SEARCH

SEARCH BY CITATION

Keywords:

  • dopamine;
  • EGFR;
  • GDNF;
  • schizophrenia;
  • striatum;
  • tyrosine hydroxylase

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

J. Neurochem. (2011) 10.1111/j.1471-4159.2011.07287.x

Abstract

Although epidermal growth factor (EGF) receptor (ErbB1) is implicated in Parkinson’s disease and schizophrenia, the neurotrophic action of ErbB1 ligands on nigral dopaminergic neurons remains controversial. Here, we ascertained colocalization of ErbB1 and tyrosine hydroxylase (TH) immunoreactivity and then characterized the neurotrophic effects of ErbB1 ligands on this cell population. In mesencephalic culture, EGF and glial-derived neurotrophic factor (GDNF) similarly promoted survival and neurite elongation of dopaminergic neurons and dopamine uptake. The EGF-promoted dopamine uptake was not inhibited by GDNF-neutralizing antibody or TrkB-Fc, whereas EGF-neutralizing antibody fully blocked the neurotrophic activity of the conditioned medium that was prepared from EGF-stimulated mesencephalic cultures. The neurotrophic action of EGF was abolished by ErbB1 inhibitors and genetic disruption of erbB1 in culture. In vivo administration of ErbB1 inhibitors to rat neonates diminished TH and dopamine transporter (DAT) levels in the striatum and globus pallidus but not in the frontal cortex. In parallel, there was a reduction in the density of dopaminergic varicosities exhibiting intense TH immunoreactivity. In agreement, postnatal erbB1-deficient mice exhibited similar decreases in TH levels. Although neurotrophic supports to dopaminergic neurons are redundant, these results confirm that ErbB1 ligands contribute to the phenotypic and functional development of nigral dopaminergic neurons.

Abbreviations used
BDNF

brain-derived neurotrophic factor

CDNF

conserved dopamine neurotrophic factor

DA

dopamine

DAT

dopamine transporter

DIG

digoxigenin

DIV

days in vitro

DβH

dopamine beta hydroxylase

E

embryonic day

EGF

epidermal growth factor

ErbB1

epidermal growth factor receptor

GDNF

glial cell-derived neurotrophic factor

HB-EGF

heparin-binding epidermal growth factor

NSE

neuron-specific enolase

PND

postnatal day

SNC

substantia nigra pars compacta

TGFα

transforming growth factor alpha

TH

tyrosine hydroxylase

VTA

ventral tegmental area

Dopaminergic neurons in the substantia nigra (SN) receive neurotrophic supports from their target regions, such as the striatum (von Bohlen und Halbach and Unsicker 2009; González-Hernández et al. 2009). Studies in vivo and in vitro indicate that a variety of neurotrophic factors support cell survival and growth of SN dopaminergic neurons with significant redundancy. The neurotrophic factors include glial-derived neurotrophic factor (GDNF), conserved dopamine neurotrophic factor (CDNF), brain-derived neurotrophic factor (BDNF), epidermal growth factor (EGF), heparin-binding EGF-like growth factor (HB-EGF), and transforming growth factor alpha (TGFα), etc. (Hyman et al. 1991; Lin et al. 1993; Casper et al. 1991; Ho and Blum 1997; Lindholm et al. 2007). The neurotrophic activity of these proteins was initially identified by assaying tyrosine hydroxylase (TH) immunoreactivity or dopamine uptake in the neuronal cultures of mesencephalic origin that contain non-neuronal cells. Because some neurotrophic factors can also act on non-neuronal cells to stimulate the production of other trophic factors, the cellular source and target cell population of these neurotrophic factors are often controversial and, therefore, their effects on dopaminergic neurons are sometimes suggested to be indirect (Engele and Bohn 1991; Ho and Blum 1997).

EGF receptors (EGFR, ErbB1) are widely expressed in both the central and peripheral nervous systems, including SN area (Seroogy et al. 1994; Piao et al. 2005; Abe et al. 2009). The expression of ErbB1 in nigral dopaminergic neurons favors direct actions of ErbB1 ligands on this cell population (Blum 1998; Abe et al. 2009). Previous pathologic studies support this argument. The neurotrophic signals of ErbB1 ligands are diminished in patients with Parkinson’s disease (Iwakura et al. 2005). The exogenous neurotrophic supply with ErbB1 ligands rescues dopaminergic neurons from the cell death induced by the neurotoxins, 6-hydroxydopamine, or MPTP (Ventrella 1993; Gill et al. 2003; Iwakura et al. 2005). Conversely, the up-regulation of ErbB1 expression is found in the postmortem forebrain of schizophrenia patients (Futamura et al. 2002). Exogenous EGF supply during rat development results in the abnormal behavioral traits associated with hyper-dopaminergic pathology (Futamura et al. 2003; Nawa and Takei 2006). In an accompanying paper, we found that ErbB1 ligands are produced and released from striatal neurons in the dopamine-dependent manner (Iwakura et al. 2011). Despite the circumstantial evidence that ErbB1 ligands serves as retrograde neurotrophic signals acting on midbrain dopaminergic neurons, the neurotrophic nature of these factors has not been fully characterized.

By mainly examining dopaminergic markers and morphology in mesencephalic culture and postnatal rats and mice, here, we investigated the phenotypic influences of EGF, EGF-neutralizing antibody, ErbB1 inhibitors, and erbB1-gene disruption. The neurotrophic action of EGF was confirmed with in vivo administration of EGF and ErbB1 inhibitors and compared among the subsets of dopaminergic pathways. The pathologic implication of ErbB1 signals are also discussed in the dopamine-associated brain diseases such as schizophrenia.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Animals

Newborn rats with dams or pregnant rats (Sprague-Dawley; Japan SLC, Inc., Hamamatsu, Japan) were housed in a plastic cage (276 × 445 × 205 mm) under 12-h light/dark cycle (light on 7:00 am) and allowed free access to food and water. Recombinant human EGF (Higeta Shouyu Co. Ltd., Chiba Japan) was dissolved in saline. PD153305 (Sigma, St. Louis, MO, USA) and ZD1839 (Iressa; AstraZeneca, Stanhope Gate, London, UK) were dissolved in 100% dimethylsulfoxide and diluted to 0.1 mg/mL. Newborn rats subcutaneously received EGF (0.875 mg/kg, daily), PD153305 (1 mg/kg, daily), or ZD1839 (1 mg/kg, every other day) from postnatal day (PND) 2–9. Littermates received saline or 50% dimethylsulfoxide and served as control animals. We maintained erbB1-knockout mice with MF1 background and used for immunoblotting at the age of PND 7 (Sibilia et al. 1998). Animal care and experiments were performed in accordance with the guidelines of NIH (USA) and authorized by Animal Care and Use Committee of Niigata University.

