SEARCH

SEARCH BY CITATION

Keywords:

  • cannabinoid receptor;
  • endocannabinoid;
  • glial tumor;
  • human brain

Abstract

  1. Top of page
  2. Abstract
  3. Methods and materials
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Conflict of interest
  8. References
  9. Supporting Information

J. Neurochem. (2012) 120, 842–849.

Abstract

Endocannabinoids are neuromodulatory lipids that mediate the central and peripheral neural functions. Endocannabinoids have demonstrated their anti-proliferative, anti-angiogenic and pro-apoptotic properties in a series of studies. In the present study, we investigated the levels of two major endocannabinoids, anandamide and 2-arachidonylglycerol (2-AG), and their receptors, CB1 and CB2, in human low grade glioma (WHO grade I-II) tissues, high grade glioma (WHO grade III-IV) tissues, and non-tumor brain tissue controls. We also measured the expressions and activities of the enzymes responsible for anandamide and 2-AG biosynthesis and degradation, that is, N-acylphosphatidylethanolamine-hydrolysing phospholipase D (NAPE-PLD), fatty acid amide hydrolase (FAAH), monoacylglycerol lipase (MGL), and diacylglycerol lipase-alpha (DGL), in the same samples. Liquid chromatography–mass spectometry analysis showed that the levels of anandamide decreased, whereas the levels of 2-AG increased in glioma tissues, comparing to the non-tumor controls. The expression levels and activities of NAPE-PLD, FAAH and MGL also decreased in glioma tissues. Furthermore, quantitative-PCR analysis and western-blot analysis revealed that the expression levels of cananbinoid receptors, CB1 and CB2, were elevated in human glioma tissues. The changes of anandamide and 2-AG contents in different stages of gliomas may qualify them as the potential endogenous biomarkers for glial tumor malignancy.

Abbreviations used:
DGL-α

diacylglycerol lipase-alpha

FAAH

fatty acid amide hydrolase

MGL

monoacylglycerol lipase

NAPE-PLD

N-acylphosphatidylethanolamine-hydrolysing phospholipase D

THC

Δ9-tetrahydrocannabinoid

Human gliomas, the most aggressive and invasive cancers usually leading to death, account for 30–35% of the malignant primary brain tumors in adults. The treatments nowadays for human gliomas are either ineffective or palliative (Kesari et al. 2007; Norden et al. 2008). Becasue of their poor prognosis and high mortality, it is imperative to identify endogenous biomarkers for glial tumor malignancy and search for potential targets for the development of effective therapies.

After two distinct cannabinoid receptors CB1 and CB2 (Matsuda et al. 1990; Munro et al. 1993) were cloned, respectively, the study of endocannabinoid system has drawn great attention. Anandamide was the first endocannabinoid identified, followed by 2-arachindonylglycerol (2-AG) (Devane et al. 1992; Mechoulam et al. 1995). Anandamide binds to cannabinoid receptors with similar affinity to Δ9-tetrahydrocannabinoid (THC) (Gaoni and Mechoulam 1964), the active component of Cannabis sativa (marijunna) uncovered in 1960s. Although THC and its analogues have shown their capability to inhibit tumor cell growth and successfully been used in palliative treatments (Bifulco and Di Marzo 2002), they are not yet approved for anti-tumor indication. Recently, there is an increase of research focused on the potential role of THC and endocannabinoid system in cancer therapy (Galve-Roperh et al. 2000; Bifulco and Di Marzo 2002; Guzman et al. 2006; Cianchi et al. 2008). As a major and potent endocannabinoid lipid signal, anandamide has demonstrated its anti-proliferative, anti-metastatic, anti-angiogenic and pro-apoptotic properties in a broad spectrum of tumors (De Petrocellis et al. 1998; Guzman et al. 2002; Ligresti et al. 2003). Anandamide was shown to induce cell cycle arrest in G1 phase and that was regulated by CB1 receptor activation (Melck et al. 2000; Mimeault et al. 2003). It was recently reported that cannabinoid-induced inhibition of tumor growth and invasion was mediated through the regulation of matrix metalloproteinase-2 (Blazquez et al. 2008) and p38 MAPK signaling pathway (Pisanti et al. 2007), which are associated with fast tumor progression and poor prognosis.

The antineoplastic properties of cannabinoids are not only limited to the anti-proliferative effect but also include the pro-apoptotic effect on tumor cells. Anandamide promotes apoptosis through either the activation of vanilloid receptor (Maccarrone et al. 2000; Contassot et al. 2004) or the accumulation of the pro-apoptotic sphingolipid ceramide mediated via CB1 or CB2 receptor activation (Galve-Roperh et al. 2000; Mimeault et al. 2003). Sanchez et al. (2001) indicated that suppression of glioma growth by JWH-133, a selective agonist of CB2 receptor, was mediated by enhanced ceramide de novo synthesis (Galve-Roperh et al. 2000; Sanchez et al. 2001). In addition, the expression levels of CB2 receptors were found increased in human astrocytoma (Sanchez et al. 2001) and human leukaemia (McKallip et al. 2002).

