Assessment of the bacterial diversity of breast milk of healthy women by quantitative real-time PCR

Authors

  • M.C. Collado,

    1. Departamento de Nutrición, Bromatología y Tecnología de los Alimentos (NBTA), Universidad Complutense de Madrid (UCM), Madrid, Spain
    Search for more papers by this author
  • S. Delgado,

    1. Departamento de Nutrición, Bromatología y Tecnología de los Alimentos (NBTA), Universidad Complutense de Madrid (UCM), Madrid, Spain
    Search for more papers by this author
  • A. Maldonado,

    1. Departamento de Nutrición, Bromatología y Tecnología de los Alimentos (NBTA), Universidad Complutense de Madrid (UCM), Madrid, Spain
    Search for more papers by this author
  • J.M. Rodríguez

    1. Departamento de Nutrición, Bromatología y Tecnología de los Alimentos (NBTA), Universidad Complutense de Madrid (UCM), Madrid, Spain
    Search for more papers by this author

Juan M. Rodríguez, Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Universidad Complutense de Madrid, 28040 Madrid, Spain. E-mail: jmrodrig@vet.ucm.es

Abstract

Aims:  Breast milk has been described as a source of bacteria influencing the development of the infant gut microbiota. Up to the present, few studies have been focused on the application of culture-independent techniques to study bacterial diversity in breast milk. In this context, the aim of this study was to characterize the breast milk microbiota of healthy women by applying the quantitative real-time PCR technique (qRTi-PCR).

Methods and Results:  A total of 50 breast milk samples were analysed by qPCR to assess the presence of different bacterial genera or clusters, including the Bifidobacterium, Lactobacillus, Staphylococcus, Bacteroides, Enterococcus, Streptococcus, Clostridium cluster IV and Clostridium cluster XIVa–XIVb groups. Staphylococcus, Streptococcus, Bifidobacterium and Lactobacillus were the predominant groups and were detected in all the samples. Clostridium XIVa–XIVb and Enterococcus were detected in most of the samples in contrast to the Bacteroides and Clostridium cluster IV groups.

Conclusions:  Our results confirm the abundance of bacterial DNA in breast milk samples and suggest that the qRTi-PCR technique has a huge potential in the microbiological analysis of human milk.

Significance and Impact of the study:  qRTi-PCR allowed the detection of bacterial DNA of streptococci, staphylococci, lactic acid bacteria and bifidobacteria in the samples of human milk, which confirms that breast milk can be an important source of bacteria and bacterial DNA to the infant gut.

Introduction

In the last years, breast milk has been shown to be a continuous source of commensal, mutualistic and/or probiotic bacteria to the infant gut; including staphylococci, streptococci, bifidobacteria and lactic acid bacteria (Heikkilä and Saris 2003; Martín et al. 2003; Reviriego et al. 2005). These bacteria may also play an important role in the reduction of the incidence and severity of infections in the suckling infant. In fact, some of the lactic acid bacteria strains isolated from this biological fluid have the ability to inhibit the growth of a wide spectrum of pathogenic bacteria by competitive exclusion and/or through the production of antimicrobial compounds, such as bacteriocins, organic acids or hydrogen peroxide (Beasley and Saris 2004; Martín et al. 2005, 2006; Olivares et al. 2006; Fernández et al. 2008).

Up to the present, the descriptions of bacterial diversity in breast milk have been based almost exclusively on the use of culture media that are suitable for the growth of lactic acid bacteria, streptococci, staphylococci, and closely related Gram-positive bacteria. This implies that the presence of additional bacterial species that are not cultivable (or difficult to cultivate) may have been overlooked. The recent application of culture-independent molecular techniques, and particularly those based on 16S rRNA genes, has allowed a more complete assessment of the biodiversity of the human milk microbiota (Gueimonde et al. 2007; Martín et al. 2007a; Delgado et al. 2008) and has confirmed the strong influence of this biological fluid on the bacterial colonization of the neonatal gut (Martín et al. 2007b). However, the number of molecular microbiology studies focused on human milk is still low and their progressive incorporation will open new perspectives in this field.

Among the molecular techniques currently available, quantitative real-time PCR (qRTi-PCR) can provide an accurate and sensitive method for the specific detection of individual species or bacterial groups as well as total bacteria in complex bacterial ecosystems (Huijsdens et al. 2002; Malinen et al. 2003; Ott et al. 2004; Hopkins et al. 2005; Guo et al. 2008). For quantitative purposes, qRTi-PCR is more reliable than other methods such as single-strand conformation polymorphism analysis, temperature gradient gel electrophoresis and fluorescence in situ hybridization (Fang et al. 2002; Nadkarni et al. 2002; Stewart et al. 2006).