Cell culture

Mesencephalic tissue was dissected from embryonic day (E) 15 fetuses in pregnant rats (Japan SLC, Inc.) or erbB1-knockout mice (CD-1, E14; Jackson Laboratory, Bar Harbor, ME, USA) (Threadgill et al. 1995), and dissociated with 1 mg/mL papain solution. Neurons from rat embryos were plated at a density of ∼ 1.0 × 106 cells/mL in Dulbecco’s modified Eagle’s medium and grown for 5 days in serum-free conditions, as described previously (Iwakura et al. 2001). Prior to preparation of mouse mesencephalic cultures, non-neuronal cells (mainly astrocytes) were prepared from mesencephalic tissue from normal mouse embryos (C57/BL6, E14; Japan SLC, Inc.) and grown in the presence of 10% fetal bovine serum. Non-neuronal cell cultures were subjected to intense trypsinization to let neuronal cells degenerate and plated onto culture wells as feeder cells. On days in vitro (DIV) 1 and 3, cultures were treated with growth factors: EGF (Higeta Shouyu Co. Ltd.), GDNF (R&D systems, Minneapolis, MN, USA), TGFα (Peprotech, Rocky Hill, NJ, USA), BDNF (Peprotech), and HB-EGF (R&D systems). Prior to the growth factor treatment, cultures were pre-incubated with the ErbB inhibitors; PD153035 (100 nm), ZD1839 (100 nm), and AG825 (100 nm). Alternatively, cultures were supplemented with GDNF-neutralizing antibody (5.0 μg/mL; R&D systems), EGF-neutralizing antibody (5.0 μg/mL; R&D Systems), or TrkB-Fc (10 μg/mL; R&D Systems) on DIV 1 and 3. The effective concentrations of the neutralizing antibodies were determined independently (data not shown). Conditioned medium was collected from EGF-treated rat mesencephalic cultures at the time of medium change and used as a growth medium.

To examine the specificity of the anti-ErbB1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) for immunostaining (see next), we prepared the cell lines which express human ErbB1, ErbB2, ErbB3, and ErbB4. Using Fugene 6 Transfection Reagent (Roche Diagnostics, Tokyo, Japan), mouse L929 cells were transfected with the mammalian expression vectors carrying human erbB1-4 cDNAs; pCO12-EGFR (Velu et al. 1989), pSV2-Her2 (Ullrich et al. 1984), pcDNA3.1-ErbB3 (Kinugasa et al. 2004), and pcDNA3.1-ErbB4 (Kinugasa et al. 2004), respectively.

Immunostaining

Cells were fixed with 4% paraformaldehyde in phosphate-buffered saline. Alternatively, brains were fixed with 4% paraformaldehyde, cryoprotected in 30% sucrose for 1 week at 4°C, and sectioned into 12 μm-thick coronal slices at −15°C. Fixed cultures or brain sections were incubated overnight at 4°C with an anti-TH antibody (1:1000; Hatanaka and Arimatsu 1984) or anti-ErbB1 antibody (1:200; Santa Cruz Biotechnology), and incubated for 1 h at 22–24°C with an anti-mouse or anti-rabbit IgG-biotin antibody (1:400; DakoCytomation, Glostrup, Denmark), Alexa Fluor 546 goat anti-rabbit IgG secondary antibody (1:400; Molecular Probes, Eugene, OR, USA) or Alexa Fluor 488 goat anti-mouse IgG secondary antibody (1:400; Molecular Probes). Following anti-mouse IgG-biotin, cells were incubated with avidin–biotin horseradish peroxidase complexes (VECTASTAIN Elite ABC kit; Vector, Burlingame, CA, USA). Staining was developed with diaminobenzidine (0.5 mg/mL in 50 mm Tris, pH 7.5) in the presence of H2O2. Images of immunoreactive neurons were collected with a Zeiss fluorescence microscope (Axioskop 50, Carl Zeiss, Germany). TH-immunoreactive cells were photographed with a digital camera (DP50-CU; Olympus optical co. LTD, Tokyo, Japan) using 40× oil immersion lens. Digital images were then converted to grayscale and processed by Adobe Photoshop 6.0 (Adobe, Seattle, WA, USA): Puncta carrying high intensity of TH immunoreactivity were isolated by setting the cutoff dynamic range to 164 in the 8-bit gray scale image. The number of puncta and that of area (pixel) showing the strong TH-immunofluorescence were counted with the NIH image software (National Institute of Health, Bethesda, MD, USA).

In situ hybridization

Rat erbB1 cDNA fragments were amplified by PCR using rat brain RNA as a template (NM_031507). The nucleotide sequences of the PCR primers were chosen from the extracellular domain of ErbB1 using the primer design program Primer3 (Rozen and Skaletsky 2000). SP6 and T7 promoter sequences were added to the 5′-end of the forward and reverse primers, respectively.

SP6-ErbB1 forward: cgatttaggtgacactatagaata-ggcacctttgaagaccactttctga

T7-ErbB1 reverse: cgatttaggtgacactatagaata-gtgactgtctggtctgccacaggtt

The digoxigenin (DIG)-labeled anti-sense or sense RNA probe was synthesized from amplified fragment for rat erbB1 cDNA (278 ∼ 890 nt for NM_031507) as fully described previously (Abe et al. 2009).

Immunoblotting

Protein levels of phospho-EGF receptor (phospho-ErbB1), EGF receptor (ErbB1), TH, dopamine transporter (DAT), dopamine beta-decarboxylase (DβH), and neuron-specific enolase (NSE) were determined by immunoblot analysis using methods similar to those described previously (Iwakura et al. 2005). Protein samples for immunoblotting were prepared from cultured cells or brain tissues by denaturing them with 2% sodium dodecyl sulfate. Samples were separated by SDS–polyacrylamide gel electrophoresis, and transferred to a polyvinylidene difluoride membrane (ImmobilonTM; Millipore, Billerica, MA, USA) by electrophoresis. The membrane was probed with anti-ErbB1 antibody (1 : 1000; Santa Cruz Biotechnology), anti-phospho-ErbB1 antibody (1 : 500; Santa Cruz Biotechnology), anti-DAT antibody (1 : 500; Chemicon, Temecula, CA, USA), anti-DβH antibody (1 : 1000; Sigma), anti-TH antibody (1 : 2000; Chemicon), or anti-NSE antibody (1 : 2000; Chemicon). After extensive washing, the immunoreactivity on the membrane was detected with anti-rabbit/mouse immunoglobulins conjugated to horseradish peroxidase, followed by a chemiluminescence reaction (Plus-ECL; PerkinElmer, Waltham, MA). Immunoreactivity on blots was quantified by densitometry.