To understand the role of the endocannabinoid system in tumorigenesis and its potential use in glioma therapy, it is important to investigate the endogenous levels of the two major endocannabinoids, that is, anandamide and 2-AG, and their signaling targets in human gliomas. In the present study, we evaluated the levels of anandamide and 2-AG, as well as their turnover enzymes, that is, NAPE-PLD, fatty acid amide hydrolase (FAAH), diacylglycerol lipase-alpha (DGL-α), and monoacylglycerol lipase (MGL), in human gliomas at different stages in comparison with non-tumor brain tissue controls. We also analyzed the expression levels of cannabinoid receptors, CB1 and CB2, in the same samples to further elucidate the role of endocannabinid signaling in the course of glioma development.

Methods and materials

  1. Top of page
  2. Abstract
  3. Methods and materials
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Conflict of interest
  8. References
  9. Supporting Information

Patients and tissue sampling

Tumor tissues were collected during tumor surgeries at the Neurosurgery Department of Fujian Medical University, the First Affiliated Hospital (Fuzhou, China). Informed consents were obtained from 71 patients before surgeries. Only 32 patients were subsequently diagnosed as gliomas based on pathology results and graded in accordance with WHO 2002 classification (Kleihues et al. 2002) (WHO grade I-IV). Non-tumor brain tissue was collected from same patient who underwent tumor resection only when it was necessary to penetrate normal brain in order to remove the tumor or the tumor was located peripherally in a non-eloquent lobe where taking a small sample shall not compromise the normal function. Upon resection, the tissue samples intended for Liquid chromatography-mass spectometry (LC/MS) analysis and enzyme assays were immediately placed in liquid nitrogen upon collection. Normal brain tissues were obtained from trauma patients undergoing brain surgery. The use of human tissues in this research was approved by the Ethical Review Board of Fujian Medical University, China.

Immunohistochemistry

Ten-micrometer frozen brain slides were cut with crystat (Leica, Shanghai, China) and fixed by 4% paraformaldehyde. The sections were rehydrated and treated with 0.3% H2O2 in methanol for 30 min to inactivate endogenous peroxidase, rinsed in 0.1 M phosphate-buffered saline, exposed to blocking serum (3% normal goat serum) for 1 h at 25°C, and then incubated overnight at 4°C with the anti-CB1 antibody (1 : 100 dilution; Abcam, Shanghai, China) and anti-GFAP (1 : 100 dilution; Millipore, Shanghai, China). After the incubation, the sections were rinsed with 0.1 M phosphate-buffered saline and exposed to Alex anti-rabbit IgG 488 and Alex anti-mouse IgG 555 (Invitrogen, Shanghai, China) for 2 h. After an additional rinse, the sections were mounted by VECTASHIELD® Mounting Medium with DAPI (Vector Lab, Shanghai, China) and detected under confocal microscope (Olympus, Shanghai, China).

Lipid extraction and analysis

One hundred micrograms of frozen tissues were homogenized in 2 mL of methanol/water mixture (1 : 1, vol/vol) containing 100 pmol of [2H4]-AEA and [2H4]-OEA as internal standards. Lipids were extracted with 2 mL of chloroform, and the organic phase was collected and dried under nitrogen. Lipids were reconstituted in chloroform and loaded onto small glass columns packed with Silica Gel G (60-Å 230–400 Mesh ASTM; Jiyida, Qingdao, China). Lipids were eluted with 9 : 1 (vol/vol) chloroform/methanol, dried under nitrogen, and reconstituted in 0.1 mL of methanol for LC/MS analyses.

We used an 1100-LC system (Agilent, Shanghai, China) interfaced to a 3200 Q Trap linear ion trap quadrupole mass spectrometer (Applied Biosystems, Shanghai, China). Lipids were separated using a XDB Eclipse C18 column (4.6 mm × 150 mm, 5 μm; Agilent), eluted with a gradient of methanol in water (from 85% to 100% methanol in 5 min, held at 100% methanol for 10 min) at a flow rate of 1 mL/min. Column temperature was kept at 25°C. Mass spectrometer (MS) detection was ionized by positive-ion atmospheric pressure chemical ionization mode (APCI+) and monitored in multiple reaction monitoring mode. The parameters were set as follows: curtain gas at 30 psi; nebulizer pressure (GAS1) at 60 psi; and temperature at 275°C. The molecular ions were monitored at m/z 348.00/62.00 for AEA, m/z 379.10/287.10 for 2-AG, m/z 326.10/62.00 for OEA, m/z 352.10/66.00 for [2H4]-AEA, and m/z 330.10/66.00 for [2H4]-OEA. Quantifications were calculated by determining chromatographic peak areas using Analyst® version 1.4.1. software (Applied Biosystems). For each calibration standard, the peak area ratios of AEA/[2H4]-AEA, 2-AG/[2H4]-AEA, and OEA/[2H4]-OEA were determined. A linear regression was then calculated following the regression equation: y = m(x) + b, where ‘x’ is equal to the peak area ratio of analyte/internal standard, ‘m’ is equal to the slope of the calibration curve, ‘y’ is equal to the concentration of analyte, and ‘b’ is equal to the y-intercept of the calibration.

