SEARCH

SEARCH BY CITATION

Keywords:

  • astrocyte;
  • inflammation;
  • signal transducer and activation of transcription-3;
  • traumatic brain injury

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

J. Neurochem. (2012) 120, 710–720.

Abstract

Astrocytes respond to trauma by stimulating inflammatory signaling. In studies of cerebral ischemia and spinal cord injury, astrocytic signaling is mediated by the cytokine receptor glycoprotein 130 (gp130) and Janus kinase (Jak) which phosphorylates the transcription factor signal transducer and activator of transcription-3 (STAT3). To determine if STAT3 is activated after traumatic brain injury (TBI), adult male Sprague–Dawley rats received moderate parasagittal fluid-percussion brain injury or sham surgery, and then the ipsilateral cortex and hippocampus were analyzed at various post-traumatic time periods for up to 7 days. Western blot analyses indicated that STAT3 phosphorylation significantly increased at 30 min and lasted for 24 h post-TBI. A significant increase in gp130 and Jak2 phosphorylation was also observed. Confocal microscopy revealed that STAT3 was localized primarily within astrocytic nuclei. At 6 and 24 h post-TBI, there was also an increased expression of STAT3 pathway-related genes: suppressor of cytokine signaling 3, nitric oxide synthase 2, colony stimulating factor 2 receptor β, oncostatin M, matrix metalloproteinase 3, cyclin-dependent kinase inhibitor 1A, CCAAT/enhancer-binding protein β, interleukin-2 receptor γ, interleukin-4 receptor α, and α-2-macroglobulin. These results clarify some of the signaling pathways operative in astrocytes after TBI and demonstrate that the gp130-Jak2-STAT3 signaling pathway is activated after TBI in astrocytes.

Abbreviations used:
A2m

α-2-macroglobulin

BBB

blood–brain barrier

Cebpβ

CCAAT/enhancer-binding protein β

Cdkn1a

cyclin-dependent kinase inhibitor 1A

Csf2rβ

colony-stimulating factor 2 receptor β

FPI

fluid-percussion brain injury

GFAP

glial fibrillary acidic protein

gp130

glycoprotein 130

GCSF

granulocyte colony-stimulating factor

GSK-3β

glycogen synthase kinase-3β

Il2rγ

interleukin-2 receptor γ

Il4rα

interleukin-4 receptor α

Jak

Janus kinase

Mmp3

matrix metalloproteinase 3

Mpl

myeloproliferative leukemia virus oncogene

Nos2

nitric oxide synthase 2

Osm

oncostatin M

qPCR

quantitative RT-PCR

STAT3

signal transducer and activator of transcription-3

Socs3

suppressor of cytokine signaling 3

SFK

Src family kinase

TBI

traumatic brain injury

Astrocytes are important for homeostatic regulation by providing metabolic substrates to neurons and supporting the blood–brain barrier (BBB). During traumatic brain injury (TBI), astrocytes become reactive and increase expression of proinflammatory cytokines, produce excitotoxicity by failing to regulate extracellular glutamate, contribute to cerebral edema by swelling, and exacerbate neuronal death by releasing reactive oxygen species (Seifert et al. 2006; Laird et al. 2008). During focal CNS insults, astrocytes also have beneficial roles and preserve neural tissue by restricting the infiltration of inflammatory cells (Myer et al. 2006; Okada et al. 2006; Herrmann et al. 2008). Thus, understanding the biochemical signaling mechanisms that are activated in astrocytes as a consequence of trauma is essential for developing therapies to treat TBI.

In studies of cerebral ischemia, spinal cord injury, and other neuroinflammatory diseases, it has been found that cytokines induce dimerization of gp130, followed by activation of Jak1 and Jak2 which phosphorylate STAT3 at Y705 (Planas et al. 1996; Justicia et al. 2000; Choi et al. 2003; Na et al. 2007; Herrmann et al. 2008). STAT3 then translocates to the nucleus where it is further phosphorylated at S727. Phosphorylated STAT3 acts as a transcription factor by binding to promoter regions of genes containing gamma-activated sequences and increases gene expression of glial fibrillary acidic protein (GFAP) and other genes (Zhong et al. 1994; Dawn et al. 2004; Myer et al. 2006; Yu et al. 2006; Yi et al. 2007; Kim et al. 2008).

After TBI, astrocytes undergo a phenotypic change characterized by cytoplasmic enlargement, elongation of their processes, and up-regulation of GFAP; this change is termed reactive astrocytosis. Selective ablation of reactive astrocytes using the gfap promoter after TBI improves neurite outgrowth, but increases inflammation and prevents resealing of the BBB (Bush et al. 1999; Myer et al. 2006). In studies of ischemia, STAT3 is known to increase gene expression for GFAP, oncostatin M (OSM), suppressor of cytokine signaling 3 (Socs3), and pro-inflammatory genes such as cyclooxygenase-1, nitric oxide synthase 2 (Nos2), interleukin-1β, and tumor necrosis factor-α (Dawn et al. 2004; Yu et al. 2006; Yi et al. 2007; Kim et al. 2008). Although one study has determined that STAT3 is activated after the Feeney free falling model of TBI, no other studies have been completed for other clinically relevant models of TBI (Zhao et al. 2011b). Studies in ischemia suggest that the injury model and cell-type that STAT3 is activated in are important determinants as to whether STAT3 will activate pro- or anti-inflammatory genes and lead to a worsening or improvement in behavioral recovery (Wen et al. 2001; Yamashita et al. 2005; Satriotomo et al. 2006; Dziennis et al. 2007). Thus, we utilized a model of brain injury that replicates many clinical features of TBI, parasagittal fluid-percussion brain injury (FPI), and examined whether STAT3 is activated during FPI, in what cell types it may regulate gene expression, and whether it stimulates pro- or anti-inflammatory gene expression (Dietrich et al. 1994; Gennarelli 1994; Thompson et al. 2005).

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Traumatic brain injury

All animal procedures were reviewed and approved by the University of Miami Institutional Animal Care and Use Committee and were in accordance with the NIH Guide for the Care and Use of Laboratory Animals and the Society for Neuroscience Guidelines for the Use of Animals in Neuroscience Research. Adult male Sprague–Dawley rats (280–300 g; Charles Rivers Laboratories, Wilmington, MA, USA) were anesthetized with 3% isoflurane, 70% N2O, and 30% O2. A craniotomy (4.8 mm diameter) was made at −3.8 mm bregma and 2.5 mm lateral to midline over the right parietal cortex. A beveled plastic syringe hub (3.5 mm diameter) was affixed to the craniotomy using cyanoacrylate and dental cement. After the animals had recovered for 24 h, anesthesia was induced with 3% isoflurane, 70% N2O, and 30% O2. The animals were intubated, paralyzed with pancuronium bromide (1.0 mg/kg, intravenously), and mechanically ventilated (Stoelting, Wood Dale, IL, USA) with 0.5–1% isoflurane, 70% N2O, and 30% O2. Blood gases, blood pH, mean arterial blood pressure, and head and body temperature were monitored to maintain normal physiological parameters (pO2 105–140 mmHg, pCO2 35–45 mmHg, pH 7.35–7.45, brain and body temperature 36.5–37°C). After the animals had stabilized, they received a fluid-percussion pulse (1.8–2.2 atm, 22 ms duration) or sham injury. Animals (= 6/group) were allowed to survive for 30 min, 1 h, 3 h, 6 h, 24 h, or 7 days after surgery. Sham animals were performed for all time points, but no significant biochemical differences were observed at any of the survival time points; thus sham animals at all time points were pooled in the analyses (data not shown). Measures were taken to alleviate discomfort and prevent infection by administering penicillin/benzathine (20 000 IU/kg, intramuscular) once prior to the brain injury surgery, and buprenorphine was given immediately after the surgery (0.01 mg/kg, subcutaneously).