In this context, the main objective of this work is to contribute to an extended knowledge of the bacterial diversity of breast milk of healthy women by applying the qRTi-PCR technique to detect and quantify several relevant bacterial groups, including Clostridium leptum-Faecalibacterium prausnitzii subgroup (Clostridium genus cluster IV), Clostridium coccoides-Eubacterium rectale subgroup (Clostridium cluster XIVa and XIVb), Streptococcus, Staphylococcus, Enterococcus, Lactobacillus group (including also the genera Leuconostoc, Pediococcus, Aerococcus and Weissella), Bifidobacterium and Bacteroidetes group (including Prevotella and Porphyromonas).

Materials and methods

Study design

Samples of breast milk were collected from 50 mothers (M1 to M50) in sterile tubes by manual expression using sterile gloves. Previously, nipples were cleaned with soap and sterile water, and soaked in chlorhexidine (Cristalmina, Salvat, Barcelona, Spain). The first drops (approx. 250 μl) were discarded. The samples were kept at 4°C until delivery to the laboratory; then, they were stored at −80°C until further processing. All the mothers were healthy, had a full term pregnancy and breastfed their infants. All volunteers gave written informed consent to the protocol, which was approved by the Ethical Committee of Clinical Research of Hospital Clínico of Madrid (Spain).

Bacterial DNA isolation from the milk samples

Initially, a fraction of the breast milk samples (1 ml) were centrifuged at 7150 g for 20 min. Then, total DNA was isolated from the pellets using the QIAamp DNA Stool Mini Kit (QIAgen, Hilden, Germany) following a protocol described previously (Martín et al. 2007a). DNA was eluted in 20 μl of buffer AE (provided in the kit), and the purified DNA extracts were stored at −20°C.

qRTi-PCR assays

qRTi-PCR was used to characterize the bacterial DNA present in the breast milk samples. For this purpose, a series of genus-specific primer pairs were used (Table 1). All the primers had been previously described with the exception of the Streptococcus-specific primer pair (Tuf-Strep-1 and Tuf-Strep-R), which was designed on the basis of the variable regions of the tuf gene sequence of Streptococcus using the program Clone Manager Suite 7·0 (Sci Ed Central, Cary, NC, USA). The sequences of both primers were compared with those deposited in the EMBL database using the Blast algorithm. In addition, the specificity of this primer pair was tested in silico by PCR simulation against up-to-date sequenced prokaryotic genomes using the tools provided in the website http://insilico.ehu.es/PCR (Bikandi et al. 2004).

Table 1.   Oligonucleotide primers used in this study
Target bacterial group/species Sequence (5′–3′)Annealing temperature (°C)Reference
Bacteroides groupg-Bfra-F: ATAGCCTTTCGAAAGRAAGAT
g-Bfra-R: CCAGTATCAACTGCAATTTTA
50Matsuki et al. 2002
Bifidobacterium groupg-Bifid-F: CTCCTGGAAACGGGTGG
g-Bifid-R: GGTGTTCTTCCCGATATCTACA
50Matsuki et al. 2002
Clostridium cluster IVsg-Clept-F: GCACA GCAGTGGAG T
sg-Clept-R3: CTTCCTCCGTTTTGTCAA
50Matsuki et al. 2002
Clostridium cluster XIVa–XIVbg-Ccoc-F: AAATGACGGTACCTGACTAA
g-Ccoc-R: CTTTGAGTTTCATTCTTGCGAA
50Matsuki et al. 2002
Enterococcus groupEnt-R: ACTCGTTGTACTTCCCATTGT
Ent-F: CCTTATTGTTAGTTGCCATCATT
62Rinttiläet al. 2004
Lactobacillus groupLab 159: GGAAACAG(A/G)TGCTAATACCG
Lab 677: CACCGCTACACATGGAG
61Heilig et al. 2002
Staphylococcus groupTStaG422: GGCCGTGTTGAACGTGGTCAAATCA
TStag765: TIACCATTTCAGTACCTTCTGGTAA
58Martineau et al. 2001
Streptococcus groupTuf-Strep-1: GAAGAATTGCTTGAATTGGTTGAA
Tuf-Strep-R: GGACGGTAGTTGTTGAAGAATGG
62This study
Total bacteriaU968-f: AACGCGAAGAACCTTAC
L1401-r: CGGTGTGTACAAGACCC
58Muyzer et al. 1993