Enzymatic assays

Tissues were homogenized in ice-cold Tris–HCl (50 mM, 10 vol, pH 7.4) containing 0.32 M sucrose. Protein concentration was measured by BCA Protein Assay kit (Pierce, Shanghai, China) in spectrophotometer and 100 μg of protein was used for enzymatic assay. NAPE-PLD activity was determined by using 1-palmitoyl,2-palmitoyl-sn-glycero-3-phosphoethanolamine-N-heptadecenoyl (17 : 1 NAPE, 50 μM) as substrate at 37°C for 30 min in 50 mM Tris–HCl (pH 7.4) containing 0.1% Triton X-100 and 1 mM of phenylsulphonylfluoride. The reactions were stopped by adding 200 μL of methanol containing [2H4]-OEA as internal standard. FAAH activity and MGL activity were detected at 37°C for 30 min in 50 mM Tris–HCl (pH 7.4) containing 0.05% bovine serum albumin and 100 μM of corresponding substrate, that is, anandamide or 2-oleoylglycerol, respectively. The reactions were stopped by adding 200 μL of methanol containing heptadecanoic acid (17 : 0 HA) as internal standard. We analyzed metabolites with LC/MS by monitoring the molecular ions at m/z 312.1/62.0 for heptadecanoylethanolamide, m/z 330.1/66.0 for [2H4]-OEA, m/z 303 for arachidonic acid, m/z 281 for oleic acid, and m/z 269 for 17 : 0 HA.

Western-blot analysis

50 μg of protein was subject to sodium dodecyl sulfate–gel electrophoresis (10%) and thence transferred to Hybond-P membranes (Amersham Biosciences, Shanghai, China). Immunoblotting was conducted using antibodies against CB1 receptor (1 : 500), CB2 receptor (1 : 500; Cayman, Shanghai, China) and β-actin. Bands were visualized with an Electrochemiluminescence Plus kit (Amersham Biosciences). Quantitative analyses were performed using the National Institutes of Health ImageJ software, with β-actin as the internal standard.

Real-time quantitative-PCR

Total RNA was extracted from tissues with TRIzol™ (Invitrogen) and quantified with spectrophotometer (Beckman Coulter, Shanghai, China). cDNA was synthesized from 1 μg of total RNA with ReverTra Ace qPCR RT Kit (TOYOBO, Shanghai, China) following the manufacturer’s instructions. Real-time quantitative PCR was performed in a 7300 real-time PCR System (Applied Biosystems) and mRNA expression levels were normalized by using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the internal standard. Primers were as follows: NAPE-PLD, forward primer (F): TGGCTGGGACACGCG, reverse primer (R): GGGATCCGTGAGGAGGATG; FAAH, F: GCCTCAAGGAATGCTTCAGC, R: TGCCCTCATTCAGGCTCAAG; MGL, F: CATGTGGATTCCATGCAGAAAG, R: AGGATTGGCAAGAACCAGAGG; DGL-α, F: AGAATGTCACCCTCGGAATGG, R: GTGGCTCTCAGCTTGACAAAGG; GAPDH, F: AAGTATGATGACATCAAGAAGGTGGT, R: AGCCCAGGATGCCCTTTAG.

Statistical analysis

Results were expressed as means ± SEM. Statistical significance was evaluated with one-way variance analysis (ANOVA) followed by the Dunnett’s post hoc test. Analyses were conducted using GraphPad Prism (GraphPad Software, San Diego, CA, USA), and the difference was considered significant if p < 0.05.

Results

  1. Top of page
  2. Abstract
  3. Methods and materials
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Conflict of interest
  8. References
  9. Supporting Information

Changes of endocannabinoid composition in human gliomas

Tumor tissues and the adjacent non-tumor tissues were obtained from 32 patients who underwent tumor resections. In terms of the pathology results, all samples were classified into three groups, that is, low-grade gliomas (WHO I-II), high-grade gliomas (WHO III-IV), and non-tumor tissues (Table 1 and Figure S1), in accordance with WHO 2002 classification (Kleihues et al. 2002). The lipid contents were determined and analyzed subsequently in all samples by LC/MS. By wet weight of tissue, the levels of anandamide decreased significantly in both low-grade and high-grade tumor tissues comparing to the non-tumor tissue controls (p < 0.05, 44.2 ± 8 pmol/g in non-tumor brain tissues, 21.5 ± 2.2 pmol/g in low-grade gliomas, and 30.3 ± 2 pmol/g in high-grade gliomas) (Fig. 1a). In contrast, 2-AG levels were increased in both low-grade and high-grade tumor tissues comparing with non-tumor tissue controls (p < 0.05, 56.9 ± 12.8 nmol/g in non-tumor brain tissues, 112.3 ± 13.4 nmol/g in low-grade gliomas, and 104.1 ± 1.3 nmol/g in high-grade gliomas) (Fig. 1b), whereas the levels of other N-acyl ethanolamide, oleoylethanolamide, were similar in all groups (210.6 ± 74.5 pmol/g in non-tumor tissues, 318 ± 94 pmol/g in low-grade gliomas, and 265 ± 61 pmol/g in high-grade glimas) (Fig. 1c).