Polymerase chain reaction

RNA was extracted from cultured L929 cells and subjected to reverse-transcriptase-coupled PCR. A forward primer (5′-GTCCCGAGCTAGCCCCGGCG-3′) and a reverse primer (5′-CCAAATTCCCAAGGACCACCTCACA-3′) were designed in the exon 1 and exon 2 of human erbB1 genome (NM_005228), respectively. Reverse transcription and DNA digestion were performed with Verso cDNA Synthesis Kits (Thermo Fisher Scientific, Yokohama, Japan). cDNA fragments were amplified with 35 cycles of 98°C/10 s and 68°C/30 s. PCR products were subjected to agarose gel electrophoresis in the presence of ethidium bromide (0.2 μg/mL).

Dopamine uptake

Dopamine uptake was assessed by incubating cultures for 30 min at 37°C in serum-free Dulbecco’s modified Eagle’s medium containing 37 kBq of [3H]-dopamine (1.4 TBq/mmol; PerkinElmer). The reaction was terminated by removing the medium and washing the cultures five times immediately with ice-cold medium. As a control for non-specific uptake, identical cultures were incubated on ice for the duration of the experiment. Cells were lysed and their radioactive content was counted as described previously (Iwakura et al. 2001).

Statistical analysis

All values are presented as mean ± SE. Data were subjected to anova and/or multiple comparisons with Scheffe’s test to evaluate the differences in immunocytochemistry, dopamine uptake, and immunoblots. P values < 0.05 were considered to be statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Co-localization of EGF receptor and TH in developing rat SN

Our previous study on mice indicate that a significant proportion of mouse midbrain dopaminergic neurons express erbB1 mRNA (Abe et al. 2009). Using immunohistochemical and in situ hybridization techniques, we re-examined the distributions of ErbB1 protein and mRNA in postnatal rats (Figs 1 and 2). The anti-TH antibody and anti-ErbB1 antibody stained cells in the ventral tegmental area (VTA) and substantia nigra pars compacta (SNC) of postnatal rats (PND9) (Fig. 1a and b). ErbB1 immunoreactivity in the SNC appeared to be higher than that in the VTA (Fig. 1b, e, f). In the VTA, about half of the TH-immunoreactive cells (Fig. 1c) were positive for ErbB1 immunoreactivity (55.0 ± 3.4%; Fig. 1g) and a majority of TH-immunoreactive cells in the SNC (Fig. 1d) exhibited ErbB1 immunoreactivity (71.7 ± 2.1%; Fig. 1h) (n = 12 sections from three animals). The authenticity and specificity of the anti-ErbB1 antibody was confirmed by immunostaining (Fig. 1g). The anti-ErbB1 antibody recognized the L929 cells transfected with erbB1 cDNA. ErbB1 immunoreactivity of parental L929 cells and the cells transfected with cDNAs for the other members of ErbB family (i.e. erbB2–4) was modest or negligible. Moreover, immunoblotting with this anti-ErbB1 antibody revealed that ErbB1 immunoreactivity in wild-type mice disappeared in erbB1-knockout mice (see next).

image

Figure 1.  ErbB1 immunoreactivity detected in the subpopulation of midbrain dopaminergic neurons. Midbrain sections were prepared from fixed postnatal rats (PND9) and treated with the anti-TH and/or anti-ErbB1 antibodies and visualized with Alexa 488-conjugated secondary antibody for TH (green; a, c, d, g, h) and the diaminobenzidine-ABC method for ErbB1 (brown in b, e, f; red in g, h). In (g) and (h), the ErbB1 immunoreactivity was color inverted and artificially colored with red and overlaid with the TH images. Arrowheads mark cells expressing both TH and ErbB1 and showing the color of yellow or orange. (i) Specificity of the anti-ErbB1 antibody was examined by immunostaining. L929 cells were transfected with the mammalian expression vectors carrying human erbB1, erbB2, erbB3, and erbB4 cDNA and immunostained with the above anti-ErbB1 antibody. Parental L929 cells do not express detectable levels of ErbB1-4 proteins (data not shown).

Download figure to PowerPoint

image

Figure 2.  Distributions of erbB1 mRNA detected in midbrain dopaminergic neurons. Midbrain sections from fixed postnatal rats (PND9) were hybridized with a DIG-labeled anti-sense RNA probe for rat erbB1 mRNA (red in c, d) followed by immunostaining with anti-TH antibody (green in a, b). In (e) and (f), ErbB1 immunoreactivity was overlaid with the TH images. Arrowheads mark cells expressing both TH and ErbB1 and showing the color of yellow or orange. Similar results were obtained from three littermates examined independently. Note: A DIG-labeled sense RNA probe failed to give any significant hybridization signal (data not shown). (g) L929 cells were transfected with the mammalian expression vector containing human erbB1 cDNA. ErbB1 protein and mRNA amounts in culture dishes were determined in the parental cells (day 0) and 0.1 (only for mRNA), 2, 4, and 8 days after transfection. Ten percent of the whole cell lysate and 4% of total RNA from each culture dish were subjected to immunoblotting and RT-PCR, respectively, The size of the PCR product agrees with the predicted one (367 bp).

Download figure to PowerPoint

We also performed in situ hybridization of erbB1 mRNA in this region and combined it with TH immunohistochemistry (Fig. 2). In situ hybridization revealed that 15.6 ± 4.2% of TH-positive cells in the SNC (Fig. 2b) displayed hybridization signals for erbB1 mRNA (Fig. 2d and f), whereas 4.0 ± 1.8% of TH-positive cells in the VTA (Fig. 2a) were positive for erbB1 mRNA (Fig. 2c and e) (= 6 sections from two animals). The frequency of erbB1 mRNA-positive dopaminergic cells was lower than that of the cells positive for immunoreactivity for ErbB1 protein.

We explored the difference in the frequencies of erbB1 mRNA and antibody signals in dopaminergic neurons. We assessed the protein and mRNA stability of ErbB1 by transiently transfecting human erbB1 cDNA to mouse L929 cells (Fig. 2g). There was an apparent difference in time courses of their expression levels following transient transfection. RT-PCR verified the absence of erbB1 mRNA 4 days after transfection whereas immunoblotting revealed the continuation of ErbB1 protein expression over 8 days. This result suggests that the difference in mRNA and protein stability potentially contributes to the discrepancy between ErbB1 immunoreactivity and mRNA found in the midbrain.

EGF promotes survival and neurite extension of dopaminergic neurons in culture

We prepared primary neuronal cultures from embryonic rat mesencephalon at mid-gestation and treated them with EGF. The cell density and neuronal morphology of TH-immunoreactive cells were compared with neurons grown with GDNF or with culture medium alone (control). EGF treatment increased the number of TH-positive cells to a similar degree as GDNF (a 1.50-fold increase for EGF and a 1.57-fold increase for GDNF) (Table 1 and Fig. 3). Both factors enlarged the size of the soma. EGF was as potent as GDNF at enhancing the neurite extension of TH-positive neurons. Similar effects of EGF were obtained with other ErbB1 ligands, TGFα, and HB-EGF (data not shown). A number of TH-positive cells in culture were also immunoreactive for the anti-ErbB1 antibody (Fig. 3d–f). However, culturing dopaminergic neurons at rat mid-gestation appeared to elevate their ErbB1 expression to the postnatal level (P8) (Figure S1), suggesting that the EGF effects observed in embryonic culture might rather reflect their responses at the postnatal stage.

