.05, one-sample t-test. (c) Cef does not protect against oxidative glutamate toxicity in the absence of Nrf2. KO or WT Nrf2 cells were grown in medium containing Cef for 7 days and treated with glutamate in the absence of Cef for 24 h. Relative survival was measured by the MTT assay normalized to cells not treated with glutamate but with Cef. Graphs represent mean ± SEM, = 2 in triplicates, *< 0.05 one-way anova with Dunnett post-hoc test.

Download figure to PowerPoint

Ceftriaxone increases xCT mRNA in human stem cell-derived motor neurons and the induction is modified by mutant G93A SOD-1

To study the effect of Cef on motor neurons, we used human motor neurons derived from human embryonic stem cells (hESCs), which can be identified by expression of EGFP driven by the motor neuron-specific enhancer Hb9 as described previously (Karumbayaram et al. 2009) (Fig. 5a). We treated differentiated hESCs for 7 days with 30 or 300 μM Cef, purified EGFP-expressing cells by FACS, and quantified xCT mRNA expression by real-time RT-PCR. Treatment with Cef led to a concentration-dependent increase in xCT mRNA expression in hESC-derived motor neurons (Fig. 5b). We then used cells over-expressing mutant G93A SOD-1, which causes familial ALS or wild-type human SOD-1 as a control (Karumbayaram et al. 2009). The expression of G93A SOD-1 was confirmed using a G93A mutant-specific antibody (Urushitani et al. 2007) (Fig. 5c). Basal xCT expression did not differ significantly between neurons expressing mutant G93A or wild type SOD-1 (Fig. 5d). As in hESC-derived motor neurons expressing EGFP only, 7 days of Cef significantly induced xCT mRNA in hESC-derived motor neurons expressing mutant G93A or wild-type SOD-1. Nevertheless, the magnitude of induction was significantly lower in mutant G93A SOD-1 than in wild-type SOD-1 expressing neurons (Fig. 5e).

image

Figure 5.  Ceftriaxone increases xCT mRNA in human stem cell-derived motor neurons and the induction is modified by mutant G93A SOD-1. (a and b) Human motor neurons show a concentration-dependent increase in xCT mRNA in response to Cef. Human stem-cell derived motor neurons were identified by EGFP driven by the motor neuron-specific enhancer derived from the Hb9 promoter (scale bar = 20 μm). (b) EGFP-positive human motor neurons treated with Cef or vehicle were purified by FACS and relative xCT mRNA quantified by real-time RT-PCR using HPRT as endogenous control, *< 0.05, one-way anova and Dunnett’s post-test. (c) Motor neurons derived from HSF-1 cells that express both EGFP and wild-type, respectively disease-causing mutant G93A, SOD-1 under the control of the motor neuron-specific enhancer derived from the Hb9 promoter. The micrographs demonstrate EGFP-fluorescence, immunofluorescence staining (IF) using a specific monoclonal antibody for G93A SOD-1, and co-localization of both. Scale bar = 20 μm. (d) Mutant SOD-1 has no effect on the expression of xCT. Relative xCT mRNA abundance in motor neurons expressing mutant G93A SOD-1 (G93A) compared to cells expressing wild-type SOD-1 (wt) in the absence of Cef, *< 0.05, unpaired t-test. (e) Mutant SOD-1 attenuates the induction of xCT by Cef. Relative Cef-mediated xCT mRNA induction in cells expressing either mutant G93A SOD-1 (G93A) or wild-type SOD-1 (wt). Induction is expressed as relative xCT mRNA abundance normalized to motor neurons expressing the same SOD-1 without Cef treatment. *< 0.05, two-way anova with Bonferroni post-test. Graphs in (b), (d), and (e) represent relative expression obtained from three PCR reactions each on two independent cDNAs derived from independent cultures as mean ± SEM.

