SEARCH

SEARCH BY CITATION

Keywords:

  • aging;
  • AMP kinase;
  • C. elegans;
  • FOXO;
  • insulin receptor

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgments
  7. References

Molecular genetics in lower organisms has allowed the elucidation of pathways that modulate the aging process. In certain instances, evolutionarily conserved genes and pathways have been shown to regulate lifespan in mammals as well. Many gene products known to affect lifespan are intimately involved in the control of energy metabolism, including the fuel sensor AMP-activated protein kinase (AMPK). We have shown previously that over-expression of an AMPK α subunit in Caenorhabditis elegans, designated aak-2, increases lifespan. Here we show the interaction of aak-2 with other pathways known to control aging in worms. Lifespan extension caused by daf-2/insulin-like signaling mutations was highly dependent on aak-2, as was the lifespan extension caused by over-expression of the deacetylase, sir-2.1. Similarly, there was partial requirement for aak-2 in lifespan extension by mitochondrial mutations (isp-1 and clk-1). Conversely, aak-2 was not required for lifespan extension in mutants lacking germline stem cells (glp-1) or mutants of the eating response (eat-2). These results show that aging is controlled by overlapping but distinct pathways and that AMPK/aak-2 represents a node in a network of evolutionarily conserved biochemical pathways that control aging.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgments
  7. References

‘He not busy being born is busy dying.’– Bob Dylan

‘Of all the self-fulfilling prophecies in our culture, the assumption that aging means decline and poor health is probably the deadliest.’– Marilyn Ferguson

Aging and death were long believed to represent an inexorable process of decay. A more optimistic view of aging is supported by recent findings that lifespan can be extended in a variety of organisms and, importantly, long-lived mutants experience an extended period of vitality rather than a longer decline. We now know that aging is subject to genetic and metabolic control, in that manipulations that extend lifespan and vitality of an organism can be considered to regulate aging. Specifically, it is well established that lifespan can be extended by limiting caloric intake or by altering the activity of single genes within defined pathways related to the control of metabolism (Curtis et al., 2005; Katic & Kahn, 2005).

The evolution of our understanding of aging is very reminiscent of the changing views on cell death in the last 15–20 years. It was initially thought that cells died passively by failing to thrive; however, it was discovered that the loss of cells during development or disease requires a well-orchestrated biochemical process (apoptosis). Apoptotic genes were initially discovered by genetic studies in invertebrates, as well as the positional cloning of Bcl-2 in humans (Bouchier-Hayes & Martin, 2002; Danial & Korsmeyer, 2004). It was quickly realized that these genes assembled into discrete pathways regulating cell death and that these pathways are sometimes convergent. No single pathway or gene completely controls apoptosis, in that cell death can proceed even if one pathway is blocked (Green, 2005). For instance, both the intrinsic and extrinsic pathways require activation of the apoptosome, but apoptosome-independent pathways also exist (Danial & Korsmeyer, 2004).

A similar story is unfolding regarding the biochemistry and genetics of aging where many evolutionarily conserved cellular pathways can function to alter lifespan (Curtis et al., 2005; Kenyon, 2005). At the organismal level, lifespan can be extended by a regimen of calorie restriction in which macronutrient sources of protein, carbohydrate and lipid are limited while maintaining micronutrients. In animals that have been calorie restricted, there is slowed physical aging and increased resistance to disease (Longo & Finch, 2003; Bordone & Guarente, 2005). Several genes that modulate aging and disease resistance have been identified and these assemble into biochemical pathways. Notably, pathways regulating lifespan also play central roles in energy homeostasis (Curtis et al., 2005). The insulin pathway influences aging in response to carbohydrate and fat metabolism (Bluher et al., 2003; Kenyon, 2005) while the Sir2 pathway senses the cellular redox state via NAD+-dependent deacetylation (Hekimi & Guarente, 2003; Blander & Guarente, 2004). There is also mitochondrial control of lifespan: many mutations that affect the function of this organelle result in lower energy levels and lifespan extension (Dillin et al., 2002b; Hekimi & Guarente, 2003; Lee et al., 2003b). In addition, the nematode worm Caenorhabditis elegans can adjust lifespan in response to physiological inputs, such as sensory signals from olfactory and gustatory neurons (Apfeld & Kenyon, 1999; Alcedo & Kenyon, 2004) and signals reflecting the number of germline stem cells (Hsin & Kenyon, 1999; Arantes-Oliveira et al., 2002).