Table 1.   Effects of neurotrophic factors on TH-positive cells in rat mesencephalic cultures
 TH(+) neuron (per 1000 cells)Total neurite length (μm)Branch number(per cell)Branch point(per cell)Soma area (μm2)
  1. Mesencephalic cultures were treated with control vehicle, EGF (20 ng/mL), or GDNF (20 ng/mL) on DIV1 and 3. On DIV5, cultures were fixed and immunostained with an anti-TH antibody. A TH-positive cell was photographed with a 40× objective lens and its morphology was analyzed in each picture. = 20 cells in 20 microscopic fields from four sister cultures, mean ± SE. ***< 0.001, **< 0.01, *< 0.05, compared with control. Representative cell morphology is shown in Fig. 2.

Control114 ± 21256 ± 8810.2 ± 3.98.0 ± 3.483.6 ± 19
EGF171 ± 21***451 ± 185***13.4 ± 7.111.7 ± 5.4107 ± 18*
GDNF180 ± 28***391 ± 76**17.5 ± 5.3***13.1 ± 4.5**115 ± 24**
image

Figure 3.  EGF exhibits neurotrophic effects on dopaminergic neurons in rat mesencephalic cultures. Mesencephalic cultures were treated with control vehicle (saline, a), EGF (20 ng/mL, b), GDNF (20 ng/mL, c) on DIV1 and 3. On DIV5, cultures were fixed and immunostained with the anti-TH antibody. Representative pictures are displayed. Effects of the given factors on the morphology of TH-positive cells were quantified (see Table 1). Control cultures were immunostained with the anti-TH (d) and anti-ErbB1 (e) antibodies. (f) Both images were merged after red-color conversion of ErbB1 immunoreactivity. Arrowheads mark the cells immunoreactive for both TH and ErbB1.

Download figure to PowerPoint

Tyrosine hydroxylase is the rate-limiting enzyme in the conversion of l-dihydroxyphenylalanine to dopamine and present in both dopaminergic and noradrenergic neurons. Although we carefully dissected the embryonic midbrain, minor contamination of noradrenergic neurons from the hindbrain was technically unavoidable. We employed DAT as a marker for dopaminergic neurons and DβH as a marker for noradrenergic neurons (Fig. 4a). Immunoblotting revealed that EGF-elevated TH and DAT levels but not DβH levels in mesencephalic cultures. These results suggest that the neurotrophic activity of the ErbB1 ligands on noradrenergic neurons appeared to be limited.

image

Figure 4.  The activation of ErbB1 receptors enhances phenotypic development of mesencephalic dopaminergic neurons in culture. Mesencephalic cultures were treated with control vehicle or EGF (20 ng/mL) on DIV1 and 3. Some of the cultures were additionally supplied with ErbB1 inhibitors (100 nm PD153035 or 100 nm ZD1839). (a) Cell lysates were prepared from DIV5 sister cultures (= 4) and subjected to SDS–PAGE and immunoblotting for phospho-ErbB1, ErbB1, TH, DAT, DβH, and NSE. Typical immunoblots are shown. Effects of EGF (c), PD153035 (d), ZD1839 (e), and AG825 (f) on cell morphology were examined by TH immunostaining and compared with those of control culture (b). These cultures were fixed and immunostained with an anti-TH antibody to visualize dopaminergic neurons. Morphological features of TH-positive cells were determined (see Table 2). The ErbB1 inhibitors attenuated neurite extension and soma growth.

Download figure to PowerPoint

To confirm the contribution of ErbB1 to the EGF action, we assessed the effects of the ErbB1-specific inhibitors, PD153035 and ZD1839 (Fry et al. 1994) (Fig. 4b–e). The simultaneous application of PD153035 or ZD1839 abolished the EGF effects on TH-positive cells (Table 2). The neurite extension promoted by EGF was markedly attenuated as well. However, total cell proliferation in culture dishes appeared not to be influenced by the ErbB1 inhibitors (control: 100 ± 7.7%, EGF: 104.6 ± 7.0%, PD153035 + EGF: 97.0 ± 8.6%, ZD1839 + EGF: 97.9 ± 9.0%). In contrast, an ErbB2 inhibitor, AG825, failed to block the EGF-dependent increase in cell number and neurite extension of this population (Fig. 4f; Table 2). These results demonstrated that ErbB1 activation is required to promote dopaminergic differentiation and survival in mesencephalic cultures.

Table 2.   Effects of ErbB1 inhibitors on TH-positive cells in rat mesencephalic cultures
 Frequency of TH neurons (per 1000 cells)Total neurite length (μm)Branch number (per cell)Branch point (per cell)Soma area (μm2)
  1. Mesencephalic cultures form rat embryos were treated with control vehicle, EGF (20 ng/mL) on DIV1 and 3. Some culture wells were pre-incubated with PD153035 (100 nm), ZD1839 (100 nm) or AG825 (100 nm) for 2 h before EGF treatment. On DIV5, cultures were fixed and similarly analyzed as described in Table 1. = 20 cells in 20 microscopic fields from four sister cultures, mean ± SE, **< 0.01, *< 0.05, compared with control. Representative pictures are shown in Fig. 4.

Control102 ± 5251 ± 1813.7 ± 1.010.9 ± 0.9101 ± 7
EGF143 ± 6**468 ± 28**16.6 ± 1.212.8 ± 1.0126 ± 7*
EGF + PD15303597 ± 5277 ± 1511.3 ± 1.07.9 ± 0.893 ± 6
EGF + ZD183990 ± 5240 ± 199.6 ± 0.95.8 ± 0.7**86 ± 4
EGF + AG825140 ± 5**491 ± 35*18.3 ± 1.114.1 ± 1.1118 ± 6

To compare quantitatively the potency of EGF with GDNF, we determined the dose response curves for stimulated dopamine uptake in mesencephalic cultures (Fig. 5a). Increasing concentrations of EGF and GDNF gradually enhanced dopamine uptake. EGF was as potent as GDNF at increasing dopamine uptake. In contrast, HB-EGF was less potent at enhancing dopamine uptake, presumably because of the inhibitory influence of heparin-like molecules (Takazaki et al. 2004). As the glial contamination was unavoidable in mesencephalic cultures, EGF challenge might stimulate the glial production of other neurotrophic factors, such as GDNF and BDNF. To test this possibility, mesencephalic cultures were supplemented with GDNF-neutralizing antibody or TrkB-Fc together with EGF (Fig. 5b and c). Neither the GDNF antibody or TrkB-Fc attenuated the EGF effects on dopamine uptake. However, the GDNF antibody and TrkB-Fc fully blocked the GDNF-triggered and BDNF-triggered increases in dopamine uptake, respectively, and these agents alone had no significant effects in control cultures. As there are many neurotrophic factors reported for dopaminergic neurons, it was still possible that EGF recruited other neurotrophic molecules. We collected culture supernatants conditioned with EGF-treated mesencephalic cells. We added this conditioned medium and/or EGF-neutralizing antibody to independent mesencephalic cultures (Fig. 5d). Treatment with the conditioned medium alone elevated dopamine uptake as high as EGF did, while its co-treatment with the anti-EGF antibody decreased dopamine uptake to the control level. These results suggest that the conditioned medium contained no detectable levels of neurotrophic molecules other than EGF.