Download figure to PowerPoint

Ceftriaxone is a slow inducer of Nrf2 devoid of any pro- or antioxidant activity

Based on the above data, we hypothesized that Cef is a novel, slow, and therefore atypical inducer of Nrf2. Whereas a 4 h pre-treatment with 25 μM tert-butyl hydroquinone (tBHQ), a classical Nrf2 inducer, protected HT22 cells against oxidative glutamate toxicity, no effect was seen for a similar treatment with 300 μM Cef (Fig. 6a). Similarly, while tBHQ strongly induced nuclear Nrf2 protein after a 4 h treatment, Cef-induced induction of Nrf2 was not significantly different from control at this time point, but became apparent with a 5-fold induction after 24 h (Fig. 6b). The development of a robust protection by Cef took even longer (Fig 1b).

image

Figure 6.  Ceftriaxone is a slow inducer of Nrf2 devoid of any pro- or antioxidant activity. (a) The Nrf2 inductor tBHQ, but not Cef protects HT22 cells after a 4-h treatment. HT22 cells were exposed to tBHQ, Cef, or vehicle 4 h prior to glutamate and viability measured 24 h later by the MTT assay. Survival was normalized to cells not treated with glutamate but with the same pre-treatment. (b) Cef is a slow inductor of Nrf2. HT22 cells were incubated for 4 or 24 h with 300 μM Cef or 25 μM t-BHQ. Lower panel shows representative blots, upper panel mean ± SEM of five independent immunoblots. (c) Cef transiently lowers ROS production. HT22 cells were exposed to Cef for the indicated times and ROS production measured by DCFDA fluorescence and normalized to the level in untreated cells. The known pro-oxidant tBOOH served as positive control. Graph represents means ± SEM, = 5 independent experiments, *< 0.05, two-way anova. (d) Cef does not act as a direct antioxidant in the TEAC assay. Graph represents mean TEAC values ± SEM, = 3 independent experiments.

Download figure to PowerPoint

Many inducers of Nrf2 have either oxidant or antioxidant properties (Kensler et al. 2007). Reactive oxygen species (ROS) production in living neuronal cells can be measured by intracellular oxidation of the non-fluorescent dye H2DCFDA to the fluorescent compound DCFDA (Oyama et al. 1994). If Cef was a pro- or an antioxidant, then a change in reactive oxygen species detection measured by DCFDA fluorescence should be present after exposure of cells to Cef. After treatment of HT22 cells with 30 or 300 μM Cef, DCFDA fluorescence was slightly and transiently diminished after 15 and 60 min but not different from control values after longer exposure. The pro-oxidant tBOOH served as a positive control (Fig. 6c). Thus, we tested whether Cef is a direct antioxidant using the TEAC assay. In contrast to rapid and strong inducers of Nrf2 such as fisetin (Hanneken et al. 2006) and tBHQ (Wang and Jaiswal 2006), which show significant antioxidant activity, Cef showed no direct antioxidant activity in the TEAC assay (Fig. 6d).

Discussion

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References
  8. Supporting Information

Ceftriaxone has been reported to increase EAAT2 expression and induce neuroprotection in animal models of diverse neurological diseases (Rothstein et al. 2005; Chu et al. 2007; Ouyang et al. 2007; Miller et al. 2008). It was generally assumed that the up-regulation of EAAT2 is responsible for Cef-mediated neuroprotection by virtue of its ability to reduce extracellular glutamate levels and subsequent excitotoxicity (Sheldon and Robinson 2007). Here, we demonstrate that Cef robustly induces the expression of the glutamate/cystine exchanger, system xc, in four different neuronal or glial cell culture models: hippocampal HT22 cells, cortical astrocytes differentiated by co-culture with cortical neurons, cortical and spinal cord astrocyte monocultures, as well as increased mRNA expression of the specific system xc subunit, xCT, in human stem cell-derived motor neurons. Induction of system xc activity by Cef strongly correlated with increased intracellular GSH levels, the most important endogenous small molecule antioxidant in the brain (Dringen 2000; Schulz et al. 2000). In addition, Cef increased GSH release from cortical and spinal astrocytes, supporting the assumption that the increase in GSH is because of increased synthesis and not decreased export. Experiments with cortical and spinal astrocytic monocultures showed that the effect of Cef on GSH metabolism is independent of EAAT induction since Cef-induced increases in GSH were present in pure astrocytic cultures without increase in functional EAAT expression. In vivo astrocytes contain ∼4-fold higher GSH levels compared to neurons (Sun et al. 2006) and astrocytic GSH release and subsequent extracellular degradation is thought to be an important source of cysteine for neuronal GSH synthesis (Dringen and Hirrlinger 2003). Thus, induction of xCT in vivo might have a dual protective activity on motor neurons by, first, increasing their ability to directly import cystine and, second, by providing cysteine as a break-down product of astrocyte-derived GSH for GSH synthesis.