Table 1.   Main clinical characteristics of enrolled patients
GroupsAge (mean ± SEM)Pre-treatmentTumor site
Low-grade (n = 10)17–57 (37 ± 4.4)NoneVentricle (n = 3, 30%)
Frontal and temporal lobe (n = 4, 40%)
Parietal and occipital (n = 3, 30%)
High-grade (n = 22)16–76 (44.6 ± 13.2)One patient received chemotherapy with Temiposide & SemustineVentricle (n = 1, 4.55%)
Frontal and temporal lobe (n = 17, 77.27%)
Parietal and occipital (n = 4, 17.18%)
Non-tumor (n = 21)16–57 (43 ± 5.4)NoneFrontal and temporal
image

Figure 1.  Levels of anandamide (a), 2-AG (b), and OEA (c) in non-tumor brain tissue controls (N, open bars), low-grade gliomas (L, gray bars), and high-grade gliomas (H, solid bars). Top panel showed LC/MS chromatographs for anandamide (a), 2-AG (b), and OEA (c). *p < 0.05, one-way anova followed by Dunette’s post hoc, n = 10–21.

Download figure to PowerPoint

To ensure that the non-tumor tissue controls, obtained from same patients who also contributed the tumor samples, were not infiltrated by tumor cells, we compared the endocannabinoid levels in non-tumor tissues with that in normal brain tissues obtained from other trauma patients undergoing brain surgery. Lipid analysis showed no significant difference of endocannabinoid contents between the non-tumor tissue controls and the normal brain tissues from trauma patients. The levels of anandamide were 44.2 ± 8 pmol/g in non-tumor tissue controls and 50.8 ± 2.6 pmol/g in normal brain tissues (p = 0.11) (Figure S2a); the levels of 2-AG were 56.9 ± 12.8 nmol/g in non-tumor tissue controls and 57.6 ± 12.7 nmol/g in normal brain tissues (p = 0.93) (Figure S2b); no significant difference was observed on OEA as well (Figure S2C).

image

Figure 2.  Down-regulation of anandamide metabolic enzymes in human gliomas. The activities (a, c) and mRNA expression levels (b, d) of NAPE-PLD (a, b) and FAAH (c, d) in non-tumor brain tissues (N, open bars), low-grade gliomas (L, gray bars), and high-grade gliomas (H, solid bars). *p < 0.05; **p < 0.01; ***p < 0.001; one-way anova followed by Dunette’s post hoc, n = 6–16.

Download figure to PowerPoint

Changes of endocannabinoid metabolism in human gliomas

To explore the molecular mechanism underlying the changes of endocannabinoids, we examined the expressions and activities of the enzymes responsible for endocannabinoid biosynthesis and degradation, including NAPE-PLD, FAAH, DGL-α and MGL, in all patient samples by quantitative-PCR and enzymatic activity assays, respectively. Comparing to the non-tumor tissues, NAPE-PLD mRNA expression (Fig. 2a) in tumor tissues decreased, so did the enzymatic activity (Fig. 2b) which was measured by using 17 : 1 NAPE as substrate. This down-regulation was accompanied by the reduction of FAAH’s mRNA expression (Fig. 2c) and enzymatic activity (Fig. 2d) in glioma samples. In addition, the expression and activity of FAAH showed greater decrease in high-grade gliomas (60%) than in low-grade gliomas (30%) (Fig. 2c and d). Figure 3 showed that mRNA expression (Fig. 3a) and activity (Fig. 3b) of MGL, the 2-AG hydrolyzing enzyme, decreased in glioma tissues comparing to that in the non-tumor tissues, whereas there was no difference in the expression levels of DGL-α, the 2-AG generating enzyme, between the groups (Fig. 3c).

image

Figure 3.  2-AG hydrolyzing-enzyme decreased in human gliomas. The activities (a) and mRNA expression levels (b), assessed by real-time PCR, of MGL (a, b) in patient samples. (c) The mRNA expression level of DGL-α in patient samples of non-tumor brain tissues (N, open bars); low-grade gliomas (L, gray bars); and high-grade gliomas (H, solid bars). *p < 0.05; **p < 0.01; ***p < 0.001; one-way anova followed by Dunette’s post hoc, n = 6–16.

