Isolation of clinically relevant fungal species from solid waste and environment of dental health services

Authors


Luiz de Macêdo Farias, Anaerobe and Oral Microbiology Laboratory, Departamento de Microbiologia – ICB/UFMG, Universidade Federal de MInas Gerais, Avenida Antônio Carlos, 6627 – Campus Pampulha, 31.270-901 Belo Horizonte, Minas Gerais – Brazil. E-mail: macedo@icb.ufmg.br

Abstract

Aims:  This study was undertaken to detect, identify and determine antifungal susceptibility of yeast strains isolated from dental solid waste and to evaluate airborne fungi in the Brazilian dental health care environment and in the waste storage room.

Methods and Results:  A group of 17 yeast strains were identified by macroscopic and microscopic characteristics, API 20C Aux system and Multiplex PCR. All 104 airborne fungal colonies were identified by macroscopic and microscopic morphology. The CLSI broth microdilution method was utilized as the susceptibility test. Candida parapsilosis was the prevailing yeast species recovered from waste, followed by Rhodotorula glutinis. Three strains of Candida guilliermondii presented minimal inhibitory concentration values considered to be susceptible dose dependent (2 μg ml−1) to voriconazole. Of all airborne fungal species, 69% were recovered from the waste storage room and 31% were recovered from the clinical/surgical environment. Most of them were identified as Cladosporium spp.

Conclusions:  These findings reinforce the potential risk of waste handling and point out the need for safe management to minimize the spread of these agents to the environment. Filamentous fungi isolation in almost all sampled environments indicates that a periodic monitoring of airborne microbiota in the dental health care service environment is required.

Significance and Impact of the Study:  The survival of yeast strains for 48 h suggests that dental waste should be carefully controlled and monitored.

Introduction

Despite the enormous volumes of waste produced by health care systems and the increasing concern among scientists, waste generation has received little attention in clinical literature. Information regarding the biological content of waste in the health care environment could demonstrate the relationship between micro-organisms and harm to the environment and human health (Sherman 2007). The isolation of fungal species in health care solid waste is rarely mentioned in the literature. Jang et al. (2005) described an outbreak of candiduria arising from the improper disposal of infectious waste, detected by molecular techniques. According to Carrasco et al. (2005), yeasts can cause several human diseases ranging from localized mild infections to deep-seated candidiasis. Research that considers fungal isolation from solid waste in the dental health service environment is quite rare. Owing to the importance of the research in this area and the general paucity of data in literature, in this paper, prevalence, identification and antifungal susceptibility of yeast strains recovered from dental health service solid waste were evaluated. Airborne fungi from the dental health care environment and waste storage room were also investigated within the study period.

Materials and methods

Collecting and processing dental solid waste

Two schools of dentistry (one public and one private) and one public dental health service from Belo Horizonte, Brazil, were selected. Altogether six samples of dental solid waste, produced in 1 day of dental work (medium of 52·53 kg), were collected, two from each dental health service. Waste collection took place from March to November 2007. The average temperature during this period was 23·44°C, and the relative humidity was 67·55% (CDTN, 2010). The amount of waste generated was transferred to the waste storage room, where it was manually separated into subfractions (Vieira et al. 2009). The waste category included infectious and potentially infectious materials that have come in contact with blood and other potentially infectious oral fluids. This waste subfraction was divided into three samples and deposited in an experimental sterilized apparatus (container) specifically developed for this study. The portions that were deposited into three containers were evaluated at zero, 24 and 48 h. In an attempt to maintain the humidity and wash the waste sample, a physiological saline solution containing 5·61 g NaCl (Vetec Química Fina Ltda, Rio de Janeiro, Brazil), 1·0 g KH2PO4 (Reagen Produtos Para Laboratórios Ltda, Paraná, Brazil), 2·0 g Na2HPO4 (Reagen), 0·11 g KCl (Reagen), 0·25 g l-Cistein (InLab®, Sâo Paulo, Brazil), 0·5 g l−1 sodium thioglycolate (Vetec), 5·0 ml of surfactant polyoxyethylene monooleate (Tween 80; Tennant Química S/A®, São Paulo, Brazil) per 1 l distilled water and pH adjusted to 7·0–7·2 was added. Using this composition, we intend to preserve the viability of the various micro-organisms present in the sample. After 1- h contact, the solution was collected from the bottom of the experimental unit in a sterile bottle. The leached liquid was transported to laboratory within 30 min to perform the microbiological analysis.