It is now becoming apparent that these overlapping but distinct pathways assemble into a network, with key genes acting as nodes. In C. elegans for instance, the transcription factor DAF-16 is required for regulation of lifespan by insulin/insulin-like growth factor-1 (IGF-1) signaling, known as the DAF-2 pathway (Kenyon et al., 1993; Lin et al., 1997; Ogg et al., 1997). DAF-16 is also required for Sir-2.1-mediated lifespan extension (Tissenbaum & Guarente, 2001) but not for that mediated by mitochondrial mutations or by calorie restriction (Lakowski & Hekimi, 1998). Lifespan reflects the integration of multiple inputs with overlapping regulatory mechanisms and therefore no single gene or pathway completely controls the aging process.

We have previously reported findings in C. elegans that the AMPK α-subunit aak-2 is a key gene that functions to extend lifespan (Apfeld et al., 2004). The AAK-2 protein is activated by increases in the AMP:ATP ratio caused by environmental stressors or normal aging in the worm and therefore links cellular energy availability to aging. Increased gene dosage of aak-2 extends lifespan and, importantly, aak-2 activity contributes to lifespan extension by insulin/IGF-1 signals. AMPK belongs to a conserved family of eukaryotic protein kinases that functions to restore cellular energy levels (energy charge) by increasing the synthesis of ATP in response to ATP depletion and consequent AMP accumulation. AMPK is a heterotrimeric complex composed of a catalytic α-subunit with regulatory β- and γ-subunits. AMPK is activated by AMP through an allosteric mechanism (Hardie, 2004; Kahn et al., 2005) and also by phosphorylation of the α-subunit by the kinases LKB1 and CaMKKβ (Hawley et al., 2003; Birnbaum, 2005). Activated AMPK phosphorylates key metabolic enzymes to either promote catabolism (glycolysis and fatty acid oxidation) or inhibit synthetic pathways for fatty acids, triglycerides, cholesterol and protein (Hardie, 2004; Kahn et al., 2005). AMPK also plays an important role in whole-body energy homeostasis in vivo via several mechanisms. First, control of fatty acid oxidation (via acetyl CoA carboxylase) regulates fat metabolism, obesity and insulin resistance (Kahn et al., 2005). Second, the fat tissue-derived hormones leptin and adiponectin activate AMPK in skeletal muscle (via increased AMP levels and LKB1-mediated phosphorylation) to stimulate glucose uptake and fatty acid oxidation (Minokoshi et al., 2002; Yamauchi et al., 2002). Third, AMPK is involved in hypothalamic feeding circuits that integrate signals from receptors for ghrelin, leptin and endocannabinoids. Direct pharmacological activation of hypothalamic AMPK by 5-aminoimidazole-4-carboxamide riboside (AICAR) promotes feeding (Andersson et al., 2004). Accordingly, hypothalamic AMPK is activated by ghrelin and cannabinoids (Andersson et al., 2004; Minokoshi et al., 2004; Kola et al., 2005), which are known to stimulate feeding in a variety of species, including man. These central effects are probably mediated by calcium-induced CaMKKβ phosphorylation of AMPK. In contrast, leptin inhibits feeding by reducing AMPK activity, likely due to inhibition of CaMKKβ in neurons (Birnbaum, 2005). Thus, AMPK coordinates metabolism at the whole body level by integrating positive and negative feeding signals to maintain ATP levels.