Download figure to PowerPoint

Expression of cannabinoid receptors in human gliomas

Because of the changes of endocannabinoid levels in tumor tissues, we assumed there were corresponding changes in cannabinoid receptors. We examined the mRNA expression levels of cannabinoid receptors, CB1 and CB2, by quantitative PCR in all patient samples. CB1 expression increased 2-fold in high-grade gliomas (8.84 ± 1.2), comparing with low-grade gliomas (4.2 ± 0.5) and non-tumor brain tissues (4.6 ± 0.3), while there was no significant difference between low-grade gliomas and non-tumor brain tissues (Fig. 4a). Interestingly, CB2 expression revealed a different pattern. Figure 4b showed that CB2 expression was elevated in low-grade gliomas (13.4 ± 2.69) and even greater in high-grade gliomas (20.5 ± 3.92) in comparison with non-tumor tissue controls (4.6 ± 1.73).

image

Figure 4.  Expression levels of cannabinoid receptors increased in human gliomas. The mRNA expression levels of CB1 (a) and CB2 (b) in non-tumor brain tissues (N, open bars), low-grade gliomas (L, gray bars), and high-grade gliomas (H, solid bars). *p < 0.05; **p < 0.01; one-way anova followed by Dunette post hoc, n = 6–16.

Download figure to PowerPoint

The increased expression of CB1 and CB2 in gliomas was further investigated by Western-blot (Fig. 5) and immuno-histochemistry (Figure S3). To quantify the expression at protein level, we used ImageJ software to calculate optical density of western-blot data normalized by β-actin control. In tissue sections, the protein levels of CB1 and CB2 were 1.96 ± 0.53 and 2.16 ± 0.3 in high-grade glioma tissues; 0.97 ± 0.22 and 1.26 ± 0.13 in low-grade glioma tissues; 0.73 ± 0.11 and 0.27 ± 0.13 in non-tumor tissue controls (Fig. 5b and d), respectively. Furthermore, double-immunostaining revealed that the enhanced CB1 expression was mainly localized in GFAP-positive cells (Fig. 6).

image

Figure 5.  Western-blot detection showed the expression levels of CB1 receptor (a) and CB2 receptor (c) in non-tumor controls (N) and low-grade gliomas (L), and high-grade gliomas (H). (b, d) Quantitative analysis of western-blot corresponding to CB1 receptor (b) and CB2 receptor (d), respectively. *p < 0.05; **p < 0.01 one-way anova followed Dunette post hoc, n = 5–7.

Download figure to PowerPoint

image

Figure 6.  Increased CB1 receptors localized in glial cells. Double-immunostaining with antibodies against GFAP and CB1 receptor in human gliomas. (a) Anti-GFAP, (b) anti-CB1 receptor, (c) merged image. Scale bar, 15 μm.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Methods and materials
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Conflict of interest
  8. References
  9. Supporting Information

Analyzing the levels of anandamide and 2-AG as well as their receptors in gliomas may give hints for their potential roles in tumor suppression. An interesting finding in this study is that human glioma tissues, comparing to the non-tumor control tissues, harbored lower levels of anandamide, but higher levels of 2-AG. Patient samples were grouped pursuant to WHO 2002 classification. The adjacent non-tumor tissues, which contained similar levels of endocannabinoids to that in normal brain tissues from trauma patients, served as the non-tumor control in our study. The down-regulation of anandamide in gliomas suggests that the reduction of anandamide may be in favor of tumor cell proliferation or survival. Our observation was in accordance with the data obtained by Maccarrone et al. (2001). The down-regulation of anandamide in gliomas reported herein was consistent with our finding that the activities and expression levels of NAPE-PLD, the enzyme responsible for anandamide biosynthesis, decreased significantly in gliomas versus non-tumor controls, suggesting a reduction in anandamide synthesis in tumors. However, the activities and expression levels of FAAH, the anandamide-hydrolyzing enzyme, decreased nonetheless in the glioma tissues, implying a slower degradation of anandamide. The down-regulation of FAAH might be a result of negative feedback induced by low level of its endogenous substrate, i.e., anandamide. Between these two counteracting factors, the reduction of NAPE-PLD seemed to have more dominant effects than the decrease of FAAH as it resulted in a lower level of anandamide in gliomas. In our opinion, the decrease of anandamide content in tumor tissue implies that it may play a role in suppressing apoptosis and promoting tumor cell proliferation. However, a study conducted by Petersen et al. (2005) revealed that anandamide increased in glioblastoma brain tissues. These conflicting results could be caused by the variations in sample collecting and handling (Schmid et al. 1995; Felder et al. 1996; Kempe et al. 1996) and testing methods (Schmid et al. 2002).