Microbiological analysis

Each sample of leached liquid collected at zero, 24 and 48 h was individually shaken, and then serial tenfold dilutions were prepared in physiological saline. Aliquots of 0·1 ml were streak plated on Sabouraud dextrose agar (SDA) (Difco™), malt extract agar (Difco™) and CHROMagar™ Candida (Difco). Plates were incubated at 28°C for 24–168 h. Morphologically different colonies from all media were isolated as pure cultures for later identification. Yeast identification was performed using the conventional identification method, API 20C Aux system (Biomerieux SA, São Paulo, Brazil) and Multiplex PCR. Candida albicans ATCC 18.804 was included as the control organism in all experiments.

Conventional Identification Method.  Yeasts were identified by observation of their macroscopic and microscopic morphology (Gündes et al. 2001) and pigment production on CHROMagar™ Candida.

API 20C Aux system.  Isolates were picked up with a sterile disposable loop from the 24- to 48-h SDA plates and were added to the API medium to constitute a suspension standardized according to the 2 MacFarland standard. Suspensions were used to fill the 20 cupules containing dehydrated reagents. After incubation at 30 ± 2°C, the growth in each well was recorded for 24–72 h. A profile number based upon the reactions was generated for each sample. Identification was performed using the Analytical Profile Index (Gündes et al. 2001; Silva and Candido 2005).

Multiplex PCR.  The identification of Candida species was confirmed by a multiplex PCR-based method as described by Carvalho et al. (2007). This method is able to specifically identify eight clinically relevant Candida species based on the amplification of particular DNA fragments of the internal transcribed spacer regions 1-ITS1 and 2-ITS2. It combines two yeast-specific universal primers and eight Candida species-specific primers in a single PCR yielding two amplicons of different sizes for each species (Table 1). The PCR was performed with a PCR thermal cycler (MJ Research, PTC-100, MA, USA) according to the following programme sequence: 95°C for 4 min, followed by 40 cycles consisting of 94°C for 1 min, 64°C for 2·5 min and 72°C for 2·5 min, with a final 10 min extension at 72°C. After the thermal cycling, the amplified product was run in a 2% agarose gel, stained with ethidium bromide and visualized with UV light (Abliz et al. 2003). Rhodotorula glutinis species were used as outgroup.

Table 1.   Universal and species-specific primers used in Candida species amplification and size of fragments visualized under agarose gel electrophoresis*
SpeciesPrimer nameSequence (5′–3′)
  1. *Adapted from Carvalho et al. (2007).

Universal primer1UNI1GTCAAACTTGGTCATTTA
Universal primer2UNI2TTCTTTTCCTCCGCTTATTG
Candida albicansCalbAGCTGCCGCCAGAGGTCTAA
Candida glabrataCglaTTGTCTGAGCTCGGAGAGAG
Candida kruseiCkruCTGGCCGAGCGAACTAGACT
Candida tropicalisCtroGATTTGCTTAATTGCCCCAC
Candida parapsilosisCparGTCAACCGATTATTTAATAG
Candida guilliermondiiCguiTTGGCCTAGAGATAGGTTGG
Candida lusitaniaeClusTTCGGAGCAACGCCTAACCG
Candida dubliniensisCdubCTCAAACCCCTAGGGTTTGG