In the present study, we sought to determine the role of AMPK in various aging pathways in C. elegans. We report that aak-2 functions in some but not all lifespan pathways examined. Furthermore, we show that aak-2 and daf-16 have distinct but overlapping effects on lifespan extension. Our results suggest that AMPK is an important component of the aging machinery, representing a node at which multiple pathways intersect in the control of aging. These findings provide further evidence that energy metabolism plays a fundamental role in aging.

Results and discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgments
  7. References

aak-2 functions in the mitochondrial regulation of lifespan

Metabolic stress and production of reactive oxygen species have been proposed as causative factors in determining longevity, underscoring the importance of the mitochondrion in the free radical theory of aging (Hekimi & Guarente, 2003; Schriner et al., 2005). We have recently shown that exposing C. elegans to a variety of environmental stressors increases the AMP:ATP ratio and extends lifespan in an aak-2-dependent manner (Apfeld et al., 2004). Lifespan extension by inhibition of mitochondrial function in C. elegans is characterized by reduced oxygen consumption and reduced electron transport along the respiratory chain, suggesting lower energy levels (Feng et al., 2001). Therefore, we examined the role of aak-2 in mitochondrial control of longevity. The role of the mitochondria is demonstrated by mutations in isp-1, a component of complex II in the electron transport chain (Feng et al., 2001), or clk-1 which is necessary for ubiquinone synthesis (Lakowski & Hekimi, 1996). As expected for animals with mitochondrial dysfunction, the isp-1 and clk-1 mutants had higher AMP:ATP ratios compared to wild-type worms (Table 1); this may have the net result of extending lifespan by increasing AAK-2 activity. To test whether aak-2 mediates the lifespan extension of mitochondrial mutants, we generated worms mutant for both mitochondrial function and aak-2 using the null allele ok524 (Apfeld et al., 2004). We found that isp-1(qm150); aak-2(ok524) or clk-1(qm30); aak-2(ok524) double mutants had much shorter lifespans than isp-1(qm150) or clk-1(qm30) single mutants (Fig. 1A,B). Notably, removing aak-2 activity had more than twice the impact on lifespan in isp-1 and clk-1 mutants (27% and 24% reduction of the 75th percentile, respectively; Table 2) compared to wild-type animals (9% reduction of the 75th percentile; Table 2). However, isp-1; aak-2 and clk-1; aak-2 double mutants also lived longer than the aak-2(ok524) single mutant, suggesting that reduction of mitochondrial function extends lifespan by both aak-2-dependent and aak-2-independent mechanisms.

Table 1.  Ratios of adenine nucleotides
GenotypeMean ADP:ATP ratio ± SDMean AMP:ATP ratio ± SDnEnergy charge
  1. n is the number of independent trials. Comparisons with wild-type *P < 0.02, **P < 0.002, ***P < 0.0001 (unpaired t-test). Energy charge is equal to (ATP +1/2 ADP)/(ATP + ADP + AMP) and represents the extent that adenine nucleotides exist as high energy phosphates.

Wild type0.069 ± 0.0110.020 ± 0.004150.95 ± 0.01
isp-1(qm150) 0.121 ± 0.014***0.035 ± 0.010* 50.92 ± 0.01
clk-1(qm30) 0.171 ± 0.005*** 0.058 ± 0.020** 40.88 ± 0.01
image

Figure 1. Interactions between aak-2 and mitochondrial mutants. (A) Effect of aak-2(ok524) on the lifespans of isp-1(qm150) mitochondrial mutants. (B) Effect of aak-2(ok524) on the lifespans of clk-1(qm30) mitochondrial mutants. For statistical data see Table 2. (C) Effect of aak-2(ok524) on the duration of postembryonic development (from hatching to L4 molt). (D) Effect of aak-2(ok524) on the pharyngeal pumping cycle. *P < 0.0001 compared with wild type, †P < 0.0001 compared with aak-2(ok524), #P < 0.0001 compared with the single mutant corresponding to the mutation other than aak-2(ok524).