The most notable lipid change in this study was the massive increase of 2-AG. This observation is consistent with that reported previously by other groups (Schmid et al. 2002; Petersen et al. 2005) and it was further supported by our finding on the 2-AG turnover enzymes. The 2-fold increase of 2-AG was accompanied by the decrease of activity and mRNA expression level of MGL, the enzyme responsible for 2-AG degradation, while the expression level of DGL-α, the enzyme involved 2-AG formation, was unchanged. Further studies may be conducted to elucidate which mechanism is primarily responsible for the increase of 2-AG content in gliomas.

Gliomas may appear in different cell types within a same location. It has been reported that CB1 receptors are mainly expressed in astroglial cells and neurons, while CB2 receptors appear mostly in microglial cells and endothelial cells (Stella 2004; Held-Feindt et al. 2006; Schley et al. 2009). We observed an increase of CB1 receptor expression in gliomas which may be related to the excessive production of 2-AG as previously described (De Petrocellis et al. 1998; Fowler 2003). However, the discrepancies in CB1 receptor expression in gliomas were observed by different groups. Held-Feindt et al. (2006) reported no significant change in the mRNA expression of CB1 receptor in glial tumors versus normal tissues; Schley et al. (2009) reported a slight increase of CB1 receptor expression in gliomas. De Jesus et al. (2010) found that CB1 receptor expression in human glioblastoma actually decreased. Several factors, including the variation in source of control tissues and patient age difference, may contribute to these contradictory results regarding CB1 receptor expression. Demographic factor was another significant variable that may contribute to the difference as all our samples were from Asian patients. In our case, the non-tumor tissue controls, which were confirmed with similar levels of endocannabinoids to normal tissues, were obtained from the same patients and hence involved no age bias or interference.

We also found that CB2 receptors increased in gliomas and the expression levels positively correlated with malignancy. It is known that cannabinoids may cause suppression of the immune system through CB2 activation (Berdyshev 2000; Xu et al. 2007). Elevated CB2 level reported herein likely facilitated the tumor invasion through the suppression of the anti-tumor immune system. The increase of CB2 receptors was related to the anti-inflammatory response in microglial cells (Romero-Sandoval et al. 2009). This connection to microglial cells may explicate the increase of CB2 receptors in gliomas we observed. Since microglia cells account for up to 30% of all tumor cells in gliomas (Badie and Schartner 2001), the increase of CB2 receptors in microglial cells shall translate into a large scale increase of said receptors in gliomas. In addition, a known characteristic of fast growing glioma is increased microvascular proliferation and formation of new blood microvessels whose endothelial cells express abundant CB2 receptors (Ellert-Miklaszewska et al. 2007; Schley et al. 2009). As activation of CB2 receptor is known to inhibit tumor vascularization (Casanova et al. 2003), the up-regulation of CB2 in gliomas induced by excessive 2-AG may constitute an in vivo anti-angiogenesis response.

In conclusion, the present study demonstrated the opposite changes of two major endocannabinoids, that is, the decrease of anandamide and increase of 2-AG in human glioma tissues, comparing with non-tumor controls. This finding should be of great interest in identifying an endogenous biomarker that characterizes different phases of glial tumors. Moreover, the changes in their receptors, CB1 and CB2, reflect their purported roles in the central nervous system and understanding of this information may eventually lead to a therapeutical strategy for human gliomas.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Methods and materials
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Conflict of interest
  8. References
  9. Supporting Information

We like to thank Dr Yang Chen and Dr Ana Guijarro Anton for generous support and technical consultation. We thank Ms Lin Chen for the help on experiments. This work was supported by Fujian Health-Education Research Grant (WKJ2008-2-45), china; Xiamen Science and Technology Key Program Grant (No.3502Z20100006), China.

