SEARCH

SEARCH BY CITATION

Keywords:

  • African weakly electric fish;
  • Campylomormyrus numenius;
  • cross-species amplification;
  • microsatellites;
  • Mormyridae

Abstract

  1. Top of page
  2. Abstract
  3. Acknowledgements
  4. References

We describe isolation and characterization of the first microsatellite loci specifically developed for African weakly electric fish (Mormyridae), for the genus Campylomormyrus. Seventeen of our 18 loci are polymorphic within the Campylomormyrus numenius species complex. The polymorphic loci showed four to 15 alleles per locus, an expected heterozygosity between 0.46 and 0.94, and an observed heterozygosity between 0.31 and 1.00. Most primers also yield reproducible results in several other mormyrid species. These loci comprise a set of molecular markers for various applications, from moderately polymorphic loci suitable for population studies to highly polymorphic loci for pedigree analysis in mormyrids.

The endemic African mormyrids comprise the single largest group of electric fish worldwide (Alves-Gomes & Hopkins 1997). Mormyrid fish (Mormyridae) belongs to the Osteoglossomorpha, which is considered as one of the phylogenetically basal groups of extant teleosts (Lauder & Liem 1983). They are characterized by the derived (synapomorphic) presence of electric organs, matched electroreceptors and a greatly enlarged cerebellum, among other characters (Taverne 1972). While primers for some mitochondrial (cytochrome b, 12S and 16S rRNA) and nuclear genes (RAG2, S7 ribosomal protein gene) are available (Alves-Gomes & Hopkins 1997; Lavouéet al. 2000, 2003; Sullivan et al. 2000), no microsatellite studies on African weakly electric fish have been conducted so far. Here, we present the first microsatellite primers specifically developed for mormyrids, especially for the genus Campylomormyrus.

Genomic DNA was extracted from dorsal fin clips of 13 fishes of the Campylomormyrus numenius species complex, originating from the Congo Basin (Central Africa), using the DNeasy DNA extraction kit (QIAGEN) according to the manufacturer's instructions. In order to assess the cross-species amplification of our new primers, we also obtained genomic DNA from several species of other mormyrid genera: Brienomyrus niger, Gnathonemus petersii, Hippopotamyrus pictus, Mormyrus rume proboscirostris, and Petrocephalus soudanensis.

A microsatellite-enriched genomic DNA library was constructed from a total DNA extract of a Campylomormyrus numenius fin sample according to Hamilton et al. (1999) and Paulus & Tiedemann (2003). Genomic DNA was simultaneously restricted with NheI, HaeII, RsaI, and AluI. After treatment with mung bean exonuclease and calf intestinal phosphatase, genomic DNA fragments were blunt-end ligated to SNX linkers and polymerase chain reaction (PCR) amplified with linker primers. Fragments were hybridized with 5′-biotin labelled microsatellite probes ([GA]15 and [GT]15), conjugated with streptavidin-coated magnetic beads (Dynal), and extracted with a magnetic device. After a further PCR amplification, fragments were restricted with NheI at a restriction site within the linker, ligated into Bluescript plasmids, and transformed into competent Escherichia coli (XL1-Blue MRF′, Stratagene). Recombinants were identified by blue-white-selection, blotted onto a nylon membrane, and again hybridized with the microsatellite probes. Positive clones were detected using the Phototope-Star chemiluminescent detection kit (New England Biolabs), sequenced with the BigDye version 1.1 Terminator Cycle Sequencing Kit (Applied Biosystems), and analysed on an AB 3100 multicapillary automatic sequencer (Applied Biosystems). Primers were constructed from flanking regions of microsatellite loci (Table 1). To facilitate cloning of PCR products for allele-specific DNA sequencing using the TOPO TA Cloning Kit (Invitrogen), we designed primers starting on guanin (G) at the 5′-end.

Table 1.  Characteristics of 18 microsatellites in the genus Campylomormyrus and the applicability of primers to other mormyrids
Primer name and sequence (5′–3′)GenBank Accession no.Characteristics in CampylomormyrusAmplifiable sizes in other mormyrids (— indicates no PCR product)
Repeat sequenceTanNo. of allelesAllele sizeHEHOGpPsBnMrHp
  1. Ta (°C), PCR annealing temperature; n, number of Campylomormyrus specimens analysed; HE, expected heterozygosity; HO, observed heterozygosity; Gp, Gnathonemus petersii; Ps, Petrocephalus soudanensis; Bn, Brienomyrus niger; Mr, Mormyrus rume proboscirostris; and Hp, Hippopotamyrus pictus.