Airborne fungi

Along with waste collection, the characteristics of airborne fungal populations were also examined. On each of the six occasions, air samples were taken. A total of 12 samples were collected, including six from a clinical or surgical environment of the surveyed institution and six from the external waste storage room. Microbial air samples were collected in the morning at 06:30 inside waste storage rooms and at 09:00 inside clinical/surgical rooms. SDA plates were placed at positions 1·3 m from the floor and were exposed for 10 min by trained personnel. Excluding the fourth and fifth samples that were collected inside a surgical room, all others occurred inside the dental clinics during patient’s daily care. In addition, microbial air samples were collected within external waste storage room before the beginning of the workday. A depositional sampling technique, which relies on the settling of airborne micro-organisms onto agar-filled Petri dishes for a given period of time (Buttner and Stetzenbach 1993; Pasquarella et al. 2000; Bernardo et al. 2005), was adopted for this study. According to Pasquarella et al. (2000), this technique is reliable and results successfully reproduce the circumstances of infection by dust particles sedimenting into the wound or on instruments. According to Buttner and Stetzenbach (1993), depositional sampling is a low cost alternative to forced-air-flow sampling methods, but micro-organisms deposited on plate surface may not be representative of all viable cells and fungal spores in the air. Exposed plates were incubated at 28°C, for 1–7 days. All discernible fungal colonies on each plate were identified by the microcultivation method and low power microscopy (generally, to genus). Lactophenol cotton blue on slide was used as the method of staining and observing fungi (ANVISA, 2004).

Susceptibility assays

The yeast samples recovered from solid waste were submitted to antifungal susceptibility testing that was performed according to the Clinical and Laboratory Standards Institute – CLSI – Broth Microdilution reference method M27-A2 (CLSI 2002). Fluconazole, itraconazole, voriconazole, caspofungin and amphotericin B were obtained as reagent grade powders from their respective manufacturers. The final concentration of tested antifungals was 0·125–64·0 μg ml−1 for fluconazole, 0·03–8·0 μg ml−1 for itraconazole, 0·015–4·0 μg ml−1 for voriconazole, 0·015–4·0 μg ml−1 for caspofungin and 0·03–8·0 μg ml−1 for amphotericin B. Minimal inhibitory concentration (MIC) was read as the lowest antifungal concentration with substantially lower turbidity (decrease of 80% in turbidity) compared to the growth of the antifungal-free growth control well for all agents except for amphotericin B and caspofungin. For those drugs, MIC results were read as the minimal antifungal concentration with complete inhibition of growth (NCCLS/CLSI, 2002; Richter et al. 2005). Candida albicans ATCC 18.804 was also included as the control organism.

Statistical analysis

The data obtained in this investigation were subjected to statistical analysis using a confidence interval (CI), according to the p ± 1·96 √(p (1 − p)/n) formula (Sampaio 2007).

Results

Yeasts isolated from dental waste

In total, 17 samples of yeasts were isolated. Candida parapsilosis (8 strains) was the most frequent species recovered, followed by R. glutinis (4), Candida guilliermondii (3) and Candida famata (2) (Table 2). It was possible to recover yeast viable strains after 48 h of the study. The susceptibility test was performed for 11 of the 17 yeasts isolated and revealed that most MIC values for antifungals tested are in accordance with breakpoints established by NCCLS/CLSI (2002) (Table 3). Three species of C. guilliermondii presented MIC values considered to be susceptible dose dependent (2 μg ml−1) to voriconazole (Paredes 2009). Despite all efforts, it was not possible to test R. glutinis and C. famata samples. The PCR multiplex–obtained results are demonstrated in Fig. 1.

Table 2.   Yeast strains isolated from solid waste in dental health care services, in Belo Horizonte, Brazil
Date of isolationInstitutionYeast speciesNumber of samples
  1. A – Dental Public Health Service; B – Public School of Dentistry; C – Private School of Dentistry.

Mar/2007ACandida guilliermondii02
Apr/2007BC. guilliermondii01
May/2007CCandida parapsilosis07
Aug/2007CRhodotorula glutinis04
Aug/2007CCandida famata02
Aug/2007CC. parapsilosis01
Table 3.   Antifungal susceptibility of 11 yeast strains isolated from solid waste in dental health care services, in Belo Horizonte, Brazil
InstitutionSpeciesMinimal inhibitory concentration (μg ml−1)
FluconazoleItraconazoleVoriconazoleCaspofunginAmphotericin B
  1. A – Dental Public Health Service; B – Public School of Dentistry; C – Private School of Dentistry.