PCR amplification and detection were performed on optical-grade 96-well plates using an iQ5 Cycler Multicolor real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA). Each reaction mixture (25 μl) was composed of iQ™ SYBR® Green Supermix (Bio-Rad Laboratories), 1 μl of each of the specific primers at a concentration of 0·25 μmol l−1 and 1 μl of template DNA. The fluorescent products were detected at the last step of each cycle. A melting curve analysis was made after amplification to distinguish the targeted PCR product from the non-targeted PCR product. Standard curves were created using serial 10-fold dilutions of bacterial DNA extracted from pure cultures with a bacterial population ranging from 2 to 9 log10 colony forming units (CFUs), as determined by plate counts. One strain belonging to each of the bacterial genera or groups targeted in this study was used to construct the standard curve. More specifically, the strains from which the DNA was extracted were the following: Staphylococcus epidermidis CECT 231, Bifidobacterium longum CECT 4551, C. coccoides DSMZ 935, C. leptum DSMZ 753, Bacteroides fragilis DSMZ 2151, Streptococcus thermophilus CECT 986, Lactobacillus delbrueckii CECT 282, Lactobacillus salivarius CECT 2197, Enterococcus faecalis CECT 481. All of them were obtained from the Spanish Collection of Type Cultures (CECT) or the German Collection of Microorganisms and Cell Cultures (DSMZ).

The bacterial concentration in each sample was measured as log10 genome equivalents by the interpolation of the Ct values obtained by the milk samples into the standard calibration curves. For example, a value of 4 log10 genome equivalents for the group Staphylococcus means that the Ct value obtained in the assay was the same than that achieved by the DNA extract obtained from a culture containing 4 log10 CFU of Staph. epidermidis CECT 231. All the breast milk samples were analysed in two independent qRTi-PCR assays.

Results

Design of a Streptococcus genus-specific primer pair

A pair of Streptococcus-specific primers (Tuf-Strep-1 and Tuf-Strep-R), targeting the tuf gene, was developed. The PCR primers showed to be specific for the Streptococcus group at an annealing temperature of 62°C, with amplification of a product of the expected size (560 bp). Amplification was obtained from DNA of all the streptococcal strains used to evaluate primer specificity: Strep. thermophilus CECT 986, S. dysgalactiae DSM 20662, S. agalactiae DSM 2134, S. bovis DSM 20480, S. uberis DSM 20569, S. peroris DSM 12493, S. mitis DSM 12643, S. parasanguinis DSM 6778, S. pneumoniae DSM 20566, S. oralis CECT 907, S. salivarius CECT 805. In contrast, no amplification could be detected from DNA of Staph. epidermidis CECT 231, Bif. longum CECT 4551, C. coccoides DSMZ 935, C. leptum DSMZ 753, Bact. fragilis DSMZ 2151, L. delbrueckii CECT 282, L. salivarius CECT 2197 and E. faecalis CECT 481.

qRTi-PCR analysis

To determine the detection limit of the PCR assay, a standard curve was made from serial dilutions of DNA isolated from pure cultures of the different reference strains. A linear relationship was observed between the cell number and Ct values (r2 = 0·99) when the DNA was isolated from cultures containing between 2 and 9 log10 CFU ml−1.

The bacterial genera detected in the breast milk samples are shown in Table 2. DNA from the Staphylococcus, Streptococcus, Bifidobacterium and Lactobacillus groups could be detected in all the samples (Table 2). The mean reached by the Streptococcus group was the highest (4·50 log genome equivalents ml−1) while those of the Staphylococcus, Bifidobacterium and Lactobacillus groups were similar (3·55–3·74 log genome equivalents ml−1). Clostridium cluster XIVa–XIVb was detected in most of the samples (48 out of 50, 96%) but, in contrast, Clostridium cluster IV was only detected in two of the samples (Table 2). DNA from the Enterococcus and Bacteroides groups was detected in 38 and 20 samples from a total of 50 samples (76% and 40% respectively).

Table 2.   Detection of bacterial DNA in the breast milk samples by quantitative real-time PCR technique (qRTi-PCR). Data are presented as log10 (genome equivalent ml−1)
Bacterial groupsPrevalenceRangeMean ± SD
Total bacteria50/505·05–7·766·03 ± 0·75
Staphylococcus group50/501·30–5·563·55 ± 0·84
Bifidobacterium group50/502·45–4·753·56 ± 0·53
Lactobacillus group50/502·61–4·503·74 ± 0·47
Enterococcus group38/501·20–4·852·56 ± 0·71
Streptococcus group50/502·91–6·114·50 ± 0·81
Bacteroides group20/501·50–3·352·02 ± 0·55
Clostridium cluster XIVa–XIVb48/502·27–4·853·32 ± 0·60
Clostridium cluster IV2/501·07–2·121·60 ± 0·17

Discussion

Traditionally, the description of the bacterial composition of human mucosal epitheliums and/or the biological materials in contact with them were based on culture techniques which are laborious, time-consuming, and may underestimate the bacterial diversity of these ecosystems. The use of molecular methods that rely on culture-independent approaches allows a complementary perception of the bacterial diversity in an ecosystem.

