SEARCH

SEARCH BY CITATION

Keywords:

  • β-glucuronidase;
  • aminopeptidase N;
  • Lactobacillus plantarum;
  • regulation;
  • sakacin P

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Bacterial strains, plasmids and standard genetic techniques
  6. Plasmid construction
  7. Gene expression studies
  8. Results
  9. Discussion
  10. Acknowledgements
  11. References

Aims:  To use promoters and regulatory genes involved in the production of the bacteriocin sakacin P to obtain high-level regulated gene expression in Lactobacillus plantarum.

Methods and Results:  In a plasmid containing all three operons naturally involved in sakacin P production, the genes encoding sakacin P and its immunity protein were replaced by the aminopeptidase N gene from Lactococcus lactis (pepN) or the β-glucuronidase gene from Escherichia coli (gusA). The new genes were precisely fused to the start codon of the sakacin P gene and the stop codon of the immunity gene. This set-up permitted regulated (external pheromone controlled) overexpression of both reporter genes in L. plantarum NC8. For PepN, production levels amounted to as much as 40% of total cellular protein.

Conclusions: Promoters and regulatory genes involved in production of sakacin P are suitable for establishing inducible high-level gene expression in L. plantarum.

Significance and Impact of the Study: This study describes a system for controllable gene expression in lactobacilli, giving some of the highest expression levels reported so far in this genus.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Bacterial strains, plasmids and standard genetic techniques
  6. Plasmid construction
  7. Gene expression studies
  8. Results
  9. Discussion
  10. Acknowledgements
  11. References

Lactic acid bacteria (LAB) are important micro-organisms, because of their many roles in the fermentation and preservation of food and because of their presence in the human intestine (Axelsson 1998; Ross et al. 2002). As many LAB have the generally regarded as safe (GRAS) status and some LAB show probiotic effects on animal and human health (Mercenier et al. 2003), they are important organisms for biotechnological applications. LAB have potential as food-grade cell factories and as delivery vehicles for antigens, antibodies and growth factors.

Many LAB produce anti-microbial peptides called bacteriocins, whose production is often regulated via a quorum-sensing system (Kleerebezem et al. 1999; Nes and Eijsink 1999; Eijsink et al. 2002; Quadri 2002). In the case of class I bacteriocins (lantibiotics such as nisin), the bacteriocin itself acts as pheromone, which activates a two-component regulatory system consisting of a histidine kinase receptor and a cognate response regulator. For class II bacteriocins, there is one known case of a bacteriocin that induces its own production (Kleerebezem and Quadri 2001). However, in most cases strains producing class II bacteriocins secrete a separate pheromone peptide with no or little bacteriocin activity, whose gene is co-transcribed with the genes encoding the cognate two-component regulatory system (see Fig. 1). In both systems, the phosphorylated response regulator acts as a transcription activator, enhancing transcription of all operons involved in bacteriocin production.

image

Figure 1. Schematic overview of inserts in some of the plasmids used in this study. pMLS114 contains the natural ssp gene cluster and contains all genes necessary for production of sakacin P, encoded by sppA (Hühne et al. 1996). The genes are transcribed from characteristic promoters (indicated by the thin arrows), which are all activated by the phosphorylated form of the response regulator encoded by the sppR gene (Brurberg et al. 1997; Risøen et al. 2000). Other gene products: sppIP, peptide pheromone; sppK, histidine kinase; spiA, immunity protein; sppT and sppE, transport system. PorfX precedes another putative bacteriocin gene (Brurberg et al. 1997). In pGM1, sppA and spiA have been replaced with pepN. pGM4 is a derivative of pGM1 carrying a deletion (▵) in sppIP

