SEARCH

SEARCH BY CITATION

Keywords:

  • apoptosis;
  • deacetylation;
  • forkhead box O transcription factor;
  • oxidative stress;
  • SIRT2;
  • sirtuin

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References

The sirtuin family of nicotinamide adenine dinucleotide-dependant (NAD) deacetylases plays an important role in aging and metabolic regulation. In yeast, the Sir2 gene and its homolog Hst2 independently mediate the action of caloric restriction on lifespan extension. The mammalian Sir2 ortholog, SIRT1, is up-regulated by caloric restriction and deacetylates a variety of substrates, including histones and the forkhead box O (FOXO) transcription factors. The mammalian ortholog of Hst2, SIRT2, was shown to co-localize with microtubules and functions as α-tubulin deacetylase. During G2/M phase, SIRT2 proteins enter nuclei and deacetylate histones. We report here that the expression of SIRT2 is elevated in the white adipose tissue and kidney of caloric-restricted mice. Oxidative stress, such as hydrogen peroxide treatment, also increases SIRT2 expression in cells. We have demonstrated that SIRT2 binds to FOXO3a and reduces its acetylation level. SIRT2 hence increases FOXO DNA binding and elevates the expression of FOXO target genes, p27Kip1, manganese superoxide dismutase and Bim. As a consequence, SIRT2 decreases cellular levels of reactive oxygen species. Furthermore, as Bim is a pro-apoptotic factor, SIRT2 promotes cell death when cells are under severe stress. Therefore, mammalian SIRT2 responds to caloric restriction and oxidative stress to deacetylate FOXO transcription factors.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References

Dietary caloric restriction is the most potent intervention to retard aging in a variety of species (Weindruch & Walford, 1988). Recent studies have revealed the Sir2 gene and its homolog, Hst2, as possible mediators of caloric restriction in yeast (Lin et al., 2000; Lamming et al., 2005). Sir2 and Hst2 proteins possess nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylase activities (Imai et al., 2000; Landry et al., 2000; Smith et al., 2000; Perrod et al., 2001). Mutation of Sir2 or blocking of NAD synthesis abolishes the effect of caloric restriction in yeast (Lin et al., 2000) or flies (Rogina & Helfand, 2004). In yeast, Hst2 is complementary to Sir2 in mediating lifespan extension by caloric restriction (Lamming et al., 2005). Whether any of the seven mammalian Sir2 homologs, that is, sirtuins, mediate the action of caloric restriction on longevity is still unknown. Mammalian SIRT1 is the most closely related to yeast Sir2. Caloric restriction (Cohen et al., 2004) or fasting (Rodgers et al., 2005) elevates SIRT1 protein levels. It was recently shown that knockout of SIRT1 in mice prevents the increase of physical activity in response to caloric restriction (Chen et al., 2005). SIRT1 can deacetylate several important transcription factors including p53 (Luo et al., 2001; Vaziri et al., 2001; Langley et al., 2002), NF-κB (Yeung et al., 2004) and O subfamily of forkhead (FOXO) transcription factors (Brunet et al., 2004; Daitoku et al., 2004; Motta et al., 2004; van der Horst et al., 2004). SIRT1 protein was originally thought to be exclusively nuclear localized. However, recent work has revealed that SIRT1 subcellular localization varies in different tissue or cell types, even during development and cell differentiation processes (Tanno et al., 2007). SIRT2, the mammalian ortholog of Hst2, is distributed mainly in the cytoplasm (Yang et al., 2000). SIRT2 co-localizes with microtubules and deacetylates α-tubulin at the lysine-40 (North et al., 2003). A recent report showed SIRT2 can transiently migrate to nuclei in the G2/M transition during mitosis to deacetylate histone H4Lys16 (Vaquero et al., 2006). SIRT2 has also been shown to play a role in the control of G2/M transition with its expression and phosphorylation being increased during G2/M phase (Dryden et al., 2003). In addition, SIRT2 expression is down-regulated in gliomas, supporting its potential role as an inhibitor for cell proliferation (Hiratsuka et al., 2003).