Western blot analysis

The ipsilateral parietal cortex and hippocampus were homogenized using a Dounce homogenizer (35 strokes, 4°C) in 15 mM Tris–HCl pH 7.6, 0.25 M sucrose, 1 mM MgCl2, 1 mM EGTA, 1 mM dithiothreitol, 1.25 μg/mL pepstatin, 25 μg/mL aprotinin, 10 μg/mL leupeptin, 1 mM benzamidine, 0.5 mM phenylmethylsulfonyl fluoride, 0.1 mM Na3VO4, 50 mM NaF, 2 mM Na4P2O7, and 1× phosphatase inhibitor cocktail set II (EMD Chemicals, Gibbstown, NJ, USA). Samples were boiled with 1× sample buffer at 95°C for 7–9 min. Total protein was assayed using a Coomassie Plus assay kit (Bio-Rad Laboratories, Hercules, CA, USA) to load equal amounts of protein (60 μg) on each lane. Samples were electrophoresed and western blotted. Antibodies used from Cell Signaling Technology (Danvers, MA, USA) were: phospho-STAT3 Y705 (1 : 1000), phospho-STAT3 S727 (1 : 1000), total STAT3 (1 : 5000), phospho-Jak1 (1 : 2000), phospho-Jak2 (1 : 2000), phospho-gp130 (1 : 2000), phospho-glycogen synthase kinase-3β (GSK-3β; 1 : 1000), and phospho-Src family kinase (SFK, 1 : 1000). The antibody against β-actin (1 : 10 000) was from Sigma-Aldrich (St Louis, MO, USA). Western blots were developed using enhanced chemiluminescence plus or enhanced chemiluminescence advance (GE Healthcare, Piscataway, NJ, USA) and X-ray film (Phenix X-ray film BX; Phenix Research Products, Hayward, CA, USA). Films were densitized using ImageJ 1.38x (NIH).

Immunohistochemistry

Free-floating sections (50 μm thick) were blocked and incubated with antibodies in phosphate-buffered saline containing 5% normal goat serum, 0.2% fish skin gelatin, and 0.3% TX-100. Primary antibodies used were: anti-phospho-STAT3 Y705 (1 : 1000), total STAT3 (1 : 1000), GFAP (1 : 5000; Millipore, Billerica, MA, USA), and NeuN (Millipore, 1 : 5000). Secondary antibodies used were Alexa 488 and 546-labeled anti-rabbit and anti-mouse antibodies (Invitrogen, Carlsbad, CA, USA). Images were obtained using a LSM510 laser scanning confocal microscope (Carl Zeiss, Thornwood, NY, USA) using a 40× 0.8 NA water-immersion lens. At least three different sections from three animals in each experimental group were analyzed, and all animals within each group yielded similar results.

qPCR and qRT-PCR

The ipsilateral parietal cortex (= 3 animals/group) containing both the epicenter and penumbra of the injury was homogenized and total RNA was isolated using Trizol reagent (Invitrogen). The RNA was precipitated, resuspended in H20, and quantified using a Nanodrop (ThermoFisher Scientific, Pittsburgh, PA, USA).

For the quantitative polymerase chain reaction (qPCR) arrays, equivalent amounts of RNA from each individual animal for each group were combined (= 3 animals/group), and a total of 2 μg was subjected to an RNA clean-up step and reverse-transcribed using kits PA-001 and C-03 as per the manufacturer’s protocols (SABiosciences/Qiagen, Frederick, MD, USA). Quantitative PCR was performed using a JAK/STAT signaling pathway PCR array (PARN-039C), SYBR green/ROX qPCR master mix (SABiosciences: PA-012), and 7300 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA). Analysis was performed using the ΔΔCt Method via the PCR Array Data Analysis Web Portal, http://www.SABiosciences.com/pcrarraydataanalysis.php (Livak and Schmittgen 2001).

For individual quantitative real-time PCR analysis, 2 μg of RNA from each animal (= 3 animals/group) was individually reverse transcribed using kit C-03 (SABiosciences), and qPCR performed using JumpStart DNA polymerase (Sigma: D9307). Cycling conditions were 35 cycles of 94°C 20 s, 58–60°C 20 s, 72°C 30 s. Primer sets used for all PCRs spanned at least 1 intron as indicated in Table 1.

Table 1.   Primer sets for qRT-PCR
TranscriptForward primerExonReverse primerExonSize (bp)
  1. Note that some primers spanned exon boundaries as denoted by the slashes.

A2mCAACTCGAACATCCGTAAACC17ACTGTCACTTCCACTTCAGC19216
ActinTCCTTCCTGGGTATGGAATC2/3AGTCCGCCTAGAAGCATTTG3/4269
Cdkn1aAACGGAGGCAGACCAGCCTAAC2TGAAGGCTAAGGCAGAAGATGG3148
Csf2rβTAAGCAGCTTCAGGACTCCTG5CTTGTCCTCTGTCGGAGAGTC6/7202
Il2rγGGAGCCATACTGCAGAGGAG5CCCATGGTATTCAGTAACCAG7173
Il4rα (total)CGTGGAGCCTGAACACACAG1CGGAGGACAGGAACTTGGTG3152
Il4rα (transmembrane)TCACGTGGTACAACCACTTC7CCTTCGTGTCCTGAATGATG10195
Il4rα (soluble)CTGTGACTGAATGACCTTGG8CCTTCGTGTCCTGAATGATG10241
Nos2CGCCAAGCTGAACTTGAGTG26ACCGCACCGAAGATATCCTC2793
OsmCTCAGCCAGTTGAAGAGTCAG2TCTCAGGGTGAGCGTGTTCAG399

Statistical analysis

Results are presented as mean ± SEM. A one-way anova with post hoc Tukey tests was used. Significance was set at < 0.05.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