xCT is transcriptionally induced by the nuclear factor Nrf2, which binds to AREs in the promoter region of the xCT gene (Sasaki et al. 2002). Our observation that increased xCT expression and system xc activity was paralleled by increased Nrf2 protein levels in response to Cef treatment strongly suggests that Nrf2 induces xCT. This hypothesis is substantiated by the observations that Cef did not protect MEFs deficient in Nrf2 against oxidative glutamate toxicity, and that Nrf2 and xCT deficiency strongly and independently diminished the effect of Cef on GSH levels. Besides xCT, Nrf2 also induces enzymes involved in GSH biosynthesis (glutamate cysteine ligase and glutathione synthase), use (glutathione S-transferase and glutathione reductase), and export (multidrug resistance protein 1) (Shih et al. 2003). Nevertheless, the diminished Cef-mediated GSH increase in xCT KO MEFs indicates the critical role of xCT induction.

Whereas the classical Nrf2 inducer tBHQ protects against oxidative glutamate toxicity within 4 h, the Cef-induced protection of HT22 cells took days to develop. In addition, we show that Cef neither acts as a direct antioxidant nor induces oxidative stress. Thus, Cef represents a novel, slow, and rather atypical inducer of Nrf2. It remains to be shown whether Cef induces Nrf2 in a phosphatidylinositol 3-kinase-dependent pathway as recently described for dietary flavonoids (Bahia et al. 2008).

The EAAT-inhibitor TBOA reduced Cef-mediated protection in the HT22 cells, where we observed simultaneous induction of EAAT activity and Nrf2 by Cef. EAATs were suggested to support system xc function by supplying intracellular glutamate to drive cystine import and to reduce competitive inhibition by extracellular glutamate (Rimaniol et al. 2001; Lewerenz et al. 2006). We think that Cef-mediated EAAT induction in HT22 cells is responsible for part of the observed protective effect via this mechanism. Moreover, system xc activity inevitably leads to glutamate release (Bannai 1986) and, in a cell culture model of ischemic stroke, a combination of post-hypoxic induction of system xc and concomitant reduction of EAAT activity has been found to exacerbate glutamate-mediated neuronal cell death (Fogal et al. 2007). Thus, in diseases with both oxidative stress and a deficiency in EAAT function, compounds like Cef that simultaneously induce system xc and EAAT activity might provide a substantial neuroprotective benefit. Our observation that the Cef-mediated xCT induction is preserved in the presence of mutant SOD-1 in human stem cell-derived motor neurons points to the potential therapeutic benefits of ceftriaxone in ALS. Of note, mutant G93A slightly attenuated the effect of Cef on xCT expression compared to wild type SOD-1. As we did not control for equal expression of both proteins, the results should be interpreted with care. Nevertheless, our results are in line with observations that suggest an impaired Nrf2-mediated gene transcription in the presence of mutant SOD-1 in motor neuron-like cells and in familial ALS carrying SOD-1 mutations as described previously (Kirby et al. 2005).