The forkhead transcription O subfamily of transcription factors is part of the insulin/insulin-like growth factor (IGF) signaling pathway, a conserved regulatory system for metabolism and aging. In Caenorhabditis elegans, the absence of the forkhead transcription factor daf-16 prevents dauer formation and lifespan extension of the insulin/IGF receptor daf-2 mutant (Lin et al., 2001). Increasing daf-16 activity in the intestine of worms delays aging (Libina et al., 2003). The mammalian homologs of daf-16 are the FOXO family of transcription factors: FOXO1, FOXO3a, FOXO4 and FOXO6. FOXO factors regulate metabolism and confer stress resistance (Burgering & Kops, 2002; Accili & Arden, 2004). FOXO regulates oxidative response genes by activating manganese superoxide dismutase (MnSOD) (Kops et al., 2002) and catalase (Furuyama et al., 2000; Nemoto & Finkel, 2002). FOXO was shown to mediate oxidative stress resistance in long-lived p66shc mutant mice (Nemoto & Finkel, 2002). In addition, FOXO induces cell cycle inhibitor p27kip1 and p130 (Burgering & Kops, 2002) and pro-apoptotic factor Bim (Dijkers et al., 2000).

Because in yeast, the Hst2 gene complements the action of Sir2 in mediating caloric restriction (Lin et al., 2000; Lamming et al., 2005), it is imperative to find out whether the mammalian ortholog of Hst2, SIRT2, responds to caloric restriction and shares some of the function of SIRT1. Here, we report our discovery that the expression of SIRT2 is elevated in response to caloric restriction and oxidative stress. We further demonstrated that SIRT2 also binds to and deacetylates FOXO3a, resulting in the increased expression of p27kip1, MnSOD and Bim to reduce cellular reactive oxygen species (ROS) levels, while promoting apoptosis when cells are under severe stress.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References

SIRT2 expression is up-regulated by caloric restriction and oxidative stress

It was reported that in rats, SIRT1 protein levels were increased by caloric restriction in fat, liver, brain and kidney (Cohen et al., 2004). We also discovered that SIRT3 expression in white and brown fat is elevated by caloric restriction (Shi et al., 2005). We decided to investigate whether caloric restriction affects SIRT2 expression. After subjecting C57BL/6 male mice to 18 months of caloric restriction by feeding them 60% of the amount consumed by ad libitum controls, SIRT2 protein levels increased significantly in white adipose tissue and kidney, but not in the liver and brain (Fig. 1A). SIRT1 protein levels were up in all four tissues, but reaching statistical significance in only white adipose and liver. As oxidative stress is closely related to the aging process, we then investigated the effect of oxidative stress on SIRT2 expression in cultured cells. We found SIRT2 mRNA level was increased in HEK293T human embryonic kidney cells after treatment with 100 µm hydrogen peroxide (H2O2) or 25 µm menadione for 24 h. Hydrogen peroxide treatment (500 µm, 24 h) also increased SIRT2 mRNA level in 3T3-L1 murine adipocytes (Fig. 1B). We found that SIRT2 protein level is up-regulated in HEK293T cells after treatment with menadione in a dose-dependent manner (Fig. 1C). These results suggest that both caloric restriction and oxidative stress activate SIRT2 expression.

image

Figure 1. Caloric restriction and oxidative stress stimulate SIRT2 expression. (A) C57BL/6 male mice were fed NIH-31 standard feed (Harlan Teklad) ad libitum (AL) or NIH-31/NIA fortified diet (Harlan Teklad) with a daily food allotment of 60% of the control mice (CR). Eighteen months after the onset of caloric restriction, tissues were harvested to examine SIRT1 and SIRT2 expression by immunoblot analysis. (B) 293T cells were treated with either 100 µm H2O2 or 25 µm menadione for 24 h. Differentiated 3T3-L1 adipocytes were treated with 500 µm H2O2 for 24 h. SIRT2 mRNA levels were detected by Northern blot analysis. (C) 293T cells were treated with 0, 5, 15, and 25 µm menadione for 5 h. SIRT2 protein levels were detected by Western blot analysis. Values represent the mean of three different experiments. *P < 0.05, **P < 0.01.