image

Figure 5.  Comparative up-regulation of dopamine uptake by EGF and GDNF in dopaminergic cultures. (a) Mesencephalic cultures were treated with vehicle or various concentrations (20 pg/mL ∼ 200 ng/mL) of EGF, GDNF, HB-EGF on DIV1 and 3. On DIV5, cultures were incubated with [3H]-dopamine (3.7 × 104 Bq/mL) for 30 min in 37°C (= 4). Background levels were estimated by measuring [3H]-dopamine uptake/binding on ice. (b) Mesencephalic cultures were treated with vehicle (−), EGF (20 ng/mL), GDNF (20 ng/mL), and/or GDNF-neutralizing antibody (Ab; 5 μg/mL) on DIV1 and 3. (c) Alternatively, cultures were treated with vehicle (−), EGF (20 ng/mL), BDNF (20 ng/mL), and/or TrkB-Fc (10 μg/mL). (d) In the presence or absence of EGF-neutralizing antibody (Ab; 5 μg/mL), midbrain dopaminergic neurons were treated with EGF in plain medium or conditioned medium taken from EGF-stimulated mesencephalic cultures. ***< 0.001, **< 0.01, *< 0.05, compared with EGF (−) and Ab (−) control culture. +++p < 0.001, compared with EGF (+) and Ab (−) culture. Bars indicate mean ± SE.

Download figure to PowerPoint

Attenuation of dopaminergic development in mesencephalic culture from erbB1-deficient mice

It has been controversial whether the trophic activity of EGF on dopaminergic neurons, at least in parts, reflects a direct action on these neurons, or not (Engele and Bohn 1991; Ho and Blum 1997; Wagner et al. 2006). We examined the effects of EGF on the dopaminergic neurons prepared from erbB1-deficient mice. Midbrain neurons were dissected from wild-type or erbB1-homozygous mutant embryos and plated onto glial-feeder cells prepared from wild-type embryos (Fig. 6; Table 3). In neuronal cultures from wild-type mice, EGF treatment significantly increased the cell number of TH-positive cells and promoted their neurite extension. These results mirrored our observations with neuronal cultures from rat midbrain. In contrast, when dopaminergic neurons were prepared from erbB1-knockout mice, they exhibited a markedly reduced response to EGF even grown in the presence of wild-type glial cells. The erbB1-deficient dopaminergic cells extended shorter neurites. This morphology resembles that induced by the pharmacological treatment with ErbB1 inhibitors (Fig. 4). In comparison with control cultures from wild-type mice, the erbB1 mutant cultures contained fewer TH-positive neurons (Table 3). Therefore, we conclude that ErbB1 signals, at least in parts, directly act on midbrain dopaminergic neurons.

image

Figure 6.  EGF fails to promote cell survival and neurite extension of dopaminergic neurons deficient of ErbB1. Mesencephalic cultures were prepared from wild-type (WT; a, b) and erbB1-knockout (KO; c, d) mouse embryos (E15, = 2 pooled) and plated on a feeder layer of non-neuronal cells, which had been prepared from normal mouse embryos. Cultures were treated with control vehicle (a, c) and EGF (20 ng/mL; b, d) on DIV1 and 3 (= 4 sister cultures for each group). Cultures were fixed on DIV5 and immunostained with the anti-TH antibody. Representative images are shown for display. Morphological features of TH-positive cells were quantified (see Table 3). Note: The dendritic polarity of TH-positive cells from erbB1-knockout mice resembles the dopaminergic neurons cultured with the ErbB1 inhibitors (see Fig. 4).

Download figure to PowerPoint

Table 3.   Effects of EGF on TH-positive neurons in cultures from wild-type or erbB1-knockout mice midbrain
 TH(+) neuronTotal neurite length (μm)Branch number(per cell)Branch point(per cell)Soma area (μm2)
  1. Non-neuronal cells were prepared from mesencephalic tissue of normal mouse embryos and grown in the presence of fetal bovine serum. After one passage, non-neuronal cells were plated as feeder cells. ErbB1-deficient or wild-type dopaminergic neurons were plated on these cells and grown in serum-free condition with or without EGF (20 ng/mL). On DIV5, cultures were fixed and immunostained with an anti-TH antibody. Neuronal morphology was analyzed as described in Table 1. = 20 cells in 20 microscopic fields from 4 sister cultures, mean ± SE, **< 0.01, *< 0.05, compared with wild-type. Representative pictures are shown in Fig. 5.

Wild-type259 ± 15331 ± 3010.6 ± 0.97.4 ± 0.8119 ± 7
Wild-type + EGF339 ± 17**580 ± 43**13.1 ± 1.39.1 ± 1.0143 ± 5*
Knockout129 ± 7**269 ± 2114.0 ± 1.18.9 ± 0.8109 ± 4
Knockout + EGF124 ± 8**328 ± 2314.8 ± 1.0*9.5 ± 0.9109 ± 5
Feeder alone19 ± 2**    

In vivo administration of ErbB1 inhibitors attenuates phenotypic development of nigrostriatal dopaminergic neurons

The ErbB1 inhibitors, PD153035 and ZD1839, were subcutaneously administered to neonatal rats during PND2–9. These compounds appeared to penetrate the immature blood–brain barrier (Cornford and Cornford 1986), and decreased basal ErbB1 phosphorylation in the brain (Fig. 7a). Repetitive treatment with ErbB1 inhibitors resulted in a significant reduction in TH and DAT levels in the striatum, nucleus accumbens, and globus pallidus (Fig. 7c–e). However, DβH level were not significantly changed. There were no significant reductions in either TH or DAT levels in the frontal cortex (Fig. 7b). There were no significant alterations in levels of the neuron marker NSE in the present experimental paradigm (data not shown).

image

Figure 7. In vivo administration of ErbB1 inhibitors decreases the expression of TH and DAT in the striatum. Newborn rats were injected with control vehicle, PD153035 (1 mg/kg, daily), or ZD1839 (1 mg/kg, every other day) from PND2–9. On PND10, protein extracts were prepared from the target regions of midbrain dopaminergic neurons and subjected to immunoblotting for phospho-ErbB1, dopaminergic and noradrenergic markers. (a) PD153035 and ZD1839 both inhibited the phosphorylation of ErbB1 in striatum, which controls the in vivo effect of these inhibitors. The effects of ErbB1 inhibitors on dopaminergic fibers and terminals were estimated by determining protein immunoreactivity for TH, DAT, DβH, and NSE in frontal cortex (b), striatum (c), nucleus accumbens (d), and globus pallidus (e). Two representative lanes of immunoblots are provided for display. = 4 pups, ***< 0.001, **< 0.01, *< 0.05. Bars represent mean ± SE.