All of the animal disease models in which Cef was found to be protective (Rothstein et al. 2005; Chu et al. 2007; Ouyang et al. 2007; Melzer et al. 2008; Miller et al. 2008) show signs of oxidative stress (Bogdanov et al. 2001; Fox et al. 2004; Poon et al. 2005; Tomizawa et al. 2005; Chi et al. 2007; Zargari et al. 2007). Hence, the induction of the antioxidant GSH via Nrf2 and xCT described herein might, at least in part, have mediated some of the previously reported neuroprotective effects of Cef. However, none of these studies measured intracerebral Cef concentrations. In general, 200 mg/kg body weight was administered daily for 5 days (Chu et al. 2007; Ouyang et al. 2007; Miller et al. 2008), 2 weeks (Rothstein et al. 2005) or 40 days (Melzer et al. 2008). In humans, 2 g (∼30 mg/kg body weight) daily, which is administered for antibiotic treatment, leads to maximal cerebrospinal fluid concentrations of 0.2–1.6 μM (Nau et al. 1993). Although a ∼7-fold higher dose was used in animal studies on Cef-mediated neuroprotection, there is no evidence that brain Cef concentrations were high enough to induce brain expression of Nrf2 and xCT. Nevertheless, system xc is expressed in the brain capillary endothelium (Burdo et al. 2006) and system xc-mediated cystine transport across the blood brain barrier is readily induced by diethyl maleate (Hosoya et al. 2001), a Nrf2- and xCT-inducing electrophile (Sasaki et al. 2002). In humans, plasma concentrations > 300 μM are achieved by regular Cef treatment (Nau et al. 1993), which in our hands prominently induced GSH synthesis in vitro in various cell types. Thus, increased transport of cystine across the blood-brain-barrier might underlie the neuroprotective actions of ceftriaxone observed in animal studies.

In summary, we demonstrate that the neuroprotective β-lactam antibiotic Cef not only increases the expression of EAATs but, additionally, is an inducer of Nrf2, system xc and GSH in vitro. Thus, Cef has a dual neuroprotective effect with the induction of EAATs theoretically supporting the action of system xc and neutralizing the increase in glutamate release resulting from enhanced system xc activity, which is a possible negative side effect. Further studies are needed to reveal whether both actions play a role in the observed Cef-mediated neuroprotection in vivo.

Acknowledgement

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References
  8. Supporting Information

This work was funded by the American ALS association (ALSA starter grant 1266 to Axel Methner and Dave Schubert) and Forschungskommission der Heinrich-Heine Universität Düsseldorf grant 9772353 to Philipp Albrecht.