Download figure to PowerPoint

The genes and promoters involved in nisin production have been used to develop a nisin-controlled expression (NICE) system for efficient, regulated overproduction of heterologous proteins in lactococci (de Ruyter et al. 1996), lactobacilli (Pavan et al. 2000), and other Gram-positive bacteria (Eichenbaum et al. 1998). Similar systems may be developed on the basis of genes and promoters involved in the production of class II bacteriocins. For example, Axelsson et al. (1998) have established a two-plasmid system for overproduction of heterologous bacteriocins in Lactobacillus sakei, based on genes and promoters involved in the production of sakacin A. Studies with the aminopeptidase N reporter gene (pepN from Lactococcus lactis) have shown that this system is not suitable for high-level protein production in Lactobacillus plantarum (G. Mathiesen, V.G.H. Eijsink and L. Axelsson, unpublished observations). Recently, regulated bacteriocin promoters have been used to construct one-plasmid inducible expression systems (Axelsson et al. 2003; Sørvig et al. 2003). These new systems showed promising results with the gusA reporter gene, but in all cases, expression levels in L. plantarum were ca 10 times lower than the levels obtained with the NICE system (Pavan et al. 2000; Sørvig et al. 2003).

Our previous studies on overproduction of sakacin P in lactobacilli (Hühne et al. 1996; I.M. Aasen and L. Axelsson, unpublished observations) showed that the highest production levels were obtained in strains harbouring all operons naturally involved in sakacin P production, in their natural organization (plasmid pMLS114; Fig. 1). Therefore, pMLS114 was used as a starting point for establishing regulated expression of aminopeptidase N from Lactococcus lactis (pepN) and β-glucuronidase from Escherichia coli (gusA) in L. plantarum. The resulting gene expression system allowed controlled gene expression in lactobacilli, at levels that are among the highest ever described for lactic acid bacteria.

Bacterial strains, plasmids and standard genetic techniques

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Bacterial strains, plasmids and standard genetic techniques
  6. Plasmid construction
  7. Gene expression studies
  8. Results
  9. Discussion
  10. Acknowledgements
  11. References

Table 1 gives an overview of the bacterial strains and plasmids used in this study. Escherichia coli cells were grown in shaking flasks at 37°C in brain–heart infusion (BHI) medium (Oxoid Ltd, Basingstoke, UK). Lactobacillus plantarum NC8 was grown in MRS medium (Oxoid Ltd) at 30°C without shaking, unless stated otherwise. For plates, media were solidified by adding 1·5% (w/v) agar. Antibiotic concentrations were: ampicillin – 150 μg ml−1 (E. coli); kanamycin – 50 μg ml−1 (E. coli); erythromycin – 200 μg ml−1 (E. coli) and 5 μg ml−1 (lactobacilli).

Table 1.  Strains and plasmids used in this study
 Relevant characteristics/purposeSource or reference
Strains
 E. coli DH5αHost strain for plasmidsInvitrogen
 E. coli JM109Host strain for plasmidsPromega
 E. coli TOP10Host strain for ‘TOPO-cloning’ of PCR fragmentsInvitrogen
 L. plantarum NC8Host strain (silage isolate) for pMLS114 derivativesAukrust and Blom (1992)
Plasmid
 pCR2·1-TOPOVector for cloning of PCR fragments, AmprInvitrogen
 pCR Blunt-TOPOVector for cloning of PCR fragments, KanrInvitrogen
 pMLS114Derivative of pLPV111 containing all spp genes necessary for production ;of the class II bacteriocin sakacin P (see Fig. 1), EmrHühne et al. (1996)
 pKRV3a-gusSource of gusA geneAxelsson et al. (2003)
 pSTO10Source of pepN geneChr Hansen A/S, Denmark, Strøman (1992)
 pGM1pMLS114 derivative; pepN replaces sppA and spiA, Emr (Fig. 1)This work
 pGM4pMLS114 derivative; pepN replaces sppA and spiA; deletion ;in sppIP, Emr (Fig. 1)This work
 pGM4-GUSpMLS114 derivative; gusA replaces sppA and spiA; deletion in sppIP, EmrThis work

All cloning steps were conducted according to standard procedures as described in Sambrook et al. (1989). PCR reactions were performed in a PTC-100 Programmable Thermal Controller (MJ Research, Inc., Waltham, MA, USA) with Pfu DNA polymerase (Promega Corp., Madison, WI, USA), as recommended by the polymerase supplier. Oligonucleotides were purchased from Medprobe (Oslo, Norway). PCR fragments were subcloned using the TOPO system provided by Invitrogen (Carlsbad, CA, USA). All PCR-derived DNA fragments were sequenced using the BigDye Terminator Cycle Sequencing Kit, according to the manufacturer's recommendations, and the ABI Prism 377 DNA sequencer (Perkin Elmer/Applied Biosystems, Foster City, CA, USA).