ACandida guilliermondii4·00·1252·0>4·00·5
AC. guilliermondii4·00·1252·0>4·00·25
BC. guilliermondii4·00·1252·0>4·00·25
CCandida parapsilosis0·50·030·251·00·25
CC. parapsilosis0·50·1250·252·00·5
CC. parapsilosis0·50·060·252·00·5
CC. parapsilosis0·50·030·252·00·5
CC. parapsilosis0·50·030·252·01·0
CC. parapsilosis0·50·030·252·00·5
CC. parapsilosis0·50·0150·252·00·25
Figure 1.

 Agarose gel showing the results for multiplex PCR of Candida species isolated from solid waste in dental health care services, in Belo Horizonte, Brazil. (a) Lanes: 01–07 and 14 –Candida parapsilosis; 08–11 –Rhodotorula glutinis (outgroup); 12 and 13 –Candida famata; 15 – negative control; 16 – molecular weight standard (100 base pair ladder – Invitrogen®, São Paulo, Brazil). (b) Lanes: 16 – molecular weight standard (100 base pair ladder – Invitrogen®); 17–19 –Candida guilliermondii.

Airborne fungi

A total of 104 fungal strains were recovered, 72 (69%) being from the waste storage room and 32 (31%) from the clinical/surgical environment. In an attempt to compare the percentage of isolated fungi, the confidence interval (CI) formula was applied. The CI69% values range from 42 and 98% and CI31% from 21 to 39%. The margin of error for this study was 5%. A statistically significant difference was observed between the frequencies obtained for the clinical/surgical environment and the waste storage room. Most of the isolates obtained from air samples were identified as Cladosporium spp. (63 strains), Mycelia sterilia (11), Penicillium spp. (7), Rhodotorula sp. (4), Aspergillus níger (3), Fusarium sp., Fusarium solani, Torula sp., Charalopsis sp., Curvularia sp. (two strains each) and Cunninghannella sp. Basipetospora sp., Scopulariopsis sp., Aureobasidium sp., Scytalidium sp. and Alternaria sp. (one each). Cladosporium spp. corresponded to 43·7% of the samples recovered from the clinical/surgical environment and 68·0% from the waste storage room.