Download figure to PowerPoint

Table 2.  Statistical analysis of adult lifespans
Genotype/treatmentMean ± SEM (days)75th percentile (days)*Number of animals that died/totalnP
  • *

    The 75th percentile is the age when the fraction of animals alive reaches 0.25.

  • The total number of observations equals the number of animals that died plus the number censored.

  • n is the number of independent times that the lifespan was determined. P-values (log-rank test) were calculated for representative individual experiments consisting of control and experimental animals examined at the same time. Statistical significance was assigned to P-values < 0.001. ‡Comparisons with wild-type, §aak-2(ok524), ¶the single mutant corresponding to the mutation other than aak-2(ok524) present in the double mutant, **vector control, ††aak-2 RNAi starting at hatching.

Lifepans at 20 °C
 wild type20.0 ± 0.322157/17710 
 aak-2(ok524)17.6 ± 0.220150/24610< 0.0001
 isp-1(qm150)30.3 ± 1.437 45/60 1< 0.0001§
 isp-1(qm150); aak-2(ok524)22.6 ± 0.727 52/63 1< 0.0001§,
 clk-1(qm30)24.5 ± 0.629135/192 3< 0.0001§
 clk-1(qm30); aak-2(ok524)20.0 ± 0.222200/251 3< 0.0001§,
 geIn3[sir-2.1(+)]28.0 ± 0.731 62/70 1< 0.0001§
 geIn3[sir-2.1(+)]; aak-2(ok524)20.7 ± 0.423 75/84 1< 0.0001§,
 eat-2(ad1116)23.0 ± 0.727 54/71 1< 0.0001§
 eat-2(ad1116); aak-2(ok524)  25.9 ± 0.828 46/74 1< 0.0001§
      0.0065
 eat-2(ad465)22.2 ± 0.826 53/70 1< 0.0001§
 eat-2(ad465); aak-2(ok524)  20.7 ± 0.826 44/69 1< 0.0001§
      0.1685
Lifespans at 15 °C from egg to L4 molt, 20 °C during adulthood
 wild type18.5 ± 0.320 62/62 1 
 aak-2(ok524)16.0 ± 0.216 59/68 1< 0.0001
 glp-1(or178)23.6 ± 0.627 58/71 1< 0.0001§
 glp-1(or178); aak-2(ok524)  21.5 ± 0.524 45/81 1< 0.0001§
      0.0011
Lifespans of rrf-3(pk1426);daf-2(e1368) grown at 20 °C on HT115 bacteria expressing dsRNA for:
 Vector control33.4 ± 0.739153/186 3 
 aak-2 starting at hatching26.7 ± 0.429124/180 1< 0.0001**
 Vector control from egg to L4 molt.29.8 ± 0.433145/151 2< 0.0001**,††
  aak-2 starting at day 0 of adulthood
 Vector control from egg to day 6 of adulthood.31.3 ± 0.535114/131 1< 0.0001**
  aak-2 starting at day 6 of adulthood
 Vector control from egg to day 10 of32.5 ± 0.736 50/52 1  0.0348**
  adulthood. aak-2 starting at day 10 of adulthood

In addition to having longer lifespans, mitochondrial mutants grow and feed more slowly than their wild-type counterparts (Wong et al., 1995; Feng et al., 2001). In aak-2(ok524) mutants, the duration of postembryonic development (from hatching to the onset of adulthood) was almost the same as wild-type animals (Fig. 1C) and their pharyngeal pumping rate was normal (Fig. 1D). In contrast, isp-1(qm150); aak-2(ok524) and clk-1(qm30); aak-2(ok524) double mutants grew and fed more slowly than isp-1(qm150) and clk-1(qm30) single mutants (Fig. 1C,D). This suggests that aak-2 compensates partially for the effects of mitochondrial dysfunction in isp-1 and clk-1 mutants. Together, our results suggest that the increased AMP:ATP ratio resulting from mitochondrial dysfunction activates AAK-2 which, in turn, contributes to lifespan extension and ameliorates the feeding and growth defects caused by mutations in mitochondrial genes.