CampGTI35FGCTTCATAATCCCCATCTTGCTAJ865352(GT)1555 5 6122–1380.890.60 92
CampGTI35RGGGAGAACTTGCACAATCGGT             
CampGTII6bFGTTTCAATGAAAACGCCAAACGAJ865353(TG)18501314144–1880.940.61144158148
CampGTII6bRGCCTGAGCCAGTCCCGTCTGTT             
CampGAI28FGCCAGCTGTGGGGAACTTCAAAAJ865354(GA)12AA(GA)55513 7173–2190.820.46175176167185171
CampGAI28RGAGCTGCCGACATCCACTTCCG           189 
CampGTIII41FGTTTTCTCATATTAATCTGTGCAJ865355(GT)6CT(GT)4CT(GT)75513 4177–1950.480.31185173185173199
CampGTIII41RGTAGGTTAGCAGTGTCTTATCA         175   
CampGTI19FGTCGGCTGAATGGAGTGACACTAJ865356(GT)125513 6188–2020.560.46186228150196198
CampGTI19RGTCAAGTTGAGGGATATGCTGC          186  
CampGTII2aFGTTCATGTGTTAAATCAAGGCGAJ865357(GT)9551311193–2490.850.69227227219249
CampGTII2aRGGGAAATCAAAATGGTGACAG            255
CampGAII26FGTGAGGCTGATGAGCACAACATAJ865358(GT)6GGCA(GA)145513 6208–2280.720.46250
CampGAII26RGCCTGGCTCTCAACAACCTGTG             
CampGTII27FGATCAGTGTTCTTTTTCAAATAJ865359(GT)5GC(GT)3TT(GT)75013 12790.000.00267
CampGTII27RGGGAACTGTAGTAAAATAAAG             
CampGAIII8FGTCTTCTCTGATTAACTGCTCTAJ865360(GA)3AAGC(GA)20551313379–4330.820.69405
CampGAIII8RGTAGAACAAATGTTCCTTCGT             
CampGTI18aFGCCAGAAAGGATGTCCCAGCTCAJ865361(GT)5GC(GT)35513 4150–1580.460.38192158140170
CampGTI18aRGGACCCCCCACTGACAAATTT        202    
CampGTI39FGTCACTCAATGTATAAAATGCAAJ865362(GT)16551313171–2130.920.85201
CampGTI39RGAGATGTGAAAACTGAGCAACT        215    
CampGTIII4bFGTTCCACTTCTATGCTTCCCTGAJ865363(GT)12551314194–2360.941.00190190182
CampGTIII4bRGTGTCACAATTTCTTAACGCCA        202    
CampGAI8FGACATTGTCTGAACTGAAACGAAJ865364(GA)26551313177–2150.920.92193
CampGAI8RGCTTCTGTTGTTGAGGGCTTAA             
CampGAI14FGGTTCCCCGTTGGTTCTGTCTAJ865365(GA)22551315189–2370.940.92181183
CampGAI14RGCATCCAGGGCTTTCACTTTCC             
CampGAII17FGCAAGGTGCATTATTGCGATTTAJ865366(GA)125513 9222–2440.860.69214214236228216
CampGAII17RGCCTGTCAAGTCCCGACTCACG             
CampGTII6aFGTTGGACCTGAAATGTAAGATAJ865367(GATG)12481310188–2360.870.85188184200180
CampGTII6aRGACTTGCACATCTGTCACCTAT          188204 
CampGAII42FGTCATGAGGTCAGTAGGAAGAAAJ865368(GA)5AG(GA)16551310345–3760.860.92360360414356348
CampGAII42RGATGGAGAGTTGTTTTGAAGAA          430 368
CampGAIII4FGATGAATGAACTGGCGAGATGCAJ865369(GA)16521311450–4940.810.54470
CampGAIII4RGTCACTTCCACCTTCCCTTAGC             