Discussion

Research on prevalence and risk factors associated with the microbial content of dental solid waste are scarce. Therefore, this makes it difficult to establish a comprehensive discussion and results comparison. The (few) published studies regarding waste microbial content tested hospital or medical services. In this study, potentially infectious dental solid waste was evaluated and viable yeast strains were recovered, even after 48 h of storage. Candida parapsilosis was the most frequently isolated species. This species is an exogenous pathogen that may be found on skin rather than on mucosal surfaces (Pfaller and Diekema 2007). This species has been found to be responsible for a broad variety of clinical manifestations generally in individuals with impaired immune systems (Ahmed et al. 2005; Lasker et al. 2006; Pfaller and Diekema 2007). There are no published data on C. parapsilosis survival in waste; despite this, according to Kramer et al. (2006), the species can survive on surfaces for 14 days or more when in the presence of serum or albumin, at low temperature and high humidity. Thus, safe and appropriate waste management is essential to attempt minimizing the spread of these agents inside the health care environment. All but voriconazole antifungal demonstrated an excellent in vitro activity against the yeast strains. Three species of C. guilliermondii presented MIC values considered as susceptible dose dependent (2 μg ml−1) to this drug. In a study performed by Pfaller et al. (2006), samples collected from 127 medical centres in Asia, Latin America, Europe, the Middle East and North America showed C. guilliermondii only as the most common species in the Latin America region. According to authors, it is a curious and not readily explained fact. This study showed that C. guilliermondii appears to exhibit decreased susceptibility to fluconazole in all geographical regions, and in Latin America, 4·0% of the strains were considered as susceptible dose dependent. Girmenia et al. (2006) evaluated C. guilliermondii fungemia in patients with haematological malignancies and found that 95% of the strains were susceptible to voriconazole. Our findings suggest a different pattern of susceptibility than the agent tested in strains recovered from dental solid waste. All tested antifungals exhibit MIC values below CLSI breakpoints against all C. parapsilosis strains. Data concerning R. glutinis and C. famata were omitted, as they were not reproducible. Some authors attest that infections caused by these two species are uncommon. MIC results are neither shown nor discussed (Zaas et al. 2003; Ahmed et al. 2005; González et al. 2008). Given their apparent clinical irrelevance, it seems that these species are of a minor concern. However, as data are missing in the literature, we believe these species should be more carefully investigated, specifically regarding the immunocompromised persons. Fungi that form spores are known human aeroallergens, and bioaerosol levels containing filamentous fungi may be 2–4 times higher in sanitary landfills, according to The World Health Organization (2004). This study showed that a statistically significant, higher number of filamentous fungi could be recovered from the waste storage room. Waste manipulation can generate small particles from 1 to 3 μm in diameter that contain infectious agent (WHO, 2004). All waste storage rooms evaluated were small, low ventilated and favour particle accumulation. It is interesting to note that these rooms are less frequently cleaned and disinfected than the Clinical/surgical environment. Our findings advise that all personnel involved in waste collection should protect the mucous membranes of the eyes and nose and wear all protective clothing and equipment. Cladosporium was the predominant genus recovered from the air in clinical/surgical and waste storage room environments. The results are in accordance with the literature (Pini et al. 2004; Martins-Diniz et al. 2005; Grinn-Gofrón and Rapiejko 2009). In a Brazilian hospital, inside an Intensive Care Unit (ICU) and the surgical room, Martins-Diniz et al. (2005) found Cladosporium as the most frequent genus. Inside ICU, more than 60% of the total recovered strains were Cladosporium spp. Another study performed in a haematology centre, in Florence, Italy, found Cladosporium as the most frequent genus (57%). These fungi are widely distributed in the air, and some of the species are most widely found in the tropics and subtropics. Cladosporium spp. can cause cerebral phaeohyphomycosis, cutaneous infections, onychomycosis, sinusitis, pulmonary infections and allergic infections (Tasic and Tasic 2007). As spores of these fungi are frequent air contaminants, as confirmed by this study, it is necessary to take all precautions to prevent contamination of air, surfaces, immunosuppressed patients and even the staff. Grinn-Gofrón and Rapiejko (2009) suggested that the increase in Cladosporium spp. spore concentration occurs with temperature increase throughout the season. They generally exhibit the highest concentration in atmospheres with conditions of low humidity (Lee et al. 2006). Other studies encountered Aspergillus spp. as the most frequent genus (Leenders et al. 1999; Augustowska and Dutkiewicz 2006). Differences among the published data may be expected because of differences in geographical location, climate characteristics, season of the year, presence of accumulated dust, carbon dioxide concentration, presence of air conditioning system and other conditions. This study demonstrated that the characteristics of dental health care service airborne fungi are similar to those from other health care services.

In conclusion:

  • 1 The microbiological analysis indicates that yeasts remain viable inside dental solid waste for up to 48 h. However, in regard to this finding, further studies are needed to establish the relationship between health risk level and dental solid waste.
  • 2 Despite the lack of data in the literature concerning airborne fungi in dental health services, our results suggest that these environments are ecologically similar to other health care environments. This makes them potentially critical regarding cross-infection control.
  • 3 Airborne fungi measured inside clinical/surgical environment indicate that storage rooms may provide very favourable conditions for survival/dispersion of airborne fungal spores.
  • 4 Filamentous fungi isolation in almost all evaluated environments indicates the importance of periodic monitoring of the air in dental health care service environments to guide preventive measures.
  • 5 Considering the biological risk, all health care institutions should establish a safety programme for dental health care workers in the attempt to prevent accidents.

Acknowledgements

The authors thank Renata Maria da Fonseca Gomes, Rute Denise Miranda, Luzia Rosa Rezende and José Sérgio Barros de Souza for technical assistance. This work was supported by the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) and Pró-Reitoria de Pesquisa da Universidade Federal de Minas Gerais (PRPq/UFMG).

Ancillary