References

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References
  8. Supporting Information
  • Bahia P. K., Rattray M. and Williams R. J. (2008) Dietary flavonoid (-)epicatechin stimulates phosphatidylinositol 3-kinase-dependent anti-oxidant response element activity and up-regulates glutathione in cortical astrocytes. J. Neurochem. 106, 21942204.
  • Bannai S. (1986) Exchange of cystine and glutamate across plasma membrane of human fibroblasts. J. Biol. Chem. 261, 22562263.
  • Bogdanov M. B., Andreassen O. A., Dedeoglu A., Ferrante R. J. and Beal M. F. (2001) Increased oxidative damage to DNA in a transgenic mouse model of Huntington’s disease. J. Neurochem. 79, 12461249.
  • Bruijn L. I., Miller T. M. and Cleveland D. W. (2004) Unraveling the mechanisms involved in motor neuron degeneration in ALS. Annu. Rev. Neurosci. 27, 723749.
  • Burdo J., Dargusch R. and Schubert D. (2006) Distribution of the cystine/glutamate antiporter system xc- in the brain, kidney, and duodenum. J. Histochem. Cytochem. 54, 549557.
  • Chi L., Ke Y., Luo C., Gozal D. and Liu R. (2007) Depletion of reduced glutathione enhances motor neuron degeneration in vitro and in vivo. Neuroscience 144, 9911003.
  • Choi D. W. (1992) Excitotoxic cell death. J. Neurobiol. 23, 12611276.
  • Chu K., Lee S. T., Sinn D. I. et al. (2007) Pharmacological induction of ischemic tolerance by glutamate transporter-1 (EAAT2) upregulation. Stroke 38, 177182.
  • Clement A. M., Nguyen M. D., Roberts E. A. et al. (2003) Wild-type nonneuronal cells extend survival of SOD1 mutant motor neurons in ALS mice. Science 302, 113117.
  • Davis J. B. and Maher P. (1994) Protein kinase C activation inhibits glutamate-induced cytotoxicity in a neuronal cell line. Brain Res. 652, 169173.
  • Dringen R. (2000) Glutathione metabolism and oxidative stress in neurodegeneration. Eur. J. Biochem. 267, 4903.
  • Dringen R. and Hirrlinger J. (2003) Glutathione pathways in the brain. Biol. Chem. 384, 505516.
  • Fogal B., Li J., Lobner D., McCullough L. D. and Hewett S. J. (2007) System x(c)- activity and astrocytes are necessary for interleukin-1 beta-mediated hypoxic neuronal injury. J. Neurosci. 27, 1009410105.
  • Fox J. H., Barber D. S., Singh B. et al. (2004) Cystamine increases L-cysteine levels in Huntington’s disease transgenic mouse brain and in a PC12 model of polyglutamine aggregation. J. Neurochem. 91, 413422.
  • Gurney M. E., Pu H., Chiu A. Y. et al. (1994) Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science 264, 17721775.
  • Hanneken A., Lin F. F., Johnson J. and Maher P. (2006) Flavonoids protect human retinal pigment epithelial cells from oxidative-stress-induced death. Invest. Ophthalmol. Vis. Sci. 47, 31643177.
  • Hosoya K., Saeki S. and Terasaki T. (2001) Activation of carrier-mediated transport of L-cystine at the blood-brain and blood-retinal barriers in vivo. Microvasc. Res. 62, 136142.
  • Ishii T., Itoh K., Takahashi S., Sato H., Yanagawa T., Katoh Y., Bannai S. and Yamamoto M. (2000) Transcription factor Nrf2 coordinately regulates a group of oxidative stress-inducible genes in macrophages. J. Biol. Chem. 275, 1602316029.
  • Karumbayaram S., Kelly T. K., Paucar A. A., Roe A. J., Umbach J. A., Charles A., Goldman S. A., Kornblum H. I. and Wiedau-Pazos M. (2009) Human embryonic stem cell-derived motor neurons expressing SOD1 mutants exhibit typical signs of motor neuron degeneration linked to ALS. Dis. Model Mech. 2, 189195.
  • Kensler T. W., Wakabayashi N. and Biswal S. (2007) Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu. Rev. Pharmacol. Toxicol. 47, 89116.
  • Kirby J., Halligan E., Baptista M. J. et al. (2005) Mutant SOD1 alters the motor neuronal transcriptome: implications for familial ALS. Brain 128, 16861706.
  • Krobert K., Lopez-Colberg I. and Cunningham L. A. (1997) Astrocytes promote or impair the survival and function of embryonic ventral mesencephalon co-grafts: effects of astrocyte age and expression of recombinant brain-derived neurotrophic factor. Exp. Neurol. 145, 511523.