About 100 ng of genomic DNA were used as template. The PCR was performed in a total volume of 37.5 µL, containing 1 mm Tris-HCl, pH 9.0, 5 mm KCl, 0.15 mm MgCl2, 0.2 mm of each dNTP, 0.13 µm of both forward and reverse primers (forward primer was 5′-fluorescence-labelled), and 0.75 U Taq polymerase (Qbiogene). Amplifications were performed in a Biometra TGradient thermocycler according to the following reaction profile: one cycle at 95 °C for 5 min, 40 cycles at 94 °C for 1 min 30 s, at the locus-specific annealing temperature (Ta in Table 1) for 1 min 15 s, 72 °C for 1 min 30 s, and a final extension at 72 °C for 7 min. Fragment size was determined on an AB 3100 automatic sequencer, using the genemapper version 3.5 software and an internal size standard (LIZ500, Applied Biosystems).

We identified 18 new microsatellite loci for Campylomormyrus numenius, of which 17 are polymorphic. No linkage disequilibrium among the loci was detected, except for two pairs of loci. Data analysis using the arlequin software (Schneider et al. 2000) indicates linkage disequilibrium between CampGAII26 and CampGAIII4 as well as between CampGTI39 and CampGAIII4. The polymorphic loci had four to 15 different alleles, an expected heterozygosity (HE) from 0.46 to 0.94, and an observed heterozygosity (HO) from 0.31 to 1.00 (Table 1). A few loci exhibited heterozygote deficits. Because of small sample size, however, we were unable to discriminate, whether this was caused by null alleles, population subdivision, or stochastic effects. These first microsatellite loci specifically developed for African weakly electric fish of the genus Campylomormyrus comprise a set of molecular markers for various applications, from moderately polymorphic loci suitable for population studies to highly polymorphic loci for pedigree analysis. We also investigated the cross-species amplification with our primers in species of several other mormyrid genera. Most primers yield reproducible results in several mormyrid species (Table 1), indicating their potentially wide applicability.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Acknowledgements
  4. References

We acknowledge financial support from Deutsche Forschungsgemeinschaft (SPP-1127: TI 349/1–1).

References

  1. Top of page
  2. Abstract
  3. Acknowledgements
  4. References
  • Alves-Gomes J, Hopkins CD (1997) Molecular insights into the phylogeny of mormyriform fishes and the evolution of their electric organs. Brain, Behavior and Evolution, 49, 324351.
  • Hamilton MB, Pincus EL, DiFiore A, Fleischer RC (1999) Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. BioTechniques, 27, 500507.
  • Lauder GV, Liem KF (1983) The evolution and interrelationships of the actinopterygian fishes. Bulletin of the Museum of Comparative Zoology, 150, 95197.
  • Lavoué S, Bigorne R, Lecointre G, Agnèse J-F (2000) Phylogenetic relationships of mormyrid electric fishes (Mormyridae; Teleostei) inferred from cytochrome b sequences. Molecular Phylogenetics and Evolution, 14, 110.
  • Lavoué S, Sullivan JP, Hopkins CD (2003) Phylogenetic utility of the first two introns of the S7 ribosomal protein gene in African electric fishes (Mormyroidea; Teleostei) and congruence with other molecular markers. Biological Journal of the Linnean Society, 78, 273292.
  • Paulus KB, Tiedemann R (2003) Ten polymorphic autosomal microsatellite loci for the eider duck Somateria mollissima and their cross-species applicability among waterfowl species (Anatidae). Molecular Ecology Notes, 3, 250252.
  • Schneider S, Roessli D, Excoffier L (2000) arlequin: a software for population genetics data version 2.000. Department of Anthropology, University of Geneva, Switzerland.
  • Sullivan JP, Lavoué S, Hopkins CD (2000) Molecular systematics of the African electric fishes (Mormyroidea; Teleostei) and a model for the evolution of their electric organs. Journal of Experimental Biology, 203, 665683.
  • Taverne L (1972) Ostéologie des Genres Mormyrus Linné, Mormyrops Müller, Hyperopisus Gill, Isichthys Gill, Myomyrus Boulenger, Stomatorhinus Boulenger et Gymnarchus Cuvier Considérations Générales sur la Systématique des Poissons de l’Ordre des Mormyriformes. Musee Royal de L’Afrique Central, Tervuren.