Download figure to PowerPoint

The above observations of immunoblotting agreed with the subsequent immunohistochemical analysis of TH expression. TH immunoreactivity was markedly decreased in the striatum (Fig. 8). Low magnification images reveal that application of ErbB1 inhibitors decreased the intensity of TH immunoreactivity (Fig. 8a–f). When we counted the number and area of only varicosities exhibiting high TH-immunofluorescence, there were significant decreases in these indices in PD153035- and ZD1839-treated animals (Fig. 8g and h). These results suggest that postnatal treatment with ErbB1 inhibitors attenuate differentiation or maturation of TH-positive varicosities or terminals.

image

Figure 8.  ErbB1 blockade reduces the density of TH-immunoreactive varicosities in the striatum. Effects of ErbB1 inhibitors on putative dopaminergic terminals were estimated by counting the number of strongly TH-positive puncta in the striatum. Newborn rats were challenged with vehicle (a, b), PD153035 (c, d), and ZD1839 (e, f) and subsequently brain sections were prepared as described in Materials and methods. (a, c, e) TH-immunoreactive puncta in the striatum were photographed with a digital camera. (b, d, f) A part of the picture (corresponding to windows in a, c, e) was clipped out to avoid nerve fiber regions and processed by Photoshop. Only puncta carrying the high intensity of TH immunoreactivity were isolated by eliminating fluorescent signals below 67% of the 256-bit full dynamic range and converted to a two-tone color image (see windows in b, d, f). The number of the TH-positive puncta as well as the total size of their areas were measured by the NIH image software and plotted in panels (g) and (h), respectively. Note: In the windows of (b), (d), and (f), the TH-positive puncta in each panel are marked with the same size of red dots to display all the isolated puncta, irrespective of their sizes. = 20 microscopic fields from two rats for each group, ***< 0.001, **< 0.01, *< 0.05. Bars represent mean ± SE. Red lines represent the equal size of individual window’s rectangles.

Download figure to PowerPoint

Postnatal erbB1-deficient mice exhibit decreases in TH levels

To confirm the neurotrophic contribution of ErbB1 signaling to postnatal dopaminergic development in vivo, we studied TH expression in erbB1-deficient mice (Fig. 9). The knockout mice carrying MF1 background are known to survive postnatally (Sibilia et al. 1998; Wagner et al. 2006). Immunoblotting revealed that there were significant decreases in TH levels in the striatum and SN of the homozygous mutant mice (PND7). Heterozygous mutant mice exhibited moderate decreases in TH levels, compared with those in wild-type littermates. These results suggest that endogenous ErbB1 signals are required for normal dopaminergic development.

image

Figure 9.  Striatal reduction in tyrosine hydroxylase levels in postnatal erbB1-deficient mice. On PND7, protein tissue extracts were prepared from right and left hemispheres of midbrain and striatum of homozygous (−/−), heterozygous (+/−), and wild-type (+/+) littermates of erbB1-deficient mice and subjected to immunoblotting for TH, NSE, and ErbB1. The effects of erbB1-deficiency on dopaminergic neurons and terminals were estimated by determining immunoreactivity for TH in striatum and midbrain. (a) Three representative lanes of immunoblots are provided for each genotype for display. (b) TH immunoreactivity was measured by densitometric analysis and its ratio to the mean control level was plotted. Note: There was no significant reduction of the neuronal marker NSE in both brain regions examined (F2,15 = 1.77, = 0.20 for striatum, F2,15 = 2.11, = 0.16 for midbrain, anova). = 6 (three mice × both hemispheres), ***< 0.001, **< 0.01, *< 0.05. Bars represent mean ± SE.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The present investigations revealed that EGF promotes morphologic and neurochemical development of cultured midbrain dopaminergic neurons. Conversely, the application of the ErbB1 tyrosine kinase inhibitors attenuated dopaminergic development in vivo and in vitro. We failed to detect no significant effects of secondarily produced neurotrophic molecules in EGF-stimulated mesencephalic cultures. In agreement, neuronal cultures from mice lacking erbB1 did not exhibit a trophic response to EGF. The trophic action of the ErbB1 ligand was not apparent in noradrenergic neurons or corticolimbic dopamine fibers, however. The accompanying paper revealed that the striatal tissue of postnatal rats contains 5–10 pg EGF per mg protein (Iwakura et al. 2011). This is roughly equivalent to ∼ 0.5 ng EGF per gram tissue. The dose responsiveness to EGF in Fig. 5 suggests that the postnatal striatum contains biologically active concentrations of EGF in vivo. This argument is further supported by the fact that postnatal erbB1-deficient mice exhibit TH reduction. Therefore, endogenous EGF exerts a neurotrophic activity on developing midbrain dopaminergic neurons, although the EGF effects in embryonic culture might be overestimated with the given increase in ErbB1 expression.

Selectivity of the neurotrophic action of EGF on nigral dopaminergic neurons

Cultured dopaminergic neurons responded to EGF to extend neurites and enlarge their soma size. At the postnatal stage, a subset of dopaminergic neurons showed the response to EGF. Dopaminergic neurons positive for ErbB1 immunoreactivity were more frequent in the SNC than those in VTA, although the density of erbB1 mRNA signals were much lower than that of the immunoreactivity. We also found a significant difference between ErbB1 protein and mRNA levels following transient transfection of erbB1 cDNA. Thus, the discrepancy of the protein and mRNA distributions in situ might be owing to the difference in their stability.

The denser distributions of ErbB1 immunoreactivity in the SNC might explain the regional difference in the in vivo effects of ErbB1 inhibitors. Postnatal treatment with ErbB1 inhibitors attenuated development of nigrostriatal dopaminergic fibers but not VTA-corticolimbic dopaminergic fibers as estimated by TH expression in their target regions. Therefore, the present results indicate that the in vivo neurotrophic effect of ErbB1 signals is limited to the subset of midbrain dopaminergic neurons or pathways (Solbrig et al., 2004).

Neurotrophic interplay of ErbB1 signals with other neurotrophic pathways

Although previous reports have suggested that EGF, TGFα, and HB-EGF have trophic action on midbrain dopaminergic neurons, these conclusions have remained controversial, especially with regard to whether these trophic effect are direct (or not) (Casper et al. 1991; Engele and Bohn 1991; Ho and Blum 1997). As the subset of dopaminergic neurons express ErbB1 and their loss of this receptor reduced the sensitivity to EGF, we suggest that the observed trophic action of EGF is, at least in part, a consequence of EGF binding and activating ErbB1 present on dopaminergic neurons.