References

  1. Top of page
  2. Abstract
  3. Methods and materials
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Conflict of interest
  8. References
  9. Supporting Information
  • Badie B. and Schartner J. (2001) Role of microglia in glioma biology. Microsc. Res. Tech. 54, 106113.
  • Berdyshev E. V. (2000) Cannabinoid receptors and the regulation of immune response. Chem. Phys. Lipids 108, 169190.
  • Bifulco M. and Di Marzo V. (2002) Targeting the endocannabinoid system in cancer therapy: a call for further research. Nat. Med. 8, 547550.
  • Blazquez C., Salazar M., Carracedo A., Lorente M., Egia A., Gonzalez-Feria L., Haro A., Velasco G. and Guzman M. (2008) Cannabinoids inhibit glioma cell invasion by down-regulating matrix metalloproteinase-2 expression. Cancer Res. 68, 19451952.
  • Casanova M. L., Blazquez C., Martinez-Palacio J., Villanueva C., Fernandez-Acenero M. J., Huffman J. W., Jorcano J. L. and Guzman M. (2003) Inhibition of skin tumor growth and angiogenesis in vivo by activation of cannabinoid receptors. J. Clin. Invest. 111, 4350.
  • Cianchi F., Papucci L., Schiavone N. et al. (2008) Cannabinoid receptor activation induces apoptosis through tumor necrosis factor alpha-mediated ceramide de novo synthesis in colon cancer cells. Clin. Cancer Res. 14, 76917700.
  • Contassot E., Wilmotte R., Tenan M., Belkouch M. C., Schnuriger V., de Tribolet N., Burkhardt K. and Dietrich P. Y. (2004) Arachidonylethanolamide induces apoptosis of human glioma cells through vanilloid receptor-1. J. Neuropathol. Exp. Neurol. 63, 956963.
  • De Jesus M. L., Hostalot C., Garibi J. M., Salles J., Meana J. J. and Callado L. F. (2010) Opposite changes in cannabinoid CB1 and CB2 receptor expression in human gliomas. Neurochem. Int. 56, 829833.
  • De Petrocellis L., Melck D., Palmisano A., Bisogno T., Laezza C., Bifulco M. and Di Marzo V. (1998) The endogenous cannabinoid anandamide inhibits human breast cancer cell proliferation. Proc. Natl. Acad. Sci. U S A 95, 83758380.
  • Devane W. A., Breuer A., Sheskin T., Jarbe T. U., Eisen M. S. and Mechoulam R. (1992) A novel probe for the cannabinoid receptor. J. Med. Chem. 35, 20652069.
  • Ellert-Miklaszewska A., Grajkowska W., Gabrusiewicz K., Kaminska B. and Konarska L. (2007) Distinctive pattern of cannabinoid receptor type II (CB2) expression in adult and pediatric brain tumors. Brain Res. 1137, 161169.
  • Felder C. C., Nielsen A., Briley E. M. et al. (1996) Isolation and measurement of the endogenous cannabinoid receptor agonist, anandamide, in brain and peripheral tissues of human and rat. FEBS Lett. 393, 231235.
  • Fowler C. J. (2003) Plant-derived, synthetic and endogenous cannabinoids as neuroprotective agents Non-psychoactive cannabinoids, ‘entourage’ compounds and inhibitors of N-acyl ethanolamine breakdown as therapeutic strategies to avoid pyschotropic effects.. Brain Res. Brain Res. Rev. 41, 2643.
  • Galve-Roperh I., Sánchez C., Cortes M. L., del Pulgar T. G., Izquierdo M. and Guzmán M. (2000) Anti-tumoral action of cannabinoids: involvement of sustained ceramide accumulation and extracellular signal-regulated kinase activation. Nat. Med. 6, 313319.
  • Gaoni Y. and Mechoulam R. (1964) Isolation, structure and partial synthesis of an active constituent of hashish. J. Am. Chem. Soc. 86, 16461647.
  • Guzman M., Sanchez C. and Galve-Roperh I. (2002) Cannabinoids and cell fate. Pharmacol. Ther. 95, 175184.
  • Guzman M., Duarte M. J., Blazquez C., Ravina J., Rosa M. C., Galve-Roperh I., Sanchez C., Velasco G. and Gonzalez-Feria L. (2006) A pilot clinical study of Delta9-tetrahydrocannabinol in patients with recurrent glioblastoma multiforme. Br. J. Cancer 95, 197203.
  • Held-Feindt J., Dorner L., Sahan G., Mehdorn H. M. and Mentlein R. (2006) Cannabinoid receptors in human astroglial tumors. J. Neurochem. 98, 886893.
  • Kempe K., Hsu F. F., Bohrer A. and Turk J. (1996) Isotope dilution mass spectrometric measurements indicate that arachidonylethanolamide, the proposed endogenous ligand of the cannabinoid receptor, accumulates in rat brain tissue post mortem but is contained at low levels in or is absent from fresh tissue. J. Biol. Chem. 271, 1728717295.
  • Kesari S., Schiff D., Doherty L. et al. (2007) Phase II study of metronomic chemotherapy for recurrent malignant gliomas in adults. Neuro Oncol. 9, 354363.
  • Kleihues P., Louis D. N., Scheithauer B. W., Rorke L. B., Reifenberger G., Burger P. C. and Cavenee W. K.. (2002) The WHO classification of tumors of the nervous system. J. Neuropathol. Exp. Neurol. 61, 215225; discussion 226–219.
  • Ligresti A., Bisogno T., Matias I. et al. (2003) Possible endocannabinoid control of colorectal cancer growth. Gastroenterology 125, 677687.