It is of interest that mammalian AMPK is activated by the antidiabetic drugs metformin, phenformin and rosiglitazone (Zhou et al., 2001; Fryer et al., 2002; Hawley et al., 2003). While the precise mechanism of action of these drugs is unknown, it has been proposed that they inhibit electron transport chain function (Owen et al., 2000; Brunmair et al., 2004) which would have the net effect of increasing the AMP:ATP ratio and lead to activation of AMPK. Consistent with our findings in C. elegans, treatment of nondiabetic rodents with phenformin extends maximum lifespan by 20% (Dilman & Anisimov, 1980; Anisimov et al., 2003). This suggests that the link between mitochondrial function, AMPK and lifespan is conserved from worms to mammals.

aak-2 is not required for lifespan extension by germline mutants

Loss-of-function mutations in the insulin/IGF-1 receptor orthologue daf-2 extend lifespan by a mechanism that is dependent on the FOXO transcription factor daf-16 (Kenyon et al., 1993; Lin et al., 1997; Ogg et al., 1997). While both daf-16 and aak-2 are required for the lifespan extension of daf-2 mutants, they apparently act in parallel pathways to influence lifespan (Apfeld et al., 2004). Therefore, we wanted to investigate the role of aak-2 in other lifespan-promoting manipulations known to be dependent on daf-16 function, such as ablation of the germline (Hsin & Kenyon, 1999). Signals from germline stem cells have a negative influence on lifespan. For example, temperature-sensitive mutants of glp-1 have a reduced number of germline stem cells when grown at a semirestrictive temperature during adulthood and these animals are long-lived (Arantes-Oliveira et al., 2002). However, signals from germline stem cells did not appear to require aak-2 to regulate lifespan, as aak-2(ok524) shortened the lifespan of glp-1(or178ts) mutants only as much as it shortened the lifespan of wild-type animals (Fig. 2A). Therefore, aak-2 is not a determinant of lifespan extension caused by loss of germline cells, and this represents a point of divergence between daf-16 and aak-2 in the control of lifespan.

image

Figure 2. Interactions between aak-2 and daf-16-dependent lifespan pathways. (A) Effect of aak-2(ok524) on the lifespans of glp-1 mutants. (B) Effect of aak-2(ok524) on the lifespans of sir-2.1 transgenic animals. For statistical analyses see Table 2.

Download figure to PowerPoint

Dependence on aak-2 for lifespan extension by sir-2.1

The Sir2 family of genes functions to extend lifespan in yeast, fruit flies and worms (Tissenbaum & Guarente, 2001; Rogina & Helfand, 2004). Members of the Sir2 family are NAD+-dependent protein deacetylases that may regulate lifespan in response to increased cellular NAD+:NADH ratios (Anderson et al., 2003; Lin et al., 2004). C. elegans overexpressing a sir-2.1 transgene (geIn3) live 50% longer than controls and lifespan extension in these sir-2.1-transgenic worms is daf-16-dependent (Tissenbaum & Guarente, 2001). Interestingly, aak-2(ok524) shortened the lifespan of animals carrying this sir-2.1 transgene more than it shortened the lifespan of wild-type animals (Fig. 2B). However, aak-2(ok524)-mutant, sir-2.1-transgenic animals lived longer than aak-2(ok524) single mutants, suggesting that sir-2.1 extends lifespan by both aak-2-dependent and aak-2-independent mechanisms. It is possible that the aak-2(ok524)-mutant prevents full expression of the sir-2.1 transgene. However, it is more likely that that information about cellular energy level (AMP:ATP ratio) and redox state (NAD+:NADH ratio) is integrated to regulate lifespan in C. elegans.