  • Lewerenz J. and Maher P. (2009) Basal levels of eIF2alpha phosphorylation determine cellular antioxidant status by regulating ATF4 and xCT expression. J. Biol. Chem. 284, 11061115.
  • Lewerenz J., Letz J. and Methner A. (2003) Activation of stimulatory heterotrimeric G proteins increases glutathione and protects neuronal cells against oxidative stress. J. Neurochem. 87, 522531.
  • Lewerenz J., Klein M. and Methner A. (2006) Cooperative action of glutamate transporters and cystine/glutamate antiporter system Xc protects from oxidative glutamate toxicity. J. Neurochem. 98, 916925.
  • Lipski J., Wan C. K., Bai J. Z., Pi R., Li D. and Donnelly D. (2007) Neuroprotective potential of ceftriaxone in in vitro models of stroke. Neuroscience 146, 617629.
  • Maher P. (2006) A comparison of the neurotrophic activities of the flavonoid fisetin and some of its derivatives. Free Radic. Res. 40, 11051111.
  • Maher P. and Davis J. B. (1996) The role of monoamine metabolism in oxidative glutamate toxicity. J. Neurosci. 16, 63946401.
  • Maher P. and Hanneken A. (2005) The molecular basis of oxidative stress-induced cell death in an immortalized retinal ganglion cell line. Invest. Ophthalmol. Vis. Sci. 46, 749757.
  • Melzer N., Meuth S. G., Torres-Salazar D. et al. (2008) A beta-lactam antibiotic dampens excitotoxic inflammatory CNS damage in a mouse model of multiple sclerosis. PLoS ONE 3, e3149.
  • Miller B. R., Dorner J. L., Shou M., Sari Y., Barton S. J., Sengelaub D. R., Kennedy R. T. and Rebec G. V. (2008) Up-regulation of GLT1 expression increases glutamate uptake and attenuates the Huntington’s disease phenotype in the R6/2 mouse. Neuroscience 153, 329337.
  • Miyamoto M., Murphy T. H., Schnaar R. L. and Coyle J. T. (1989) Antioxidants protect against glutamate-induced cytotoxicity in a neuronal cell line. J. Pharmacol. Exp. Ther. 250, 11321140.
  • Murphy T. H., Miyamoto M., Sastre A., Schnaar R. L. and Coyle J. T. (1989) Glutamate toxicity in a neuronal cell line involves inhibition of cystine transport leading to oxidative stress. Neuron 2, 15471558.
  • Murphy T. H., Schnaar R. L. and Coyle J. T. (1990) Immature cortical neurons are uniquely sensitive to glutamate toxicity by inhibition of cystine uptake. FASEB J. 4, 16241633.
  • Nau R., Prange H. W., Muth P., Mahr G., Menck S., Kolenda H. and Sorgel F. (1993) Passage of cefotaxime and ceftriaxone into cerebrospinal fluid of patients with uninflamed meninges. Antimicrob. Agents Chemother. 37, 15181524.
  • Nguyen T., Sherratt P. J. and Pickett C. B. (2003) Regulatory mechanisms controlling gene expression mediated by the antioxidant response element. Annu. Rev. Pharmacol. Toxicol. 43, 233260.
  • Ouyang Y. B., Voloboueva L. A., Xu L. J. and Giffard R. G. (2007) Selective dysfunction of hippocampal CA1 astrocytes contributes to delayed neuronal damage after transient forebrain ischemia. J. Neurosci. 27, 42534260.
  • Oyama Y., Hayashi A., Ueha T. and Maekawa K. (1994) Characterization of 2′,7′-dichlorofluorescin fluorescence in dissociated mammalian brain neurons: estimation on intracellular content of hydrogen peroxide. Brain Res. 635, 113117.
  • Poon H. F., Hensley K., Thongboonkerd V., Merchant M. L., Lynn B. C., Pierce W. M., Klein J. B., Calabrese V. and Butterfield D. A. (2005) Redox proteomics analysis of oxidatively modified proteins in G93A-SOD1 transgenic mice–a model of familial amyotrophic lateral sclerosis. Free Radic. Biol. Med. 39, 453462.
  • Ratan R. R., Murphy T. H. and Baraban J. M. (1994) Oxidative stress induces apoptosis in embryonic cortical neurons. J. Neurochem. 62, 376379.
  • Re R., Pellegrini N., Proteggente A., Pannala A., Yang M. and Rice-Evans C. (1999) Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free Radic. Biol. Med. 26, 12311237.