To determine if the STAT3 pathway is altered after experimental TBI, adult Sprague–Dawley rats received moderate parasagittal FPI or sham injury, and then the ipsilateral, injured parietal cortex was analyzed by western blotting for changes in phosphorylated STAT3. Parasagittal FPI is a widely used model of TBI because it induces focal and diffuse lesions throughout the brain, similar to what is typically seen in the majority of TBI patients (Kotapka et al. 1992; Ross et al. 1993; Dietrich et al. 1994; Gennarelli 1994; Hicks et al. 1996; Maxwell et al. 2003; Thompson et al. 2005). The pathology includes breakdown of the BBB and inflammation predominantly within the parietal cortex, although some leakage of the BBB and reactive astrocytosis is also seen within the ipsilateral hippocampus (Dietrich et al. 1994). In the ipsilateral parietal cortex, we observed a highly significant activation of STAT3 between 1 and 24 h post-injury as assessed by phosphorylation at Y705 and S727 (Fig. 1). Total levels of STAT3 were slightly variable, but did not significantly change at any time points examined. In the ipsilateral hippocampus and similar to our results in the cortex, we found that STAT3 was significantly phosphorylated at 6 h post-injury.

image

Figure 1.  Phosphorylated STAT3 increases after FPI. (a) Representative western blots of phosphorylated STAT3 at Y705 (pSTAT3 Y705) and S727 (pSTAT3 S727), total STAT3, and β-actin from the ipsilateral, injured parietal cortex (a) and hippocampus (b) after moderate parasagittal FPI. Densitometric analysis indicated that phosphorylation of STAT3 significantly increased from 30 min to 24 h after injury in the parietal cortex (c) and at 6 h post-FPI in the hippocampus (d). Total levels of STAT3 were unchanged. Mean ± SEM, = 6/group, *< 0.05, **< 0.01, #< 0.001 for sham versus FPI animal groups.

Download figure to PowerPoint

During cerebral ischemia, activation of STAT3 has been observed in neurons and associated with up-regulation of neuroprotective genes (Justicia et al. 2000; Dziennis et al. 2007). In contrast, increased STAT3 activation in microglia/macrophages after ischemia has been associated with neuronal apoptosis (Satriotomo et al. 2006). To determine the cellular localization of STAT3 after parasagittal FPI, we performed immunohistochemistry followed by confocal microscopy for phosphorylated STAT3 for sham animals (= 3) and animals 6 h after FPI (= 3). In the injured, ipsilateral parietal cortex, phosphorylated STAT3 was localized to astrocytes, having a discrete nuclear localization (Fig. 2a). There were occasional cells that were phospho-STAT3 positive, but not GFAP-positive, that may have been microglia (Satriotomo et al. 2006). Phosphorylated STAT3 was not detected in neurons, as assessed by lack of colocalization with the neuronal cell marker, NeuN (Fig. 2d). Furthermore, phosphorylated STAT3 immunoreactivity was not detected in the contralateral parietal cortex (Fig. 2b) or in the parietal cortex of sham-injured animals (Fig. 2c). These results demonstrate that FPI elicits activation of STAT3 selectively in astrocytes.

image

Figure 2.  Phospho-STAT3 increased in astrocytes at 6 h after FPI. (a) The injured, ipsilateral parietal cortex was immunostained for phosphorylated STAT3 Y705 (red) and GFAP (green). Confocal imaging revealed that phosphorylated STAT3 was found primarily in GFAP-positive nuclei, although a few cells not immunostaining with GFAP were also found to immunostain for phospho-STAT3. Inset: higher magnification of boxed area. In contrast, phosphorylated STAT3 was undetectable in the contralateral (b) or sham-injured (c) parietal cortex. (d) Phospho-STAT3 immunoreactivity (red) was not detectable in neurons in the ipsilateral parietal cortex at 6 h post-FPI, based on lack of co-localization with the neuronal marker, NeuN (green). (e) No primary antibody controls. Results were based on immunohistochemistry and confocal imaging performed for three sham animals and three FPI animals assessed 6 h after surgery. Far right panels show the z-depth used to create the maximum projections. Scale bars, 50 μm.

Download figure to PowerPoint

Based on the selective nuclear localization of phosphorylated STAT3 to astrocytes in the ipsilateral cortex after FPI, we also examined how total STAT3 was affected. In the non-injured parietal cortex from sham-surgery animals, total STAT3 immunoreactivity was diffusely present predominantly in the soma of large cells that had a morphology and distribution consistent with neurons, but STAT3 was virtually undetectable in these nuclei (Fig. 3a). Similar results were obtained for the contralateral cortex at 6 h after FPI (Fig. 3c). In contrast in the ipsilateral parietal cortex at 6 h after FPI, STAT3 became predominantly nuclear in GFAP-positive cells (Fig. 3b). We also observed a subpopulation of cells not co-staining for GFAP with a morphology consistent with neurons that were STAT3-positive, but had a reduced STAT3 staining intensity as compared to the GFAP/STAT3-positive astrocytes (Fig. 3b).

image

Figure 3.  STAT3 translocates to nuclei after FPI. (a) Total STAT3 immunoreactivity (red) was found in the cytosol of GFAP-positive cells (green) in the non-injured parietal cortex of sham animals, although some cells that were not GFAP-positive also weakly immunostained with STAT3. (b) At 6 h after parasagittal FPI, STAT3 was predominately localized to the nuclei of GFAP-positive cells in the ipsilateral parietal cortex, but remained cytosolic in the contralateral (c) parietal cortex. Translocation was also seen in non-GFAP-positive cells. (d) No immunoreactivity was observed when primary antibodies were omitted. Images are representative of three animals per group. Right panels show the z-distance used to create the maximum projection images. Scale bars, 50 μm.

Download figure to PowerPoint

STAT3 is directly phosphorylated and activated by the protein kinases, Jak1 and Jak2. To determine which of these was also activated after TBI, we assessed the parietal cortex for phosphorylated, activated Jak1 and Jak2 (Fig. 4). Only Jak2 was significantly increased in phosphorylation at 30 min, 1 h, and 24 h after FPI. These results suggest that Jak2, but not Jak1, likely mediates STAT3 activation.

image

Figure 4.  Jak2, but not Jak1, increases in phosphorylation in the ipsilateral parietal cortex after FPI. (a) Representative western blots for phosphorylated Jak1 (pJak1), phosphorylated Jak2 (pJak2), total Jak2, and β-actin are shown. (b) Densitometric analysis revealed that phosphorylated Jak1 was not significantly increased at any time point. Phosphorylated Jak2 modestly, but significantly increased at 30 min, 1 h, and 24 h post-FPI. No changes in total levels of Jak2 were observed. Mean ± SEM, = 6/group, *< 0.05, **< 0.01 for sham versus FPI.

Download figure to PowerPoint

STAT3 is classically phosphorylated within astrocytes when the gp130 receptor is activated by cytokines such as IL-6, leukemia inhibitory factor, ciliary neurotrophic factor, epidermal growth factor, OSM, transforming growth factor-β, and cardiotrophin-1, several of which have been demonstrated to increase after TBI (Rimaniol et al. 1995; Banner et al. 1997; Oyesiku et al. 1999; Heinrich et al. 2003; Truettner et al. 2005b; Sun et al. 2010). The gp130 receptor, when bound to ligand, dimerizes and autophosphorylates. This recruits Jak1 or Jak2 to the receptor, activating these protein kinases which then phosphorylate STAT3. To determine if gp130 underwent autophosphorylation after FPI, we assessed for levels of phosphorylated and total gp130 after FPI. We found that gp130 phosphorylation levels were almost undetectable in sham animals, but significantly increased at 3 and 6 h post-injury (Fig. 5).

image

Figure 5.  Phospho-gp130 increases after FPI. (a) Representative western blots for phosphorylated gp130 (pgp130), total gp130, and β-actin from homogenates of the ipsilateral parietal cortex after FPI. (b) Analysis by densitometry indicated that phosphorylation of gp130 significantly increased at 3 and 6 h after FPI in the ipsilateral parietal cortex. Total levels of gp130 did not change. Mean ± SEM, = 6/group, *< 0.05, **< 0.01 for sham versus FPI.