Dietary restriction bypasses the need for aak-2 function

Lastly, we tested the longevity pathway defined by the eat-2 mutants for interaction with aak-2. Mutations in eat-2 affect the function of the pharynx, which is thought to increase lifespan by limiting food intake, thus mimicking calorie restriction (Avery, 1993; Lakowski & Hekimi, 1998). Moreover, the longevity phenotype of eat-2 mutants is independent of daf-16 (Lakowski & Hekimi, 1998). We constructed double mutants between aak-2(ok524) and either strong or weak eat-2 alleles (ad1116 or ad465, respectively). Notably, the lack of aak-2 activity did not shorten the lifespan of either eat-2 mutant (Table 2). Therefore, these results indicate that eat-2 mutations, and by analogy dietary restriction, may bypass the need for aak-2 activity for lifespan extension.

aak-2 regulates lifespan during larval development and adulthood

Previous studies have shown that daf-2 functions exclusively in adulthood to regulate lifespan (Dillin et al., 2002a). Accordingly, we sought to determine when aak-2 functions to extend lifespan. We took advantage of the fact that lifespan extension in daf-2(e1386) mutants is dependent on aak-2 (Apfeld et al., 2004), which allowed examination of aak-2 function against a background of highly increased lifespan. We lowered aak-2 activity by RNAi in daf-2(e1368) mutants, starting at specific times, and measured the lifespan of the populations. Treatment with aak-2 RNAi at hatching shortened lifespan and this treatment was also effective when initiated at the onset of adulthood or up to day 6, but not at later times (Fig. 3). This differs from daf-2 RNAi which only increases lifespan during adulthood (Dillin et al., 2002a). However, it is conceivable that the aak-2 RNAi administered in early development does not affect AAK-2 protein levels until several days later, which would manifest as reduced AAK-2 only at adult stages. These results suggest that AAK-2 controls lifespan continually throughout development and adulthood by monitoring and responding to changes in energy levels, insulin/IGF-1 signals and perhaps other environmental and metabolic stimuli.

image

Figure 3. Temporal requirements for aak-2 function in the regulation of lifespan. aak-2 RNAi was administered at various times and lifespans were then measured as described in Experimental procedures. rrf-3(pk1426); daf-2(e1368) mutants were grown on control bacteria and then transferred onto bacteria expressing aak-2 double-stranded RNA at the indicated age. Control experiments indicate that aak-2 (RNAi) acts quickly, as treatment for one day lowers the expression of an AAK-2-GFP fusion protein (data not shown). For statistics, see Table 2.

Download figure to PowerPoint

Environmental and physiological inputs and the regulation of lifespan

A model, shown in Fig. 4, summarizes how AAK-2 and DAF-16 respond to environmental and physiological inputs that control lifespan. This illustrates how these key genes serve as nodes in the network of pathways controlling longevity, with no single node acting as a ‘checkpoint’ for the entire aging process. For example, aak-2 functions in the insulin/IGF-1 and Sir2 pathways and in the mitochondrial control of aging. In contrast, daf-16 functions in the insulin/IGF-1, Sir2 and germline pathways. Taken together, these findings indicate that aak-2 and daf-16 function in parallel to regulate lifespan because they respond to overlapping, but different, inputs. The fact that eat-2 mutations are unaffected by aak-2 (Table 2) or daf-16 (Lakowski & Hekimi, 1998) implies that other, as yet unidentified, pathways impinge upon lifespan control. The use of parallel pathways for lifespan control may allow the organism to coordinate responses to changes in specific environmental and physiological conditions.

image

Figure 4. Model for AAK-2 function in the regulation of lifespan. The model shows how diverse signals and pathways form a network that controls lifespan. Although daf-16 is completely required for lifespan extension of daf-2 mutants there is also a requirement for aak-2. Conversely, there are pathways highly dependent on aak-2 but not daf-16. AAK-2 and DAF-16 occupy central positions in the network and serve to integrate several signals. Downstream effectors of AAK-2 and DAF-16 may represent additional points of lifespan regulation.