  • Rimaniol A. C., Mialocq P., Clayette P., Dormont D. and Gras G. (2001) Role of glutamate transporters in the regulation of glutathione levels in human macrophages. Am. J. Physiol. Cell Physiol. 281, C1964C1970.
  • Rothstein J. D., Van Kammen M., Levey A. I., Martin L. J. and Kuncl R. W. (1995) Selective loss of glial glutamate transporter GLT-1 in amyotrophic lateral sclerosis. Ann. Neurol. 38, 7384.
  • Rothstein J. D., Patel S., Regan M. R. et al. (2005) Beta-lactam antibiotics offer neuroprotection by increasing glutamate transporter expression. Nature 433, 7377.
  • Rumbaugh J. A., Li G., Rothstein J. and Nath A. (2007) Ceftriaxone protects against the neurotoxicity of human immunodeficiency virus proteins. J. Neurovirol. 13, 168172.
  • Sasaki H., Sato H., Kuriyama-Matsumura K. et al. (2002) Electrophile response element-mediated induction of the cystine/glutamate exchange transporter gene expression. J. Biol. Chem. 277, 4476544771.
  • Sato H., Tamba M., Ishii T. and Bannai S. (1999) Cloning and expression of a plasma membrane cystine/glutamate exchange transporter composed of two distinct proteins. J. Biol. Chem. 274, 1145511458.
  • Sato H., Shiiya A., Kimata M. et al. (2005) Redox imbalance in cystine/glutamate transporter-deficient mice. J. Biol. Chem. 280, 3742337429.
  • Schluter K., Figiel M., Rozyczka J. and Engele J. (2002) CNS region-specific regulation of glial glutamate transporter expression. Eur. J. Neurosci. 16, 836842.
  • Schulz J. B., Lindenau J., Seyfried J. and Dichgans J. (2000) Glutathione, oxidative stress and neurodegeneration. Eur. J. Biochem. 267, 49044911.
  • Sheldon A. L. and Robinson M. B. (2007) The role of glutamate transporters in neurodegenerative diseases and potential opportunities for intervention. Neurochem. Int. 51, 333355.
  • Shih A. Y., Johnson D. A., Wong G., Kraft A. D., Jiang L., Erb H., Johnson J. A. and Murphy T. H. (2003) Coordinate regulation of glutathione biosynthesis and release by Nrf2-expressing glia potently protects neurons from oxidative stress. J. Neurosci. 23, 33943406.
  • Shih A. Y., Erb H., Sun X., Toda S., Kalivas P. W. and Murphy T. H. (2006) Cystine/glutamate exchange modulates glutathione supply for neuroprotection from oxidative stress and cell proliferation. J. Neurosci. 26, 1051410523.
  • Sun X., Shih A. Y., Johannssen H. C., Erb H., Li P. and Murphy T. H. (2006) Two-photon imaging of glutathione levels in intact brain indicates enhanced redox buffering in developing neurons and cells at the cerebrospinal fluid and blood-brain interface. J. Biol. Chem. 281, 1742017431.
  • Swanson R. A., Liu J., Miller J. W., Rothstein J. D., Farrell K., Stein B. A. and Longuemare M. C. (1997) Neuronal regulation of glutamate transporter subtype expression in astrocytes. J. Neurosci. 17, 932940.
  • Tan S., Schubert D. and Maher P. (2001) Oxytosis: a novel form of programmed cell death. Curr. Top. Med. Chem. 1, 497506.
  • Tomizawa S., Imai H., Tsukada S. et al. (2005) The detection and quantification of highly reactive oxygen species using the novel HPF fluorescence probe in a rat model of focal cerebral ischemia. Neurosci. Res. 53, 304313.
  • Urushitani M., Ezzi S. A. and Julien J. P. (2007) Therapeutic effects of immunization with mutant superoxide dismutase in mice models of amyotrophic lateral sclerosis. Proc. Natl Acad. Sci. USA 104, 24952500.
  • Wang W. and Jaiswal A. K. (2006) Nuclear factor Nrf2 and antioxidant response element regulate NRH:quinone oxidoreductase 2 (NQO2) gene expression and antioxidant induction. Free Radic. Biol. Med. 40, 11191130.
  • Zargari M., Allameh A., Sanati M. H., Tiraihi T., Lavasani S. and Emadyan O. (2007) Relationship between the clinical scoring and demyelination in central nervous system with total antioxidant capacity of plasma during experimental autoimmune encephalomyelitis development in mice. Neurosci. Lett. 412, 2428.