Midbrain dopaminergic neurons receive redundant neurotrophic supports from various molecules such as EGF, GDNF, CDNF and BDNF (von Bohlen und Halbach and Unsicker 2009; González-Hernández et al. 2009). Although their target cell populations differ, these factors all bind to receptor tyrosine kinases and activate a common set of signal cascades. The similarity in morphologic and neurochemical responses to EGF and GDNF suggests the involvement of common molecular mechanism underlying these responses. Among those, GDNF is a well-known neurotrophic factor that is mainly produced by glial cell population (Lin et al. 1993). A part of astrocytes in the midbrain region express erbB1 mRNA (Abe et al. 2009). Thus, we assumed that EGF stimulation might let glial cells secondarily produce other neurotrophic signals, such as GDNF and BDNF, to contribute to the neurotrophic phenomena. However, both GDNF-neutralizing antibody and TrkB-Fc failed to attenuate the neurotrophic action of EGF in culture. Moreover, EGF-neutralizing antibody fully blocked the neurotrophic activity of the conditioned medium from EGF-stimulated mesencephalic cultures. These results indicate that a significant part of the observed neurotrophic actions can be ascribed to EGF iteslf, although we do not rule out the possibility that glial cell-derived factors also co-operatively promote dopaminergic cell survival and differentiation, especially in vivo.

Implication of EGF/ErbB1 signals in neurological and psychiatric diseases associated with dopaminergic dysfunction

The given trophic function of ErbB1 signaling, this pathway may contribute to neurological or psychiatric disorders resulting from dopaminergic dysfunction. Iwakura et al. (2005) report that there is a significant depletion of ErbB1 protein in the striatum of patients with Parkinson’s disease. Further, intrastriatal supplement of EGF attenuates the degeneration of nigrostriatal dopaminergic neurons in a model for Parkinson’s disease, consistent with our conclusions (Ventrella 1993). Conversely, there is the up-regulation of ErbB1 receptors in the striatum of patients with schizophrenia and hyperactivity of the dopamine system is often implicated for positive symptoms of this disease (Goldstein and Deutch 1992; Seeman 1993; Futamura et al. 2002). The marked stability of ErbB1 protein indicates that the regulation of ErbB1 protein expression is independent of its mRNA transcription and might contribute to the ErbB1 pathology of Parkinson’s disease or schizophrenia, although the molecular nature of the regulators for ErbB1 protein stability and/or degradation remains to be explored.

In experimental animals, subcutaneous administration of EGF into neonatal rats stimulates brain ErbB1 receptors and up-regulates TH expression and dopamine metabolism in the striatum (Futamura et al. 2003; Tohmi et al. 2005). Such rodents treated with EGF as neonates develop various cognitive and behavioral impairments at adult stages and serve as an animal model for schizophrenia (Futamura et al. 2003; Mizuno et al. 2004; Tohmi et al. 2005). In total, these preceding reports combined with present findings support the assumption that perturbation of ErbB1 signaling may contribute to the pathologic and/or etiological development of various brain diseases in which dopaminergic dysfunction has been implicated.

At least six different proteins are known to bind to and activate ErbB1 receptors. In addition, neuregulin-1 also activates ErbB1 receptor signaling through ErbB1/ErbB4 or ErbB1/ErbB3 dimerization (Zscheppang et al. 2006). How these ErbB1–4 ligands function independently and in combination to support dopaminergic development in vivo may be difficult to elucidate. Continued efforts by our group, and others, will examine how these ligands contribute to the development and regulation of dopaminergic functions in both physiological and pathological contexts.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