Download figure to PowerPoint

Besides Jak1 and 2, STAT3 can be regulated by phosphorylation by several other protein kinases, including GSK-3β and the SFKs (Laird et al. 2003; Beurel and Jope 2008). To determine if phosphorylation of any of these protein kinases temporally correlated with STAT3 phosphorylation, we probed the ipsilateral parietal cortex for changes in phospho-GSK-3β and the SFKs. Phosphorylation of GSK-3β did not significantly increase until 6 h post-injury, and SFK phosphorylation was even more delayed, significantly increasing beginning at 24 h post-TBI (Fig. 6). Both remained significantly elevated at 24 h and 7 days post-injury, time points when STAT3 phosphorylation was returning to sham, non-injured levels.

image

Figure 6.  Analysis of other potential regulators of STAT3 phosphorylation after FPI. (a) Representative western blots of the ipsilateral parietal cortex for phosphorylated GSK-3β (pGSK-3β), total GSK-3β, phosphorylated SFK (pSFK), total Src, and β-actin are shown. (b) Densitometric analysis demonstrated that phosphorylated GSK-3β significantly increased at 6 h, 24 h, and 7 days post-FPI, whereas phosphorylated SFK significantly increased at 24 h and 7 days post-injury. Total levels of GSK-3β and Src did not change. Mean ± SEM, = 6/group, *< 0.05, **< 0.01, #< 0.001 for sham versus FPI.

Download figure to PowerPoint

Given the role of STAT3 as a transcription factor, we examined how FPI might alter expression of STAT3-pathway related genes. Individual RNA samples from the ipsilateral parietal cortex of animals at 6 or 24 h after FPI or sham surgery were pooled, reverse transcribed, and subjected to quantitative PCR (qPCR) against an array of 84 STAT pathway-related genes. Comparison of the 6 and 24 h sham surgery animals showed tight correlations in expression levels of most of the tested mRNAs (Figure S1). Both the 6 and 24 h FPI animal groups showed changes in the expression of several STAT-pathways related genes (Fig. 7a). Of the 84 genes studied, two genes had changed by at least 5-fold at 6 h after FPI, and 10 genes had changed greater than 5-fold at 24 h post-FPI. These included a > 5-fold increase in gene expression for Socs3, Nos2, colony-stimulating factor 2 receptor β (Csf2rβ), Osm, matrix metalloproteinase 3 (Mmp3), cyclin-dependent kinase inhibitor 1A (Cdkn1a), interleukin-4 receptor α (Il4rα), CCAAT/enhancer-binding protein β (Cebpβ), and interleukin-2 receptor γ (Il2rγ) at 24 h after FPI. Furthermore, at 24 h post-FPI, a 12-fold decrease in myeloproliferative leukemia virus oncogene (Mpl) was detected.

image

Figure 7.  Transcription of STAT pathway-related genes increased after FPI. (a) Quantitative PCR array analyses of STAT3 pathway-related gene targets in the ipsilateral parietal cortex at 6 or 24 h post-FPI (= 3 animals/group). At both 6 and 24 h after FPI, the mRNA levels for Socs3 and Csf2rβ were dramatically elevated. At 24 h after FPI, additional STAT3 pathway genes that were elevated included Nos2, Osm, Mmp3, Cdkn1a, Il4Rα, Cebpβ, and Il2rγ. (b) Quantitative RT-PCR analysis on RNA from each individual animal confirmed several results from the qPCR array (= 3 animals/group). To verify the array results, the primers used in the qPCR analyses were independently designed from the array primers.

Download figure to PowerPoint

To confirm these results, we independently designed primers and performed quantitative real-time PCR on RNA samples from individual animals of each treatment group (= 3 animals/group; Table 1). We found that at 6 h post-FPI, there was an increased expression in Csf2rβ, Osm, Cdkn1a, Il2rγ, the soluble form of Il4rα, and α-2-macroglobulin (A2m). In addition and confirming our array results, at 24 h post-FPI we observed an increase in expression in Nos2, Csf2rβ, Osm, Mmp3, Cdkn1a, both the soluble and transmembrane forms of Il2rγ, Il4rα, and A2m (Fig. 7b).

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

To further our understanding of the biochemical signaling events initiated in astrocytes due to brain trauma, we investigated whether STAT3 signaling was altered after moderate parasagittal FPI. We found that in non-injured animals or in the contralateral cortex, phospho-STAT3 was nearly undetectable and total STAT3 was predominantly cytosolic. After brain trauma, our temporal analyses revealed that phosphorylated STAT3 was significantly elevated from 30 min to 24 h post-FPI and had returned almost to non-injured levels by 7 days. FPI induced a nuclear translocation of STAT3 in GFAP-expressing cells. In summary, our results demonstrate that moderate parasagittal FPI induces a robust phosphorylation of STAT3 and a translocation of STAT3 to astrocytic nuclei.

Our results also suggest that Jak2, but not Jak1, is the likely activator of STAT3 after FPI, since only Jak2 was significantly increased in phosphorylation. GSK-3β and SFK, other potential activators of STAT3, were also activated during FPI, but our findings suggest that these were unlikely the primary regulators of STAT3 because, unlike Jak2, the activation of GSK-3β and SFK was temporally delayed in relation to the changes in STAT3 activation (Laird et al. 2003; Beurel and Jope 2008). In accordance with these results, a previous study using the Feeney free falling model of brain injury found that STAT3 phosphorylation correlated with Jak2, but not Jak1 activation (Zhao et al. 2011b). Although we did observe an increase in gp130 phosphorylation which fits with previous reports demonstrating an increase in IL-6 after TBI, the increase in gp130 phosphorylation was not significant until 3 h post-injury, suggesting that other pathways may also regulate STAT3 at the earlier time points (Truettner et al. 2005b). Other potential activators of STAT3 after FPI include the epidermal growth factor, fibroblast growth factor, or platelet-derived growth factor receptor signaling pathways (Brantley and Benveniste 2008).

In our studies, we found a 2- to 3-fold increase in Stat3 expression using a quantitative PCR in the ipsilateral cortex at 6 and 24 h after FPI, even though this did not translate to a similar increase in total STAT3 protein expression with the western blot analyses. Our observed increase in Stat3 expression is in agreement with a previous study using the controlled contusion brain injury model and correlates with the time course of Gfap expression after TBI, which peaks between 6 to 24 h after TBI (Dietrich et al. 1999; Raghavendra Rao et al. 2003; von Gertten et al. 2005). We also found a robust increase in the expression of a number of STAT-pathway related genes, including Socs3, Nos2, Csf2rβ, Osm, Mmp3, Cdkn1a, Il2rγ, the soluble and transmembrane forms of Il4rα, Cebpβ, and A2m. However, as the molecular analysis was performed at two time points only, at 6 and 24 h post-FPI, transcriptional changes occurring at other time points may have been missed.