Chemically competent E. coli JM109 (Promega Corp.), or DH5α (Invitrogen) were transformed applying the protocol provided by the supplier. Lactobacilli were transformed according to the protocol of Aukrust et al. (1995).

Plasmid DNA from E. coli and lactobacilli was isolated using the QIAprep Miniprep Kit (Qiagen, Venlo, The Netherlands). Lactobacillus cells were incubated for 25 min at 37°C with 5 mg ml−1 lysozyme, 15 U ml−1 mutanolysin and 100 μg ml−1 RNase (all Sigma, St Louis, MO, USA) before adding the lysis buffer from the QIAprep kit.

Extraction and purification of DNA from agarose gels was performed using the QIAquick Gel Extraction Kit (Qiagen).

Plasmid construction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Bacterial strains, plasmids and standard genetic techniques
  6. Plasmid construction
  7. Gene expression studies
  8. Results
  9. Discussion
  10. Acknowledgements
  11. References

All derivatives of plasmid pMLS114 (Fig. 1; Hühne et al. 1996), were based on a precise exchange of the two genes in the bacteriocin operon (sppA + spiA; Fig. 1) by either pepN (Strøman 1992) or gusA (Schlaman et al. 1994). Thus, the new gene was inserted by making both a translational fusion with the ATG start codon of sppA and a stop codon fusion with spiA. The constructs were made using recombinant PCR (Higuchi 1990) and standard subcloning steps. The primers used at the fusion points are shown in Table 2. In plasmid pGM1 (Fig. 1), the bacteriocin operon is replaced with pepN; plasmid pMLS114 was used as template for PsppA and the region downstream of the stop codon of spiA, whereas plasmid pSTO10 (Table 1) was used as a template for the pepN gene. To make pepN expression dependent on externally added peptide, a deletion was introduced in the sppIP gene in pGM1, yielding pGM4 (Table 1; Fig. 1). The primers used at the deletion point are shown in Table 2. pGM4-GUS is analogous to pGM4, containing the gusA instead of the pepN gene. The primers used at the fusion points are shown in Table 2. The template for the gusA gene was pKRV3a-gus (Table 1). All constructs were transformed to L. plantarum NC8.

Table 2.  Primers used at fusion and deletion points
Primers*Sequence†Application
  1. *F, forward direction; R, reverse direction.

  2. †Start codons and stop codons are underlined; nucleotides adjacent to the deletion in the sppIP gene are printed in bold face.

PepN2RCGTTTTACAGCCATTAGAATCATACTCCTATATATTATTTTATFusion of PsppApepN
PepN3FGAGTATGATTCTAATGGCTGTAAAACGTTTAATTFusion of PsppApepN
PepN6RTAAGCTGCTACAATTTTTCAGCAATATCAGStop codon fusion pepNspiA
PepN7FGAAAAATTGTAGCAGCTTAATTCTGTAGCACStop codon fusion pepNspiA
GusA2RGGACGTACCATTAGAATCATACTCCTATATATTATTFusion of PsppAgusA
GusA4FGAGTATGATTCTAATGGTACGTCCTGTAGAAACFusion of PsppAgusA
GusA6RGAATTAAGCTGTCATTGTTTGCCTCStop codon fusion gusAspiA
GusA7FGGCAAACAATGACAGCTTAATTCTGTStop codon fusion gusAspiA
IPdel2RCACCAACAACCGAAAGTTTTTTAAATATCATCATACTTTCTCCDeletion of sppIP
IPdel3FGATATTTAAAAAACTTTCGGTTGTTGGTGAGCATGTTATATACDeletion of sppIP

Gene expression studies

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Bacterial strains, plasmids and standard genetic techniques
  6. Plasmid construction
  7. Gene expression studies
  8. Results
  9. Discussion
  10. Acknowledgements
  11. References