In the last years, most of the studies focused on the bacterial composition of breast milk from healthy women were restricted to the use of a few selective media suited for the isolation of a narrow spectrum of Gram-positive bacteria, such as staphylococci, streptococci or lactic acid bacteria (Heikkilä and Saris 2003; Martín et al. 2003). Therefore, the results of such studies cannot be considered illustrative for the total bacterial diversity existing in breast milk as the presence of other bacteria (i.e. uncultivable bacteria) may have been overlooked. Recently, the application of a molecular technique (PCR-DGGE) to breast milk samples showed that the bacterial pattern in this biological fluid is heterogeneous, host-specific and exert a notable effect on the bacterial colonization of the neonatal gut (Martín et al. 2007a,b). In this context, the aim of this work was the application of qRTi-PCR as an alternative molecular technique to describe the bacterial diversity within human milk. To our knowledge, this study represents the first application of this technique to assess a variety of bacterial groups in breast milk from healthy women.

The qRTi-PCR assays allowed the detection of bacterial DNA of streptococci, staphylococci, lactic acid bacteria and bifidobacteria in all the samples, which reinforces the finding that breast milk can be an important source of bacteria to the infant gut. In fact, streptococci, staphylococci and lactic acid bacteria are frequently isolated from breast milk (Heikkilä and Saris 2003; Martín et al. 2003) and colostrum (Jiménez et al. 2008a), and their DNA has also been detected by PCR-DGGE (Martín et al. 2007a,b). In addition, the presence of bifidobacterial DNA seems to be a common event in breast milk (Gueimonde et al. 2007; Perez et al. 2007). The probiotic potential of lactic acid bacteria and bifidobacteria is well known, including that of strains isolated from breast milk (Martín et al. 2005; Jiménez et al. 2008b); similarly, commensal staphylococci and streptococci can be useful to reduce the acquisition of undesired pathogens by infants exposed to hospital environments (Uehara et al. 2001). Finally, presence of streptococci is a typical feature of the healthy infant gut (Jiménez et al. 2008c) while they are rare or absent in the atopic infant gut (Kirjavainen et al. 2001). The predominant bacterial groups in human milk, as assessed by qRTi-PCR, are among the first colonizers of the infant gut and their presence seems to be closely related to breastfeeding (Jiménez et al. 2008c). Interestingly, the abundance of other bacteria, such as those belonging to the Clostridium cluster IV or Bacteroides groups, which were only detected in 2 and 20 samples, respectively, is a typical feature of the post-weaning period.

In our approach, the bacterial suspensions used for the construction of the standard calibration curves were pure cultures because of the difficulties to obtain natural samples suitable for the construction of standard curves; however, the technique was applied to analyse human milk samples which contain more potential PCR inhibitors (Rossen et al.1992; Bickley et al. 1996). It could produce a potential bias, such as an underestimation of the bacterial load in the biological samples. Nevertheless, that effect would be the same for the different genera evaluated and, therefore, that bias could be considered equal in the different samples.

We are aware that our qRTi-PCR approach has some limitations as, for example, it is very difficult to estimate which part of the values obtained in the qRTi-PCR assays belongs to free bacterial DNA or to viable bacteria. In addition, bacterial quantification by qRTi-PCR is strongly influenced by different factors, including the copy number of the target gene (which may vary depending on the species and even on the strain), sequence heterogeneity, differential amplification and/or differential DNA extraction from a biological sample. However, the application of this technique in complex bacterial ecosystems is increasing rapidly and this fact may help to overcome present limitations. In conclusion, qRTi-PCR allowed the detection of bacterial DNA of streptococci, staphylococci, lactic acid bacteria and bifidobacteria in samples of human milk, which confirms that this biological fluid can be an important source of bacteria and bacterial DNA to the infant gut.

Acknowledgements

This study was funded by grants AGL2007-62042 and CSD2007-00063 (Fun-C-Food; Consolider Ingenio 2010) from the Ministry of Education and Science (Spain). M.C. Collado and S. Delgado are the recipients of post-doctoral fellowships from the Ministry of Education and Science (Spain).

Ancillary