Whether STAT3 activation during FPI results in inflammation or neuroprotection is likely to be dependent on the cell type and the upstream kinase that regulates STAT3 and the subsequent downstream genes regulated by STAT3 in that particular cell type. In spinal cord injury and the Feeney free falling brain injury model, STAT3 appears to be neuroprotective: STAT3 becomes activated in neurons acutely, and inhibition of Jak with AG490 to suppress phosphorylation of STAT3 worsens behavioral recovery (Suzuki et al. 2001; Yamauchi et al. 2006; Zhao et al. 2011a; b). Activation of STAT3 during cerebral ischemia also appears to be neuroprotective, and inhibition of STAT3 activation results in a larger infarct volume and increases apoptosis (Suzuki et al. 2005; Jung et al. 2009). In addition, the neuroprotective effects of estradiol, secretoneurin, and IL-6 during middle cerebral artery occlusion are thought to be mediated by STAT3 activation (Yamashita et al. 2005; Dziennis et al. 2007; Shyu et al. 2008). Axon regeneration also correlates with STAT3 activation in retinal ganglion cells after an optic nerve crush and lens injury (Leibinger et al. 2009). Together these data suggest that STAT3 activation may have neuroprotective and regenerative functions for some types of CNS insults.

Unlike in neurons, where the evidence generally supports a neuroprotective role of STAT3, reports on activation of STAT3 in astrocytes and microglia/macrophages suggest that the diffusiveness or focal nature of the injury may determine if STAT3 exhibits a deleterious or neuroprotective role. Transient middle cerebral artery occlusion, a broad CNS injury, results in activation of STAT3 in reactive microglia/macrophages, and inhibition of STAT3 reduced infarct volume and apoptosis (Planas et al. 1996; Justicia et al. 2000; Choi et al. 2003). However, in models of spinal cord injury which results in a focal contusion, knockout of STAT3 in astrocytes disrupts the astroglial scar formation and increases lesion volume (Qiu et al. 2005; Okada et al. 2006; Herrmann et al. 2008). Thus, the STAT3 pathway could potentially contribute to inflammation or limit the spread of the injury depending on whether the injury is diffuse or focal, and the role astrocytes and microglia/macrophages play in limiting the injury area. In our studies, we found that STAT3 was activated primarily in astrocytes. However, these results needs to be interpreted cautiously and we do not rule out the possibility that either neurons or microglia also had some STAT3 activation because the use of GFAP precluded an exact overlay with the STAT3 signal and the overlay was dependent on a close apposition of GFAP and STAT3 signals. In addition, a sub-population of GFAP-negative cells demonstrated nuclear translocation of STAT3 following TBI. Further studies using macrophage/microglia markers would be informative in elucidating whether these particularly active immune cells also are involved in STAT3 signaling after TBI.

To identify upstream regulators and downstream gene targets of STAT3 activation, we performed an RT-PCR screen and found a dramatic up-regulation of expression of Socs3 (Tsai et al. 2011). Socs3 is an antagonist of the STAT3 pathway by binding Y759 of gp130, preventing further STAT3 activation and truncating the astroglial response to injury (Fischer et al. 2004). In middle cerebral artery occlusion, the onset of Socs3 expression in aged animals occurs at earlier time points after injury as compared with young adult animals, resulting in a premature termination of astrogliosis and worsening histopathological outcome (Dinapoli et al. 2010). The delayed 24 h increase in Socs3 is likely an endogenous reparative response that terminates astrogliosis once the BBB reseals (Habgood et al. 2007; Qin et al. 2008).

The increase in Nos2 and Mmp3 levels was not surprising, given that several studies have reported that these genes are induced by TBI (Clark et al. 1996; Wada et al. 1998; Gahm et al. 2000; Orihara et al. 2001; Petrov and Rafols 2001; Kim et al. 2005a; Grossetete et al. 2009). Levels of Nos2, also known as inducible Nos, increase within inflammatory cells from hours to days after TBI, which corresponds to the time course that we observed, with low expression at 6 h post-FPI, but a dramatic increase at 24 h post-FPI (Clark et al. 1996; Orihara et al. 2001). Inhibition of Nos2 reduces apoptosis of ED-1 and NeuN-positive cells, suggesting that this STAT3 gene target results in a detrimental, pro-inflammatory response to TBI (Wada et al. 1998; Gahm et al. 2006). Similarly, Mmp3 expression is induced by TBI and inhibition of Mmp3 improves cognitive recovery after TBI (Kim et al. 2005a; Falo et al. 2006; Grossetete et al. 2009; ). Mmp3 is involved in breakdown of the basal lamina and extracellular matrix and it is thought that inhibition of Mmp3 potentially interferes with the synaptic remodeling and recovery (Falo et al. 2006; Gurney et al. 2006). Both Nos2 and Mmp3 are found in astrocytes, indicating that some of the inducible genes activated by STAT3 within astrocytes after TBI may exert a variety of pathological effects on outcome following brain trauma (Wada et al. 1998; Kim et al. 2005b).

The qPCR array results verified some well-established gene targets of STAT3 activation such as Nos2, Mmp3, and Socs3, yet also identified some new targets including Csf2rβ, Cdkn1a, both the soluble and transmembrane forms of Il2rγ, Il4rα, Cebpβ, A2m, and Osm (Chatzipanteli et al. 1999; Gahm et al. 2000; Truettner et al. 2005a). Although the Csf2 receptor has not been investigated in studies of TBI, the ligand for Csf2rβ, granulocyte colony-stimulating factor (GCSF) has been used to reduce the incidence of sepsis in TBI patients (Heard et al. 1998; Ishikawa et al. 1999). GCSF is a hematopoietic growth factor and cytokine that controls the production and function of neutrophils (Whalen et al. 2000). Administration of GCSF improves behavioral recovery and outcome, suggesting that STAT3 induction of the Csf2 receptor may participate in a positive feedback loop to promote recovery after TBI (Sheibani et al. 2004; Yang et al. 2010). OSM is a member of the IL-6 cytokine family and signals using the gp130 receptor (Mosley et al. 1996; Kordula et al. 1998; Morikawa 2005). OSM has been shown to be neuroprotective against cytotoxic injury and promotes repair in demyelinated regions after injury (Weiss et al. 2006; Glezer and Rivest 2010). Furthermore, OSM promotes activation of STAT3 selectively in Müller cells in the retina, which in turn protects photoreceptors in a mouse model of retinal degeneration, suggesting that OSM may serve to induce glial-neuronal protective effects in other injury models (Xia et al. 2011). Thus, the up-regulation of OSM after FPI may serve as a novel neuroprotective function and may be a new therapeutic target.