Over night cultures of L. plantarum NC8 harbouring pepN-containing plasmids were diluted 100-fold (to O.D.600ca 0·1) in MRS with appropriate antibiotics. If induction was desirable, 25 ng ml−1 pheromone peptide (IP-673) (Molecular Biology Unit, University of Newcastle-upon-Tyne, UK) was added to the medium and the cultures were grown to an O.D.600 of 2·3–2·5. In dose–response experiments the pheromone concentration was varied from 0 to 100 ng ml−1. Cells were harvested by centrifugation and disrupted by glass beads (106 μm and finer, G-4649; Sigma) essentially as described by van de Guchte et al. (1991). The resulting protein extract was used to assay aminopeptidase activity using l-lysine p-nitroanilide (Sigma) as substrate (Exterkate 1984). The protocol for determining PepN activity (Exterkate 1984) was modified in the sense that reactions were conducted at 30°C (instead of 37°C) and in 0·1 m Tris–HCl, pH 8·5 (instead of a 0·1 m sodium phosphate buffer). PepN activities were measured three times, using three independent cultures. Protein concentrations were determined using the Bio-Rad Protein Assay (Bio-Rad, Hercules, CA, USA) with bovine serum albumin as a standard. The crude protein extracts were analysed on 12% SDS polyacrylamide gels and the amounts of PepN were quantified as a percentage of the total intracellular protein content by scanning the gels with a densitometer (Gel Doc 1000; Bio-Rad).

Lactobacillus plantarum NC8 cells harbouring pGM4-gus were induced at an O.D.600 of ca 0·3 by addition of pheromone (IP-673) to a final concentration of 50 ng ml−1. β-Glucuronidase activities were determined using a modified β-galactosidase assay (Miller 1972) as described by Axelsson et al. (2003). GUS activities were calculated as described by Miller (Miller 1972) and expressed as Miller Unit equivalents (MU). The induction protocol used for GUS production differed slightly from the induction protocol used for PepN production; when applied to PepN production, the GUS protocol yielded similar results (Fig. 2, Table 3; G. Mathiesen, unpublished observations).

image

Figure 2. SDS-PAGE analysis of cell-free extracts from various Lactobacillus plantarum NC8 transformants. Lane 1, pMLS114; lane 2, pGM1; lane 3, pGM4 (induced); lane 4, pGM4 (noninduced); lane 5, molecular mass markers. Induction of cultures of L. plantarum NC8 (pGM4) (lane 3) was achieved by addition of pheromone (IP-673) to a final concentration of 25 ng ml−1. Addition of similar amounts of pheromone to cultures of L. plantarum harbouring pMLS114 or pGM1 had no visible effect on the outcome of the experiment. The arrows indicate PepN bands

Download figure to PowerPoint

Table 3.  PepN activity in recombinant Lactobacillus plantarum NC8 strains
PlasmidSpecific activity*Increase upon induction
No pheromonePheromone (25 ng ml−1)
  1. n.a., not applicable.

  2. *PepN activity is expressed as μmol p-nitroanilide min−1 mg−1 protein ± s.d. (n = 3).

  3. Lactobacillus plantarum NC8 (pGM1) did not require external pheromone for induction of PepN production and addition of pheromone did not affect the outcome of the experiment.

pMLS114<0·01<0·01n.a.
pGM1†2·7 ± 0·6n.a.n.a.
pGM40·16 ± 0·094·1 ± 0·425-fold

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Bacterial strains, plasmids and standard genetic techniques
  6. Plasmid construction
  7. Gene expression studies
  8. Results
  9. Discussion
  10. Acknowledgements
  11. References

In pMLS114-derived pGM1 (Fig. 1), the pheromone autoinduction loop is intact, meaning that PepN production does not require externally added pheromone. pGM4 (Fig. 1) is a pGM1 variant with a deletion in the pheromone gene (sppIP), meaning that cells harbouring pGM4 need externally added pheromone for activation of pepN expression. Table 3 shows that the highest PepN levels were reached in induced cultures of L. plantarum NC8 (pGM4). SDS-PAGE analysis of cell-free extracts from L. plantarum NC8 harbouring pGM1 or pGM4 (Fig. 2) shows the expected PepN band at ca 95 kDa. Scanning of SDS-PAGE gels containing cell-free extracts of induced L. plantarum NC8 (pGM4) harvested at an O.D.600 of 2·3–2·5 showed that PepN levels amounted to more than 40% of the total intracellular protein content. Noninduced cells of L. plantarum NC8 (pGM4) produced 25-fold less PepN than induced cells (Fig. 2, Table 3).