Download figure to PowerPoint

SIRT2 interacts with FOXO3a

As FOXO transcription factors play a central role in regulating stress response (Kim et al., 2005) and because SIRT1 binds and deacetylates FOXO factors, we have investigated the interaction between SIRT2 and FOXO transcription factors. We tested whether SIRT2 interacts with FOXO3a, a FOXO factor with a broad tissue distribution (Anderson et al., 1998), by transiently transfecting HEK293T cells with plasmid constructs expressing Flag-tagged FOXO3a and SIRT2, as well as a SIRT2 mutant with greatly reduced deacetylase activity (SIRT2H187A, with amino acid residue 187 histidine to alanine substitution) (Finnin et al., 2001; Borra et al., 2002). SIRT1 or SIRT3 expressing constructs were also used as controls. Cell lysates were collected and FOXO3a proteins were immunoprecipitated with an anti-Flag antibody. As expected, SIRT1 was found to be co-immunoprecipitated with FOXO3a, but not the mitochondrial localized SIRT3 (Shi et al., 2005) (Fig. 2A). SIRT2 and SIRT2H187A mutant were also co-immunoprecipitated with FOXO3a, indicating loss of SIRT2 enzymatic activity does not affect its interaction with FOXO3a. Alternatively, when FOXO3a and SIRT2-Flag are co-expressed in HEK293T cells, immunoprecipitation of SIRT2-Flag by anti-Flag beads resulted in the pull down of FOXO3a (Fig. 2B). We next tested whether SIRT2 and FOXO3a proteins interact endogenously. As both SIRT2 and FOXO3a are expressed abundantly in the brain, brain protein extracts were used for immunoprecipitation with an anti-SIRT2 antibody. As shown in Fig. 2C, FOXO3a can be detected in the anti-SIRT2 antibody immunoprecipitation complexes. Overall, these data have demonstrated that SIRT2 protein physically interacts with FOXO3a.

image

Figure 2. SIRT2 interacts with FOXO3a. (A) HEK293T cells were transiently transfected with pFlag-FOXO3a, pcDNA-SIRT1, pCMV-SIRT2, pCMV-SIRT2H187A and pCMV-SIRT3 by calcium phosphate method. Cells were harvested 40 h after transfection. Cell lysates were immunoprecipitated with anti-Flag agarose beads and analyzed by immunoblot analysis with antibodies as indicated. (B) HEK293T cells were transiently transfected with FOXO3a, pCDNA-SIRT2-Flag or both. Cell lysates were immunoprecipitated with anti-Flag agarose beads and followed by immunoblot analysis with antibodies as indicated. (C) Brain lysate was incubated with anti-SIRT2 antibody immune-precipitated using protein A-agarose beads. Interaction of endogenous SIRT2 and FOXO3a was detected by Western blot analysis. IP, immunoprecipitation; IB, immunoblot analysis.

Download figure to PowerPoint

SIRT2 deacetylates FOXO3a

As SIRT2 is an NAD-dependant deacetylase, we investigated whether SIRT2 affects FOXO3a acetylation. For this purpose, Flag-FOXO3a was co-transfected with SIRT2 into 293T cells. FOXO3a proteins were pulled down from cell lysates with anti-Flag beads, and their acetylation levels were detected by an anti-acetylated lysine antibody. As shown in Fig. 3A, FOXO3a acetylation level was decreased in SIRT2 overexpressing cells, suggesting that SIRT2 deacetylates FOXO3a. As reported (Brunet et al., 2004; Motta et al., 2004), treatment of cells with class I/II histone deacetylase (HDAC) inhibitor, Tricostatin A (TSA), increased FOXO3a acetylation, indicating that FOXO3a is also a substrate for class I/II HDAC. Even in the presence of TSA, SIRT2 overexpression was able to keep FOXO3a acetylation to a very low level (Fig. 3A). Hydrogen peroxide treatment further increased FOXO3a acetylation, as shown before (Brunet et al., 2004). Under these conditions, FOXO3a acetylation level is still reduced by SIRT2 (Fig. 3A). In addition, we also analyzed FOXO3a protein acetylation in HEK293T cells expressing Flag-FOXO3a together with SIRT1, SIRT2, SIRT2H187A, or SIRT3. We found that SIRT1 or SIRT2 overexpression reduces FOXO3a acetylation levels to a comparable level, while SIRT2 deacetylase mutant (SIRT2H187A) or SIRT3 was not able to deacetylate FOXO3a (Fig. 3B). In order to address whether endogenous SIRT2 regulates FOXO3a acetylation levels, we knocked down the endogenous SIRT2 in NIH3T3 cells by a lentiviral-mediated expression of short hairpin RNA (shRNA). As the lentiviral vector contained a cassette for green fluorescent protein (GFP) expression, viral transduced cells were sorted out using flow cytometer. Two different shRNAs against SIRT2 were tested and both achieved satisfactory repression of SIRT2 expression (Fig. 3C). As a control, we also detected SIRT1 expression in these cells and found SIRT1 protein level was not affected by RNAi knock-down of SIRT2 (Fig. 3C). To examine the effect of SIRT2 knock-down on FOXO3a acetylation, Flag-FOXO3a was transiently transfected into NIH3T3 cells with or without SIRT2 knock-down. Flag-FOXO3a proteins were pulled down with anti-Flag beads, and acetylated FOXO3a was detected with immunoblot analysis. As shown in Fig. 3D, the acetylation level of Flag-FOXO3a was higher in SIRT2 knock-down cells than in control cells, indicating that the presence of endogenous SIRT2 decreases FOXO3a acetylation.