Download figure to PowerPoint

It will be of interest to determine whether aak-2 and daf-16 regulate lifespan by a convergent mechanism involving regulation of common effectors; that is, are there further nodes downstream? It is known that daf-16 regulates the transcription of a large number of genes, including those involved in stress responses, cellular metabolism, and extracellular signaling (Lee et al., 2003a; McElwee et al., 2003; Murphy et al., 2003). In mammals, AMPK coordinates the response to low energy levels by phosphorylating a large number of substrates, resulting in changes in feeding, metabolism, and transcription (Hardie, 2004; Ruderman & Prentki, 2004; Kahn et al., 2005). It is possible that aak-2 regulates either the transcription or activity of key daf-16 targets. The identification of downstream effectors of aak-2 in C. elegans may provide novel insights into how this evolutionarily conserved pathway serves to control the aging process.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgments
  7. References

General methods and strains

Wild-type C. elegans was Bristol N2. Unless noted, experiments were performed at 20 °C. The following genes and mutations were used: LG II: eat-2(ad1116), eat-2(ad465), rrf-3(pk1426); LG III: clk-1(qm30), daf-2(e1368), glp-1(or178ts); LG IV: isp-1(qm150); LG X: aak-2(ok524); not mapped: geIn3 [sir-2.1(+), rol-6(d)].

Construction of strains

Double mutants were constructed by crossing aak-2(ok524) males to the hermaphrodites with the desired second mutation, allowing individual F1 progeny to self-fertilize, then identifying F2 animals with the phenotype corresponding to the second mutation, transferring these animals to individual plates and identifying aak-2(ok524) homozygotes among their progeny by polymerase chain reaction (PCR) using the following primers: ATGTCGTTGGAAAGATTCGC and CAATGCTGAGGTGACTTCCTCTTCG. The 27 °C Daf-c phenotype was used to identify daf-2 mutants, as described (Apfeld et al., 2004). geIn3 homozygotes were identified as animals whose progeny were all Rol. isp-1 and clk-1 mutant homozygotes were identified as animals whose progeny were all slow growing. glp-1(or178ts) homozygotes were identified as animals whose progeny were Emb at 25 °C; viable progeny were recovered by transferring the parental animals to 15 °C.

Lifespan assays

Lifespan assays were performed as described (Apfeld & Kenyon, 1999). At the L4 molt, animals were transferred to plates containing 20 µm 5-fluoro-2′-deoxyuridine (FUDR, Sigma, St. Louis, MO, USA), which kills their progeny as embryos. Control experiments indicated that this concentration of 5-fluoro-2′-deoxyuridine does not significantly affect lifespan. We used the L4 molt as t = 0 for lifespan analysis. Animals that crawled off the plate, exploded, or bagged were censored at the time of the event. This step incorporated those animals until the censor date, and was necessary to avoid the loss of information; for example, if a 50-day-old animal crawled off the plate, it would be important to include that information in the data set, as the animal was long-lived.

Feeding RNAi was performed as described (Dillin et al., 2002a), in an rrf-3 mutant background, which improves the effectiveness of RNAi (Simmer et al., 2002). Animals were added to the plates at the appropriate stage and transferred every 7 days onto fresh plates. The fragment used for aak-2 RNAi was generated using the primers AATGTTTTCTCATCAAGATCGAGACCGC and AACGAGCCAGTGTTCCAATCAATGC. We used JMP 5.0 (SAS,Cary, NC, USA) software to carry out all statistical analyses, and to determine means and percentiles.

Other assays

Postembryonic development and pharyngeal pumping rate were measured as reported by Wong et al. (1995). Nucleotide measurements were performed by adapting the method of Stocchi et al. (1985) to C. elegans, as described (Apfeld et al., 2004).

Acknowledgments

  1. Top of page
  2. Summary
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgments
  7. References

We are indebted to Dr Javier Apfeld for conducting many of the experiments and without whose insight this work would not have been possible. We are grateful to Cynthia Kenyon for critical reading of the manuscript. We also thank members of the Elixir community for feedback and support, in particular Tom McDonagh for help with the nucleotide measurements.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgments
  7. References