In conclusion, our results indicate that the robust activation of STAT3 in astrocytes occurs after moderate parasagittal FPI, induces STAT3 to translocate to the nucleus and affect gene transcription. Osm expression in turn is dramatically up-regulated, and OSM itself may participate in a positive autocrine feedback loop, as has been previously described for HUVEC cells, and may promote neuronal survival and regeneration (Rychli et al. 2010). Socs3 expression triggered by STAT3 may then operate to truncate the gp130-JAK2-STAT3 pathway, limiting the astroglial response as an endogenous reparative response. Thus, selective inhibition of STAT3-subpathways, rather than general inhibition of STAT3, may be necessary to allow for the activation of neuroprotective pathways and inhibit the deleterious effects associated with reactive astrocytosis.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

This work was supported by The Miami Project to Cure Paralysis and The Buoniconti Fund to Cure Paralysis. The authors declare no conflict of interest. We thank Drs Ina Wanner, Valerie Bracchi-Ricard, W. Dalton Dietrich and Michael Norenberg for critical reading of the manuscript.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
  • Banner L. R., Moayeri N. N. and Patterson P. H. (1997) Leukemia inhibitory factor is expressed in astrocytes following cortical brain injury. Exp. Neurol. 147, 19.
  • Beurel E. and Jope R. S. (2008) Differential regulation of STAT family members by glycogen synthase kinase-3. J. Biol. Chem. 283, 2193421944.
  • Brantley E. C. and Benveniste E. N. (2008) Signal transducer and activator of transcription-3: a molecular hub for signaling pathways in gliomas. Mol. Cancer Res. 6, 675684.
  • Bush T. G., Puvanachandra N., Horner C. H., Polito A., Ostenfeld T., Svendsen C. N., Mucke L., Johnson M. H. and Sofroniew M. V. (1999) Leukocyte infiltration, neuronal degeneration, and neurite outgrowth after ablation of scar-forming, reactive astrocytes in adult transgenic mice. Neuron 23, 297308.
  • Chatzipanteli K., Wada K., Busto R. and Dietrich W. D. (1999) Effects of moderate hypothermia on constitutive and inducible nitric oxide synthase activities after traumatic brain injury in the rat. J. Neurochem. 72, 20472052.
  • Choi J. S., Kim S. Y., Cha J. H. et al. (2003) Upregulation of gp130 and STAT3 activation in the rat hippocampus following transient forebrain ischemia. Glia 41, 237246.
  • Clark R. S., Kochanek P. M., Schwarz M. A., Schiding J. K., Turner D. S., Chen M., Carlos T. M. and Watkins S. C. (1996) Inducible nitric oxide synthase expression in cerebrovascular smooth muscle and neutrophils after traumatic brain injury in immature rats. Pediatr. Res. 39, 784790.
  • Dawn B., Xuan Y. T., Guo Y., Rezazadeh A., Stein A. B., Hunt G., Wu W. J., Tan W. and Bolli R. (2004) IL-6 plays an obligatory role in late preconditioning via JAK-STAT signaling and upregulation of iNOS and COX-2. Cardiovasc. Res. 64, 6171.
  • Dietrich W. D., Alonso O. and Halley M. (1994) Early microvascular and neuronal consequences of traumatic brain injury: a light and electron microscopic study in rats. J. Neurotrauma 11, 289301.
  • Dietrich W. D., Truettner J., Zhao W., Alonso O. F., Busto R. and Ginsberg M. D. (1999) Sequential changes in glial fibrillary acidic protein and gene expression following parasagittal fluid-percussion brain injury in rats. J. Neurotrauma 16, 567581.
  • Dinapoli V. A., Benkovic S. A., Li X., Kelly K. A., Miller D. B., Rosen C. L., Huber J. D. and O’Callaghan J. P. (2010) Age exaggerates proinflammatory cytokine signaling and truncates signal transducers and activators of transcription 3 signaling following ischemic stroke in the rat. Neuroscience 170, 633644.
  • Dziennis S., Jia T., Ronnekleiv O. K., Hurn P. D. and Alkayed N. J. (2007) Role of signal transducer and activator of transcription-3 in estradiol-mediated neuroprotection. J. Neurosci. 27, 72687274.
  • Falo M. C., Fillmore H. L., Reeves T. M. and Phillips L. L. (2006) Matrix metalloproteinase-3 expression profile differentiates adaptive and maladaptive synaptic plasticity induced by traumatic brain injury. J. Neurosci. Res. 84, 768781.
  • Fischer P., Lehmann U., Sobota R. M. et al. (2004) The role of the inhibitors of interleukin-6 signal transduction SHP2 and SOCS3 for desensitization of interleukin-6 signalling. Biochem. J. 378, 449460.
  • Gahm C., Holmin S. and Mathiesen T. (2000) Temporal profiles and cellular sources of three nitric oxide synthase isoforms in the brain after experimental contusion. Neurosurgery 46, 169177.
  • Gahm C., Holmin S., Wiklund P. N., Brundin L. and Mathiesen T. (2006) Neuroprotection by selective inhibition of inducible nitric oxide synthase after experimental brain contusion. J. Neurotrauma 23, 13431354.
  • Gennarelli T. A. (1994) Animal models of human head injury. J. Neurotrauma 11, 357368.
  • von Gertten C., Flores Morales A., Holmin S., Mathiesen T. and Nordqvist A. C. (2005) Genomic responses in rat cerebral cortex after traumatic brain injury. BMC Neurosci. 6, 69.
  • Glezer I. and Rivest S. (2010) Oncostatin M is a novel glucocorticoid-dependent neuroinflammatory factor that enhances oligodendrocyte precursor cell activity in demyelinated sites. Brain Behav. Immun. 24, 695704.
  • Grossetete M., Phelps J., Arko L., Yonas H. and Rosenberg G. A. (2009) Elevation of matrix metalloproteinases 3 and 9 in cerebrospinal fluid and blood in patients with severe traumatic brain injury. Neurosurgery 65, 702708.
  • Gurney K. J., Estrada E. Y. and Rosenberg G. A. (2006) Blood-brain barrier disruption by stromelysin-1 facilitates neutrophil infiltration in neuroinflammation. Neurobiol. Dis. 23, 8796.
  • Habgood M. D., Bye N., Dziegielewska K. M., Ek C. J., Lane M. A., Potter A., Morganti-Kossmann C. and Saunders N. R. (2007) Changes in blood-brain barrier permeability to large and small molecules following traumatic brain injury in mice. Eur. J. Neurosci. 25, 231238.
  • Heard S. O., Fink M. P., Gamelli R. L. et al. (1998) Effect of prophylactic administration of recombinant human granulocyte colony-stimulating factor (filgrastim) on the frequency of nosocomial infections in patients with acute traumatic brain injury or cerebral hemorrhage. The Filgrastim Study Group. Crit. Care Med. 26, 748754.
  • Heinrich P. C., Behrmann I., Haan S., Hermanns H. M., Muller-Newen G. and Schaper F. (2003) Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem. J. 374, 120.