Figure 3 shows a clear dose–response relationship between the amount of PepN produced by L. plantarum NC8 (pGM4) and the amount of peptide pheromone added to the culture. PepN activity increased almost linearly with pheromone concentration in the 0·5–15 ng ml−1 range, and maximum PepN production was achieved at 25 ng ml−1. Maximum PepN levels were obtained in cultures grown at 30°C, whereas growing the cultures at 20, 25 or 37°C reduced PepN production by 80, 30 and 55%, respectively (results not shown). Induction reduced the growth rate L. plantarum NC8 (pGM4) but not of L. plantarum NC8 (pMLS114) used as a control. Thus, the growth rate reduction was due to the production of PepN and not to the presence of peptide pheromone (results not shown).

image

Figure 3. PepN activity in Lactobacillus plantarum NC8 harbouring pGM4. The plot shows specific PepN activity in cell-free extracts as function of the amount of pheromone added. The cells were harvested at an O.D.600 of ca 2·5. One unit (U) of PepN activity represents production of 1 μmol p-nitroanilide per minute. The error bars indicate the standard deviation (n = 3)

Download figure to PowerPoint

Similar studies conducted with pGM4-gus confirmed the usefulness of pMLS114-derived vectors for high level expression. Maximum GUS activity was in the range of 700 MU equivalents, which is four to five times higher than the levels recently obtained (Sørvig et al. 2003; see below for further discussion). GUS levels in noninduced cells were ca 80-fold lower than GUS levels in induced cells (results not shown).

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Bacterial strains, plasmids and standard genetic techniques
  6. Plasmid construction
  7. Gene expression studies
  8. Results
  9. Discussion
  10. Acknowledgements
  11. References

The development of pMLS114-based constructs for gene expression was initiated because previous studies had shown that Lactobacillus strains harbouring this plasmid yielded the highest levels of sakacin P that we have ever obtained in our laboratories (Aasen et al. 2000; I.M. Aasen and L. Axelsson, unpublished observations). The natural organization of the spp gene cluster and promoters in pMLS114 was expected to be important because previous studies of the NICE system had indicated that promoter activity depends in a subtle manner on the levels of all proteins involved in signal transduction, as well as on the ratios between them (Kleerebezem et al. 1997; Pavan et al. 2000). Thus, we attempted to create expression plasmids in which the natural spp gene cluster was largely intact.

Sørvig et al. (2003) have recently created a series of vectors that are more easy-to use than pMLS114, but which are much more ‘engineered’ in terms of promoters, terminators and gene organization. Using the sakacin P-based expression vector pSIP401 to express GUS in L. plantarum NC8, Sørvig et al. (2003) found GUS levels that were about one-fifth of the levels presented here, despite the fact that GUS was translationally fused to the same promoter as in pGM4-gus (note that pSIP401 and pMLS114 are based on the same L. plantarum replicon). Thus, it seems that the use of a pMLS114-like arrangement of genes and promoters indeed is favourable for expression. GUS levels obtained using the two-plasmid NICE system (Kleerebezem et al. 1997) in L. plantarum NC8 (Sørvig et al. 2003) were ca 10 times higher than the levels obtained with the pSIP401 derivative, that is ca two times higher than the levels reported here for pGM4-GUS. In all three cases considerable levels of background expression were observed. Pavan et al. (2000) have shown that a variant of the NICE system based on a L. plantarum host strain with the nisRK genes integrated into the chromosome yields higher expression levels and lower background activity. Similar improvements are conceivable for the sakacin P-derived systems described here.