  • Maccarrone M., Lorenzon T., Bari M., Melino G. and Finazzi-Agro A. (2000) Anandamide induces apoptosis in human cells via vanilloid receptors Evidence for a protective role of cannabinoid receptors. J. Biol. Chem. 275, 3193831945.
  • Maccarrone M., Attina M., Cartoni A., Bari M. and Finazzi-Agro A. (2001) Gas chromatography-mass spectrometry analysis of endogenous cannabinoids in healthy and tumoral human brain and human cells in culture. J. Neurochem. 76, 594601.
  • Matsuda L. A., Lolait S. J., Brownstein M. J., Young A. C. and Bonner T. I. (1990) Structure of a cannabinoid receptor and functional expression of the cloned cDNA. Nature 346, 561564.
  • McKallip R. J., Lombard C., Fisher M., Martin B. R., Ryu S., Grant S., Nagarkatti P. S. and Nagarkatti M. (2002) Targeting CB2 cannabinoid receptors as a novel therapy to treat malignant lymphoblastic disease. Blood 100, 627634.
  • Mechoulam R., Ben-Shabat S., Hanus L. et al. (1995) Identification of an endogenous 2-monoglyceride, present in canine gut, that binds to cannabinoid receptors. Biochem. Pharmacol. 50, 8390.
  • Melck D., De Petrocellis L., Orlando P., Bisogno T., Laezza C., Bifulco M. and Di Marzo V. (2000) Suppression of nerve growth factor Trk receptors and prolactin receptors by endocannabinoids leads to inhibition of human breast and prostate cancer cell proliferation. Endocrinology 141, 118126.
  • Mimeault M., Pommery N., Wattez N., Bailly C. and Henichart J. P. (2003) Anti-proliferative and apoptotic effects of anandamide in human prostatic cancer cell lines: implication of epidermal growth factor receptor down-regulation and ceramide production. Prostate 56, 112.
  • Munro S., Thomas K. L. and Abu-Shaar M. (1993) Molecular characterization of a peripheral receptor for cannabinoids. Nature 365, 6165.
  • Norden A. D., Drappatz J. and Wen P. Y. (2008) Antiangiogenic therapy in malignant gliomas. Curr. Opin. Oncol. 20, 652661.
  • Petersen G., Moesgaard B., Schmid P. C., Schmid H. H., Broholm H., Kosteljanetz M. and Hansen H. S. (2005) Endocannabinoid metabolism in human glioblastomas and meningiomas compared to human non-tumour brain tissue. J. Neurochem. 93, 299309.
  • Pisanti S., Borselli C., Oliviero O., Laezza C., Gazzerro P. and Bifulco M. (2007) Antiangiogenic activity of the endocannabinoid anandamide: correlation to its tumor-suppressor efficacy. J. Cell. Physiol. 211, 495503.
  • Romero-Sandoval E. A., Horvath R., Landry R. P. and DeLeo J. A. (2009) Cannabinoid receptor type 2 activation induces a microglial anti-inflammatory phenotype and reduces migration via MKP induction and ERK dephosphorylation. Mol. Pain 5, 25.
  • Sanchez C., de Ceballos M. L., Gomez del Pulgar T., Rueda D., Corbacho C., Velasco G., Galve-Roperh I., Huffman J. W., Ramon y Cajal S. and Guzman M. (2001) Inhibition of glioma growth in vivo by selective activation of the CB(2) cannabinoid receptor. Cancer Res. 61, 57845789.
  • Schley M., Stander S., Kerner J., Vajkoczy P., Schupfer G., Dusch M., Schmelz M. and Konrad C. (2009) Predominant CB2 receptor expression in endothelial cells of glioblastoma in humans. Brain Res. Bull. 79, 333337.
  • Schmid P. C., Krebsbach R. J., Perry S. R., Dettmer T. M., Maasson J. L. and Schmid H. H. (1995) Occurrence and postmortem generation of anandamide and other long-chain N-acylethanolamines in mammalian brain. FEBS Lett. 375, 117120.
  • Schmid P. C., Wold L. E., Krebsbach R. J., Berdyshev E. V. and Schmid H. H. (2002) Anandamide and other N-acylethanolamines in human tumors. Lipids 37, 907912.
  • Stella N. (2004) Cannabinoid signaling in glial cells. Glia 48, 267277.
  • Xu H., Cheng C. L., Chen M., Manivannan A., Cabay L., Pertwee R. G., Coutts A. and Forrester J. V. (2007) Anti-inflammatory property of the cannabinoid receptor-2-selective agonist JWH-133 in a rodent model of autoimmune uveoretinitis. J. Leukoc. Biol. 82, 532541.

Supporting Information

  1. Top of page
  2. Abstract
  3. Methods and materials
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Conflict of interest
  8. References
  9. Supporting Information

Figure S1. Histological staining with H&E on normal brain tissue (a), non-tumor brain tissue control (b), low-grade glioma tissue (c) and high-grade glioma tissue (d).

Figure S2. The levels of anandamide (a), 2-AG (b), and OEA (c) in normal brain tissues (open bars) and non-tumor brain tissues (closed bars).

Figure S3. Immuno-histochemistry showed the increase of CB1 in human gliomas. The expression level of CB1 was detected with antibody against CB1 in non-tumor brain tissues (a), low-grade gliomas (b), and high-grade gliomas (c).

As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.

FilenameFormatSizeDescription
JNC_7625_sm_FigS1-S3.pdf19321KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.