  • Herrmann J. E., Imura T., Song B. et al. (2008) STAT3 is a critical regulator of astrogliosis and scar formation after spinal cord injury. J. Neurosci. 28, 72317243.
  • Hicks R., Soares H., Smith D. and McIntosh T. (1996) Temporal and spatial characterization of neuronal injury following lateral fluid-percussion brain injury in the rat. Acta Neuropathol. (Berl) 91, 236246.
  • Ishikawa K., Tanaka H., Takaoka M., Ogura H., Shiozaki T., Hosotsubo H., Shimazu T., Yoshioka T. and Sugimoto H. (1999) Granulocyte colony-stimulating factor ameliorates life-threatening infections after combined therapy with barbiturates and mild hypothermia in patients with severe head injuries. J. Trauma 46, 9991007.
  • Jung J. E., Kim G. S., Narasimhan P., Song Y. S. and Chan P. H. (2009) Regulation of Mn-superoxide dismutase activity and neuroprotection by STAT3 in mice after cerebral ischemia. J. Neurosci. 29, 70037014.
  • Justicia C., Gabriel C. and Planas A. M. (2000) Activation of the JAK/STAT pathway following transient focal cerebral ischemia: signaling through Jak1 and Stat3 in astrocytes. Glia 30, 253270.
  • Kim H. J., Fillmore H. L., Reeves T. M. and Phillips L. L. (2005a) Elevation of hippocampal MMP-3 expression and activity during trauma-induced synaptogenesis. Exp. Neurol. 192, 6072.
  • Kim Y. S., Kim S. S., Cho J. J., Choi D. H., Hwang O., Shin D. H., Chun H. S., Beal M. F. and Joh T. H. (2005b) Matrix metalloproteinase-3: a novel signaling proteinase from apoptotic neuronal cells that activates microglia. J. Neurosci. 25, 37013711.
  • Kim E. J., Raval A. P. and Perez-Pinzon M. A. (2008) Preconditioning mediated by sublethal oxygen-glucose deprivation-induced cyclooxygenase-2 expression via the signal transducers and activators of transcription 3 phosphorylation. J. Cereb. Blood Flow Metab. 28, 13291340.
  • Kordula T., Rydel R. E., Brigham E. F., Horn F., Heinrich P. C. and Travis J. (1998) Oncostatin M and the interleukin-6 and soluble interleukin-6 receptor complex regulate alpha1-antichymotrypsin expression in human cortical astrocytes. J. Biol. Chem. 273, 41124118.
  • Kotapka M. J., Graham D. I., Adams J. H. and Gennarelli T. A. (1992) Hippocampal pathology in fatal non-missile human head injury. Acta Neuropathol. (Berl) 83, 530534.
  • Laird A. D., Li G., Moss K. G., Blake R. A., Broome M. A., Cherrington J. M. and Mendel D. B. (2003) Src family kinase activity is required for signal tranducer and activator of transcription 3 and focal adhesion kinase phosphorylation and vascular endothelial growth factor signaling in vivo and for anchorage-dependent and -independent growth of human tumor cells. Mol. Cancer Ther. 2, 461469.
  • Laird M. D., Vender J. R. and Dhandapani K. M. (2008) Opposing roles for reactive astrocytes following traumatic brain injury. Neurosignals 16, 154164.
  • Leibinger M., Muller A., Andreadaki A., Hauk T. G., Kirsch M. and Fischer D. (2009) Neuroprotective and axon growth-promoting effects following inflammatory stimulation on mature retinal ganglion cells in mice depend on ciliary neurotrophic factor and leukemia inhibitory factor. J. Neurosci. 29, 1433414341.
  • Livak K. J. and Schmittgen T. D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402408.
  • Maxwell W. L., Dhillon K., Harper L., Espin J., MacIntosh T. K., Smith D. H. and Graham D. I. (2003) There is differential loss of pyramidal cells from the human hippocampus with survival after blunt head injury. J. Neuropathol. Exp. Neurol. 62, 272279.
  • Morikawa Y. (2005) Oncostatin M in the development of the nervous system. Anat. Sci. Int. 80, 5359.
  • Mosley B., De Imus C., Friend D., Boiani N., Thoma B., Park L. S. and Cosman D. (1996) Dual oncostatin M (OSM) receptors. Cloning and characterization of an alternative signaling subunit conferring OSM-specific receptor activation. J. Biol. Chem. 271, 3263532643.
  • Myer D. J., Gurkoff G. G., Lee S. M., Hovda D. A. and Sofroniew M. V. (2006) Essential protective roles of reactive astrocytes in traumatic brain injury. Brain 129, 27612772.
  • Na Y. J., Jin J. K., Kim J. I., Choi E. K., Carp R. I. and Kim Y. S. (2007) JAK-STAT signaling pathway mediates astrogliosis in brains of scrapie-infected mice. J. Neurochem. 103, 637649.
  • Okada S., Nakamura M., Katoh H. et al. (2006) Conditional ablation of Stat3 or Socs3 discloses a dual role for reactive astrocytes after spinal cord injury. Nat. Med. 12, 829834.
  • Orihara Y., Ikematsu K., Tsuda R. and Nakasono I. (2001) Induction of nitric oxide synthase by traumatic brain injury. Forensic Sci. Int. 123, 142149.
  • Oyesiku N. M., Evans C. O., Houston S., Darrell R. S., Smith J. S., Fulop Z. L., Dixon C. E. and Stein D. G. (1999) Regional changes in the expression of neurotrophic factors and their receptors following acute traumatic brain injury in the adult rat brain. Brain Res. 833, 161172.
  • Petrov T. and Rafols J. A. (2001) Acute alterations of endothelin-1 and iNOS expression and control of the brain microcirculation after head trauma. Neurol. Res. 23, 139143.
  • Planas A. M., Soriano M. A., Berruezo M., Justicia C., Estrada A., Pitarch S. and Ferrer I. (1996) Induction of Stat3, a signal transducer and transcription factor, in reactive microglia following transient focal cerebral ischaemia. Eur. J. Neurosci. 8, 26122618.
  • Qin H., Niyongere S. A., Lee S. J., Baker B. J. and Benveniste E. N. (2008) Expression and functional significance of SOCS-1 and SOCS-3 in astrocytes. J. Immunol. 181, 31673176.
  • Qiu J., Cafferty W. B., McMahon S. B. and Thompson S. W. (2005) Conditioning injury-induced spinal axon regeneration requires signal transducer and activator of transcription 3 activation. J. Neurosci. 25, 16451653.
  • Raghavendra Rao V. L., Dhodda V. K., Song G., Bowen K. K. and Dempsey R. J. (2003) Traumatic brain injury-induced acute gene expression changes in rat cerebral cortex identified by GeneChip analysis. J. Neurosci. Res. 71, 208219.
  • Rimaniol A. C., Lekieffre D., Serrano A., Masson A., Benavides J. and Zavala F. (1995) Biphasic transforming growth factor-beta production flanking the pro-inflammatory cytokine response in cerebral trauma. Neuroreport 7, 133136.
  • Ross D. T., Graham D. I. and Adams J. H. (1993) Selective loss of neurons from the thalamic reticular nucleus following severe human head injury. J. Neurotrauma 10, 151165.