The results obtained with PepN show that the pMLS114-derived expression vectors are suitable for heterologous expression at very high levels. To our knowledge, the highest PepN levels in lactobacilli reported so far amount to 28% of total cellular protein. These levels were obtained by expressing the pepN gene under the control of the constitutive L. brevis slpA (surface S-layer) promoter in L. plantarum (Kahala and Palva 1999). The level of ca 40% of total cellular protein described in the present study approaches the level of 47% reported for overexpression of pepN in its natural host, Lactococcus lactis, using the NICE system (de Ruyter et al. 1996).

While the pMLS114-derived expression vectors yield high levels of gene expression, they do have some drawbacks. One of these is the lack of versatility of the vector: every expression construct needs to be made by recombinant PCR, using specially designed primers. Another drawback concerns the rather high background expression which presumably precludes the use of this system for expression of genes that encode toxic proteins.

The data presented here show that regulated promoters and regulatory genes from the sakacin P system permit controlled overproduction of proteins in L. plantarum. As lactobacilli are food grade organisms and colonize the intestine, applications of Lactobacillus-based cell factories in food and for medical purposes are conceivable. We are currently in the process of further optimizing sakacin P-based and related expression systems, with focus on reduction of background expression and the construction of smaller, more versatile vectors that are equally effective as the pMLS114 derivatives described here.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Bacterial strains, plasmids and standard genetic techniques
  6. Plasmid construction
  7. Gene expression studies
  8. Results
  9. Discussion
  10. Acknowledgements
  11. References