Supporting Information

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Results
  5. Discussion
  6. Acknowledgement
  7. References
  8. Supporting Information

Appendix S1. Differential detergent fractionation. Cells were washed twice with ice-cold PBS, scraped into 500 μL hypotonic lysis buffer (20 mM Tris, pH 7.5, 1 mM EDTA) per dish with protease inhibitors, homogenized with 30 strokes using a DUALL 21 homogenizer and nuclei and membranes were pelleted by 10 min centrifugation with 13 000 g. The pellet was resuspended in 50 μL hypotonic lysis buffer containing 1% NP40 per dish. After centrifugation, the supernatant containing the membrane proteins was stored at −70°C until analysis. The nuclei-containing pellet was resuspended in an equivalent volume of hypotonic lysis buffer containing 1% Triton X-100 by sonication and centrifuged again. The supernatant was stored at −70°C until analysis. Protein in the different fractions was quantified by the bicinchoninic acid method (Pierce) and adjusted to equal concentrations. 5× western blot sample buffer (74 mM Tris-HCl, pH 8.0, 6.25% SDS, 10% β-mercaptoethanol, 20% glycerol) was added to a final concentration of 2.5× and samples were boiled for 5 min.

Appendix S2. Primers and probes. Primers and probes for mouse cDNA were as follows: GAPDH: forward TGCCAGCCTCGTCCCGTAGA, reverse GCGCCCAATACGGCCAAAT, probe FAM-AAAATGGTGAAGGTCGGTGTGAAC-TAMRA; HPRT: forward GTTGCAAGCTTGCTGGTGAA, reverse GATTCAAATCCCTGAAGTACTCA, probe FAM-CCTCTCGAAGTGTTGGATACAGGGCA-TAMRA; EAAT1: forward GTCGCGGTGATAATGTGGTA, reverse AATCTTCCCTGCGATCAAGA, probe 105 (universal Probelibrary); EAAT2: forward ATTCCAAGCCTGGATCACTG, reverse AACGGAAGGTAACAGGCAAA, probe 38 (universal ProbeLibrary); EAAT3: forward ACGTCACCCTGATCATTGCT, reverse GACGTTCACCATGGTCCTG, probe 92 (universal ProbeLibrary); xCT: forward TGGGTGGAACTGCTCGTAAT, reverse AGGATGTAGCGTCCAAATGC, probe 1 (universal ProbeLibrary). Primers and probes for human cDNA were as follows: GAPDH: Assay on demand (ABI, Weiterstadt, Germany); EAAT1: forward TTCGGACAAATTATTACAATCAGG, reverse TGACAAGTGCTCCACAATCC, probe 14 (universal Probelibrary); EAAT2: forward GTTTCAGCCGCTCGACTC, reverse TGTTCACTTTGGTCCAGCAC, probe 88 (universal ProbeLibrary); EAAT3: forward GCGCTTCCTGAAGAATAACTG, reverse CCAAGACTCCTGTGGTAATGC, probe 56 (universal ProbeLibrary); xCT: forward TTGCAAGCTCACAGCAATTC, reverse GCGTCTTTAAAGTTCTGCGTTT, probe FAM-TCCCTGGAGTTATGCAGCTAATTAAAGGTC-TAMRA.

Figure S1. In contrast to Cef, dibutyryl-cAMP induces EAAT function in pure astrocytical cultures. Confluent cortical astrocytes were plated in the absence or presence of antibiotics. After 7 days, Cef or dibutyryl-cAMP were added at the indicated concentrations for seven days. EAAT activity was measured as chloride-independent, TBOA-sensitive 3H-glutamate in the presence or absence of culture medium antibiotics (100 IU/mL penicillin and 100 μg/mL streptomycin). Graphs represents means ± SEM, = 2 independent experiments.

As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.

FilenameFormatSizeDescription
JNC_6347_sm_fig s1.eps45KSupporting info item
JNC_6347_sm_fig s1.pdf6KSupporting info item
JNC_6347_sm_supporting material.doc15KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.