  • Rychli K., Kaun C., Hohensinner P. J. et al. (2010) The inflammatory mediator oncostatin M induces angiopoietin 2 expression in endothelial cells in vitro and in vivo. J. Thromb. Haemost. 8, 596604.
  • Satriotomo I., Bowen K. K. and Vemuganti R. (2006) JAK2 and STAT3 activation contributes to neuronal damage following transient focal cerebral ischemia. J. Neurochem. 98, 13531368.
  • Seifert G., Schilling K. and Steinhauser C. (2006) Astrocyte dysfunction in neurological disorders: a molecular perspective. Nat. Rev. Neuro. 7, 194206.
  • Sheibani N., Grabowski E. F., Schoenfeld D. A. and Whalen M. J. (2004) Effect of granulocyte colony-stimulating factor on functional and histopathologic outcome after traumatic brain injury in mice. Crit. Care Med. 32, 22742278.
  • Shyu W. C., Lin S. Z., Chiang M. F., Chen D. C., Su C. Y., Wang H. J., Liu R. S., Tsai C. H. and Li H. (2008) Secretoneurin promotes neuroprotection and neuronal plasticity via the Jak2/Stat3 pathway in murine models of stroke. J. Clin. Invest. 118, 133148.
  • Sun D., Bullock M. R., Altememi N., Zhou Z., Hagood S., Rolfe A., McGinn M. J., Hamm R. and Colello R. J. (2010) The effect of epidermal growth factor in the injured brain after trauma in rats. J. Neurotrauma 27, 923938.
  • Suzuki S., Tanaka K., Nogawa S., Dembo T., Kosakai A. and Fukuuchi Y. (2001) Phosphorylation of signal transducer and activator of transcription-3 (Stat3) after focal cerebral ischemia in rats. Exp. Neurol. 170, 6371.
  • Suzuki S., Yamashita T., Tanaka K., Hattori H., Sawamoto K., Okano H. and Suzuki N. (2005) Activation of cytokine signaling through leukemia inhibitory factor receptor (LIFR)/gp130 attenuates ischemic brain injury in rats. J. Cereb. Blood Flow Metab. 25, 685693.
  • Thompson H. J., Lifshitz J., Marklund N., Grady M. S., Graham D. I., Hovda D. A. and McIntosh T. K. (2005) Lateral fluid percussion brain injury: a 15-year review and evaluation. J. Neurotrauma 22, 4275.
  • Truettner J. S., Alonso O. F. and Dalton Dietrich W. (2005a) Influence of therapeutic hypothermia on matrix metalloproteinase activity after traumatic brain injury in rats. J. Cereb. Blood Flow Metab. 25, 15051516.
  • Truettner J. S., Suzuki T. and Dietrich W. D. (2005b) The effect of therapeutic hypothermia on the expression of inflammatory response genes following moderate traumatic brain injury in the rat. Brain Res. Mol. Brain Res. 138, 124134.
  • Tsai M. C., Chen W. J., Tsai M. S., Ching C. H. and Chuang J. I. (2011) Melatonin attenuates brain contusion-induced oxidative insult, inactivation of signal transducers and activators of transcription 1, and upregulation of suppressor of cytokine signaling-3 in rats. J. Pineal Res. 51, 233245.
  • Wada K., Chatzipanteli K., Kraydieh S., Busto R. and Dietrich W. D. (1998) Inducible nitric oxide synthase expression after traumatic brain injury and neuroprotection with aminoguanidine treatment in rats. Neurosurgery 43, 14271436.
  • Weiss T. W., Samson A. L., Niego B., Daniel P. B. and Medcalf R. L. (2006) Oncostatin M is a neuroprotective cytokine that inhibits excitotoxic injury in vitro and in vivo. FASEB J. 20, 23692371.
  • Wen T. C., Peng H., Hata R., Desaki J. and Sakanaka M. (2001) Induction of phosphorylated-Stat3 following focal cerebral ischemia in mice. Neurosci. Lett. 303, 153156.
  • Whalen M. J., Carlos T. M., Wisniewski S. R., Clark R. S., Mellick J. A., Marion D. W. and Kochanek P. M. (2000) Effect of neutropenia and granulocyte colony stimulating factor-induced neutrophilia on blood-brain barrier permeability and brain edema after traumatic brain injury in rats. Crit. Care Med. 28, 37103717.
  • Xia X., Li Y., Huang D., Wang Z., Luo L., Song Y., Zhao L. and Wen R. (2011) Oncostatin M protects rod and cone photoreceptors and promotes regeneration of cone outer segment in a rat model of retinal degeneration. PLoS ONE 6, e18282.
  • Yamashita T., Sawamoto K., Suzuki S. et al. (2005) Blockade of interleukin-6 signaling aggravates ischemic cerebral damage in mice: possible involvement of Stat3 activation in the protection of neurons. J. Neurochem. 94, 459468.
  • Yamauchi K., Osuka K., Takayasu M. et al. (2006) Activation of JAK/STAT signalling in neurons following spinal cord injury in mice. J. Neurochem. 96, 10601070.
  • Yang D. Y., Chen Y. J., Wang M. F., Pan H. C., Chen S. Y. and Cheng F. C. (2010) Granulocyte colony-stimulating factor enhances cellular proliferation and motor function recovery on rats subjected to traumatic brain injury. Neurol. Res. 32, 10411049.
  • Yi J. H., Park S. W., Kapadia R. and Vemuganti R. (2007) Role of transcription factors in mediating post-ischemic cerebral inflammation and brain damage. Neurochem. Int. 50, 10141027.
  • Yu J. H., Kim K. H. and Kim H. (2006) Suppression of IL-1beta expression by the Jak 2 inhibitor AG490 in cerulein-stimulated pancreatic acinar cells. Biochem. Pharmacol. 72, 15551562.
  • Zhao J., Li G., Zhang Y., Su X. and Hang C. (2011a) The potential role of JAK2/STAT3 pathway on the anti-apoptotic effect of recombinant human erythropoietin (rhEPO) after experimental traumatic brain injury of rats. Cytokine 56, 343350.
  • Zhao J. B., Zhang Y., Li G. Z., Su X. F. and Hang C. H. (2011b) Activation of JAK2/STAT pathway in cerebral cortex after experimental traumatic brain injury of rats. Neurosci. Lett. 498, 147152.
  • Zhong Z., Wen Z. and Darnell J. E., Jr (1994) Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science 264, 9598.

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Figure S1. Quantitative RT-PCR analysis for expression changes of STAT pathwayrelated genes. (a) Comparison of the qPCR results from the different animals groups (n=3 animals/group). Left graph: 6 hr sham surgery group versus the 24 hr sham surgery group. Middle graph: 6 hr FPI versus sham surgery. Right graph: 24 hr FPI versus sham surgery. The comparison of the two sham surgery groups yielded nearly identical results. (b) Graph showing the full analysis of the qPCR results from all of the genes tested. Expression of a few mRNAs such as Fcer1α, LOC681112 (similar to Il20), and Ifnγ exhibited a 5 to 8-fold variance between the sham surgery animals; however, this was not unexpected given that these transcripts were expressed at low levels.

As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.

FilenameFormatSizeDescription
JNC_7610_sm_FigS1.pdf396KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.