This work was supported by a strategic grant from The Research Council of Norway (no. 134314/140). We thank Per Strøman and Eric Johansen at Chr Hansen A/S (Denmark) for providing us with plasmid pSTO10 and Kathrine Hühne and Lothar Kröckel at the Federal Institute for Meat Research (Germany) for supplying pMLS114.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Bacterial strains, plasmids and standard genetic techniques
  6. Plasmid construction
  7. Gene expression studies
  8. Results
  9. Discussion
  10. Acknowledgements
  11. References
  • Aasen, I.M., Møretrø, T., Katla, T., Axelsson, L. and Storro, I. (2000) Influence of complex nutrients, temperature and pH on bacteriocin production by Lactobacillus sakei CCUG 42687. Applied Microbiology and Biotechnology 53, 159166.
  • Aukrust, T. and Blom, H. (1992) Transformation of Lactobacillus strains used in meat and vegetable fermentations. Food Research International 25, 253261.
  • Aukrust, T.W., Brurberg, M.B. and Nes, I.F. (1995) Transformation of Lactobacillus by electroporation. Methods in Molecular Biology 47, 201208.
  • Axelsson, L. (1998) Lactic acid bacteria: classification and physiology. In Lactic Acid Bacteria: Microbiology and Functional Aspects, 2nd edn, Revised and Expanded. ed. Salminen, S. and vonWright, A. pp. 172. New York: Marcel Dekker, Inc.
  • Axelsson, L., Katla, T., Bjørnslett, M., Eijsink, V.G.H. and Holck, A. (1998) A system for heterologous expression of bacteriocins in Lactobacillus sake. FEMS Microbiology Letters 168, 137143.
  • Axelsson, L., Lindstad, G. and Naterstad, K. (2003) Development of an inducible gene expression system for Lactobacillus sakei. Letters in Applied Microbiology 37, 115120.
  • Brurberg, M.B., Nes, I.F. and Eijsink, V.G.H. (1997) Pheromone-induced production of antimicrobial peptides in Lactobacillus. Molecular Microbiology 26, 347360.
  • Eichenbaum, Z., Federle, M.J., Marra, D., DeVos, W.M., Kuipers, O.P., Kleerebezem, M. and Scott, J.R. (1998) Use of the lactococcal nisA promoter to regulate gene expression in Gram-positive bacteria: comparison of induction level and promoter strength. Applied and Environmental Microbiology 64, 27632769.
  • Eijsink, V.G.H., Axelsson, L., Diep, D.B., Håvarstein, L.S., Holo, H. and Nes, I.F. (2002) Production of class II bacteriocins by lactic acid bacteria; an example of biological warfare and communication. Antonie Van Leeuwenhoek 81, 639654.
  • Exterkate, F.A. (1984) Location of peptidases outside and inside the membrane of Streptoccus cremoris. Applied and Environmental Microbiology 47, 177183.
  • van de Guchte, M., Kok, J. and Venema, G. (1991) Distance-dependent translational coupling and interference in Lactococcus lactis. Molecular and General Genetics 227, 6571.
  • Higuchi, R. (1990) Recombinant PCR. In PCR Protocols A Guide to Methods and Applications ed. Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. pp. 177183. San Diego, CA: Academic Press Inc.
  • Hühne, K., Axelsson, L., Holck, A. and Krockel, L. (1996) Analysis of the sakacin P gene cluster from Lactobacillus sake Lb674 and its expression in sakacin-negative Lb. sake strains. Microbiology 142, 14371448.
  • Kahala, M. and Palva, A. (1999) The expression signals of the Lactobacillus brevis slpA gene direct efficient heterologous protein production in lactic acid bacteria. Applied Microbiology and Biotechnology 51, 7178.
  • Kleerebezem, M. and Quadri, L.E.N. (2001) Peptide pheromone-dependent regulation of antimicrobial peptide production in Gram-positive bacteria: a case of multicellular behavior. Peptides 22, 15791596.
  • Kleerebezem, M., Beerthuyzen, M.M., Vaughan, E.E., de Vos, W.M. and Kuipers, O.P. (1997) Controlled gene expression systems for lactic acid bacteria: transferable nisin-inducible expression cassettes for Lactococcus, Leuconostoc, and Lactobacillus spp. Applied and Environmental Microbiology 63, 45814584.
  • Kleerebezem, M., de Vos, W.M. and Kuipers, O.P. (1999) The lantibiotics nisin and subtilin act as extracellular regulators of their own biosynthesis. In Cell–cell Signaling in Bacteria ed. Dunny, G.M. and Winans, S.C. pp. 159174. Washington, DC: American Society for Microbiology.
  • Mercenier, A., Pavan, S. and Pot, B. (2003) Probiotics as biotherapeutic agents: Present knowledge and future prospects. Current Pharmaceutical Design 9, 175191.
  • Miller, K.M. (1972) Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
  • Nes, I.F. and Eijsink, V.G.H. (1999) Regulation of group II peptide bacteriocin synthesis by quorum-sensing mechanisms. In Cell-Cell Signaling in Bacteria ed. Dunny, G.M. and Winans, S.C. pp. 175192. Washington, DC: American Society for Microbiology.
  • Pavan, S., Hols, P., Delcour, J., Geoffroy, M.C., Grangette, C., Kleerebezem, M. and Mercenier, A. (2000) Adaptation of the nisin-controlled expression system in Lactobacillus plantarum: a tool to study in vivo biological effects. Applied and Environmental Microbiology 66, 44274432.
  • Quadri, L.E.N. (2002) Regulation of antimicrobial peptide production by autoinducer-mediated quorum sensing in lactic acid bacteria. Antonie Van Leeuwenhoek 82, 133145.
  • Risøen, P.A., Brurberg, M.B., Eijsink, V.G.H. and Nes, I.F. (2000) Functional analysis of promoters involved in quorum sensing-based regulation of bacteriocin production in Lactobacillus. Molecular Microbiology 37, 619628.
  • Ross, R.P., Morgan, S. and Hill, C. (2002) Preservation and fermentation: past, present and future. International Journal of Food Microbiology 79, 316.
  • de Ruyter, P.G., Kuipers, O.P. and de Vos, W.M. (1996) Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin. Applied and Environmental Microbiology 62, 36623667.
  • Sørvig, E., Grönqvist, S., Naterstad, K., Mathiesen, G., Eijsink, V.G.H. and Axelsson, L. (2003) Construction of vectors for inducible gene expression in Lactobacillus sakei and L. plantarum. FEMS Microbiology Letters 229, 119126.
  • Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
  • Schlaman, H.R.M., Risseeuw, E., Franke-van Dijk, M.E.I. and Hooykaas, P.J.J. (1994) Nucleotide sequence corrections of the uidA open reading frame encoding beta-glucuronidase. Gene 138, 259260.
  • Strøman, P. (1992) Sequence of a gene (Lap) encoding a 95·3-kDa aminopeptidase from Lactococcus-lactis ssp cremoris Wg2. Gene 113, 107112.