This work was supported by a grant-in-aid for Basic Scientific Research B (JSPS), grants for Promotion Research Projects and Young Investigators of Niigata University, Core Research for Evolutional Science and Technology from the JST Corporation, and a grant-in-aid from the Ministry of Health, Labor and Welfare, Japan. We are grateful to Dr Higashiyama and Riken BRC DNA bank for the gift of erbB1–4 cDNAs.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
  • Abe Y., Namba H., Zheng Y. and Nawa H. (2009) In situ hybridization reveals developmental regulation of ErbB1-4 mRNA expression in mouse midbrain: implication of ErbB receptors for dopaminergic neurons. Neuroscience 161, 95110.
  • Blum M. (1998) A null mutation in TGF-alpha leads to a reduction in midbrain dopaminergic neurons in the substantia nigra. Nat. Neurosci. 1, 374377.
  • von Bohlen und Halbach O. and Unsicker K. (2009) Neurotrophic support of midbrain dopaminergic neurons, in Development and Engineeringof Dopamine Neurons (PasterkampR. J. et al. , eds.), pp. 7377. Springer Sceince, New York.
  • Casper D., Mytilineou C. and Blum M. (1991) EGF enhances the survival of dopamine neurons in rat embryonic mesencephalon primary cell culture. J. Neurosci. Res. 30, 372381.
  • Cornford E. M. and Cornford M. E. (1986) Nutrient transport and the blood-brain barrier in developing animals. Fed. Proc. 45, 20652072.
  • Engele J. and Bohn M. C. (1991) The neurotrophic effects of fibroblast growth factors on dopaminergic neurons in vitro are mediated by mesencephalic glia. J. Neurosci. 11, 30703078.
  • Fry D. W., Kraker A. J., McMichael A., Ambroso L. A., Nelson J. M., Leopold W. R., Connors R. W. and Bridges A. J. (1994) A specific inhibitor of the epidermal growth factor receptor tyrosine kinase. Science 265, 10931095.
  • Futamura T., Toyooka K., Iritani S., Niizato K., Nakamura R., Tsuchiya K., Someya T., Kakita A., Takahashi H. and Nawa H. (2002) Abnormal expression of epidermal growth factor and its receptor in the forebrain and serum of schizophrenic patients. Mol. Psychiatry 7, 673682.
  • Futamura T., Kakita A., Tohmi M., Sotoyama H., Takahashi H. and Nawa H. (2003) Neonatal perturbation of neurotrophic signaling results in abnormal sensorimotor gating and social interaction in adults: implication for epidermal growth factor in cognitive development. Mol. Psychiatry 8, 1929.
  • Gill S. S., Patel N. K., Hotton G. R., O’Sullivan K., McCarter R., Bunnage M., Brooks D. J., Svendsen C. N. and Heywood P. (2003) Direct brain infusion of glial cell line-derived neurotrophic factor in Parkinson disease. Nat. Med. 9, 589595.
  • Goldstein M. and Deutch A. Y. (1992) Dopaminergic mechanisms in the pathogenesis of schizophrenia. FASEB J. 6, 24132421.
  • González-Hernández T., Afonso-Oramas D. and Cruz-Muros I. (2009) Phenotype, compartmental organization and differential vulnerability of nigral dopaminergic neurons. J. Neural Transm. Suppl. 73, 2137.
  • Hatanaka H. and Arimatsu Y. (1984) Monoclonal antibodies to tyrosine hydroxylase from rat pheochromocytoma PC12h cells with special reference to nerve growth factor-mediated increase of the immunoprecipitable enzymes. Neurosci. Res. 1, 253263.
  • Ho A. and Blum M. (1997) Regulation of astroglial-derived dopaminergic neurotrophic factors by interleukin-1 beta in the striatum of young and middle-aged mice. Exp. Neurol. 148, 348359.
  • Hyman C., Hofer M., Barde Y. A., Juhasz M., Yancopoulos G. D., Squinto S. P. and Lindsay R. M. (1991) BDNF is a neurotrophic factor for dopaminergic neurons of the substantia nigra. Nature 350, 230232.
  • Iwakura Y., Nagano T., Kawamura M., Horikawa H., Ibaraki K., Takei N. and Nawa H. (2001) N-methyl-D-aspartate-inducedalpha-amino-3-hydroxy-5-methyl-4-isoxazoleproprionic acid (AMPA) receptor down-regulation involves interaction of the carboxyl terminus of GluR2/3 with Pick1. Ligand-binding studies using Sindbis vectors carrying AMPA receptor decoys. J. Biol. Chem. 276, 4002540032.
  • Iwakura Y., Piao Y. S., Mizuno M., Takei N., Kakita A., Takahashi H. and Nawa H. (2005) Influences of dopaminergic lesion on epidermal growth factor-ErbB signals in Parkinson’s disease and its model: neurotrophic implication in nigrostriatal neurons. J. Neurochem. 93, 974983.
  • Iwakura Y., Wang Y., Abe Y., Piao Y. S., Shishido Y., Higashiyama S., Takei N. and Nawa H. (2011) Dopamine-dependent ectodomain shedding and release of epidermal growth factor in developing striatum: target-derived neurotrophic signaling (Part 2). J. Neurochem. 118, 5768.
  • Kinugasa Y., Ishiguro H., Tokita Y., Oohira A., Ohmoto H. and Higashiyama S. (2004) Neuroglycan C, a novel member of the neuregulin family. Biochem. Biophys. Res. Commun. 321, 10451049.
  • Lin L. F., Doherty D. H., Lile J. D., Bektesh S. and Collins F. (1993) GDNF: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons. Science 260, 11301132.
  • Lindholm P., Voutilainen M. H., Laurén J. et al. (2007) Novel neurotrophic factor CDNF protects and rescues midbrain dopamine neurons in vivo. Nature 448, 7377.
  • Mizuno M., Malta R. S., Nagano T. and Nawa H. (2004) Conditioned place preference and locomotor sensitization after repeated administration of cocaine or methamphetamine in rats treated with epidermal growth factor during the neonatal period. Ann. N Y Acad. Sci. 1025, 612618.
  • Nawa H. and Takei N. (2006) Recent progress in animal modeling of immune inflammatory processes in schizophrenia: implication of specific cytokines. Neurosci. Res. 56, 213.
  • Piao Y. S., Iwakura Y., Takei N. and Nawa H. (2005) Differential distributions of peptides in the epidermal growth factor family and phosphorylation of ErbB 1 receptor in adult rat brain. Neurosci. Lett. 390, 2124.
  • Rozen S. and Skaletsky H. (2000) Primer3-web 0. 3. 0. Available at: http://primer3.sourceforge.net/.
  • Seeman P. (1993) Schizophrenia as a brain disease. The dopamine receptor story. Arch. Neurol. 50, 10931095.
  • Seroogy K. B., Numan S., Gall C. M., Lee D. C. and Kornblum H. I. (1994) Expression of EGF receptor mRNA in rat nigrostriatal system. Neuroreport 6, 105108.
  • Sibilia M., Steinbach J. P., Stingl L., Aguzzi A. and Wagner E. F. (1998) A strain-independent postnatal neurodegeneration in mice lacking the EGF receptor. EMBO J. 17, 719731.
  • Solbrig M., Fallon J. and Liplin I. (2004) Drawings of some other features of the SN-VTA, including dopamine transporter sites, cannabinoid receptors, and different nuclei and fiber tracts in the SN-VTA, in The Rat Nervous System (PaxinosG., ed.), p. 229. Academic Press, Australia.
  • Takazaki R., Shishido Y., Iwamoto R. and Mekada E. (2004) Suppression of the biological activities of the epidermal growth factor (EGF)-like domain by the heparin-binding domain of heparin-binding EGF-like growth factor. J. Biol. Chem. 279, 4733547343.
  • Threadgill D. W., Dlugosz A. A., Hansen L. A., Tennenbaum T., Lichti U., Yee D., LaMantia C., Mourton T., Herrup K. and Harris R. C. (1995) Targeted disruption of mouse EGF receptor: effect of genetic background on mutant phenotype. Science 269, 230234.
  • Tohmi M., Tsuda N., Mizuno M., Takei N., Frankland P. W. and Nawa H. (2005) Distinct influences of neonatal epidermal growth factor challenge on adult neurobehavioral traits in four mouse strains. Behav. Genet. 35, 615629.
  • Ullrich A., Coussens L., Hayflick J. S., Dull T. J., Gray A., Tam A. W., Lee J., Yarden Y., Libermann T. A. and Schlessinger J. (1984) Human epidermal growth factor receptor cDNA sequence and aberrant expression of the amplified gene in A431 epidermoid carcinoma cells. Nature 309, 418425.
  • Velu T. J., Beguinot L., Vass W. C., Zhang K., Pastan I. and Lowy D. R. (1989) Retroviruses expressing different levels of the normal epidermal growth factor receptor: biological properties and new bioassay. J. Cell. Biochem. 39, 153166.
  • Ventrella L. L. (1993) Effect of intracerebroventricular infusion of epidermal growth factor in rats hemitransected in the nigro-striatal pathway. J. Neurosurg. Sci. 37, 18.
  • Wagner B., Natarajan A., Grünaug S., Kroismayr R., Wagner E. F. and Sibilia M. (2006) Neuronal survival depends on EGFR signaling in cortical but not midbrain astrocytes. EMBO J. 25, 752762.
  • Zscheppang K., Korenbaum E., Bueter W., Ramadurai S. M., Nielsen H. C. and Dammann C. E. (2006) ErbB receptor dimerization, localization, and co-localization in mouse lung type II epithelial cells. Pediatr. Pulmonol. 41, 12051212.

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Figure S1. Protein samples were prepared from mesencephalic tissues from E15 rat fetuses and PND2 pups, and mesencephalic cultures (DIV5) and subjected to immunoblotting with the anti-ErbB1 antibody.

As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.

FilenameFormatSizeDescription
JNC_7287_sm_FigS1.pdf490KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.