image

Figure 3. SIRT2 decreases FOXO3a acetylation level. (A) HEK293T cells were transfected with pFlag-FOXO3a and pCMV-SIRT2. Cells were treated with or without 1 µm Tricostatin A (TSA) for 2 h and 500 µm H2O2 for 1 h before harvest. FOXO3a was immunoprecipitated with anti-Flag beads, and acetylated FOXO3a was detected with an antiacetylated lysine antibody. (B) HEK293T cells were transfected with pFlag-FOXO3a, pcDNA-SIRT1, pCMV-SIRT2, pCMV-SIRT2H187A and pCMV-SIRT3 by calcium phosphate method. Cells were treated with 1 µm TSA for 2 h before harvest. FOXO3a acetylation level was detected as described above. (C) NIH3T3 cells with SIRT2 shRNA knock-down were generated using a lentiviral-mediated delivery system. The expression of SIRT2 and SIRT1 proteins in these cells was determined by immunoblot analysis. V, vector control cells; R1, R2, NIH3T3 cells expressing two different shRNA against SIRT2. (D) pFlag-FOXO3a was transfected into NIH3T3 SIRT2 knock-down cells and control cells. Two days after transfection, cells were treated with TSA as described in (A). After protein extraction, FOXO3a was immunoprecipitated with anti-Flag beads, and acetylated FOXO3a was detected with an antiacetylated lysine antibody. (E) HEK293T cells with or without the treatment of 500 µm H2O2 for 1 h were fractionated using the Nuclear and Cytoplasmic Extraction Kit from Pierce (Rockford, IL, USA) and analyzed by immunoblot analysis with antibodies as indicated.

Download figure to PowerPoint

We then investigated the subcellular compartment where SIRT2 exerts its action. We have found that SIRT2 remains in the cytoplasmic fraction of HEK293T cells under basal or H2O2-treated conditions (Fig. 3E). Interestingly, the SIRT1 proteins were also localized mainly in the cytoplasmic fraction. This is consistent with a recent finding that SIRT1 is present in cytoplasm in some cells (Tanno et al., 2007). Our result suggests that SIRT2, as well as SIRT1, is likely to deacetylate FOXO factors in the cytoplasm in HEK293T cells.

SIRT2 increase FOXO3a transactivation activity

It is known that forkhead transcription factors activate the expression of its target genes, such as p27kip1, MnSOD and Bim. We first examined the effect of SIRT2 on FOXO3a binding to the promoter region of p27kip1, using the chromatin-immunoprecipitation (ChIP) assay. As shown in Fig. 4A, in cells with constitutive retroviral SIRT2 expression, more FOXO3a proteins bound to the p27kip1 gene promoter, suggesting the deacetylation of FOXO3a by SIRT2 enhances FOXO3a DNA binding. We then examined the expression of p27kip1 in NIH3T3 cells with RNAi knock-down of SIRT2 expression. We observed that the down-regulation of SIRT2 resulted in decreased expression of p27kip1 (Fig. 4B). In agreement with the RNA level changes, p27kip1 protein level was increased in NIH3T3 cells with SIRT2 overexpression, while it was decreased in SIRT2 knock-down cells (Fig. 4C). In addition, treatment with 100 µm H2O2 for 18 h decreased p27kip1 expression, consistent with our observation that H2O2 increased FOXO acetylation as shown in Fig. 3A. This is also in agreement with previous reports that H2O2 treatment led to increased acetylation of FOXO4 and reduced its transactivation activity (van der Horst et al., 2004). Knocking down SIRT2 further decreased p27kip1 expression (Fig. 4C), indicating that SIRT2 plays a major role in FOXO3a deacetylation during oxidative stress.

image

Figure 4. SIRT2 regulates the expression of FOXO target gene p27kip1. (A) NIH3T3 cells with SIRT2 overexpression were established using a retroviral system. The binding of FOXO3a to the p27kip1 promoter region was detected by chromatin-immunoprecipitation (ChIP) assay. The pre-immune serum was used for the negative control. (B) NIH3T3 cells with SIRT2 lentiviral RNAi knock-down were probed for the expression of p27kip1 by Northern blot analysis. The ethidium bromide (EtBr) staining of the RNA is shown for the loading and the integrity of the samples. p27kip1 mRNA levels from three different experiments were quantified and shown in right panel. (C) p27kip1 protein level was detected by Western blotting in NIH3T3 cells with lentiviral RNAi knock-down (left panel) or SIRT2 retroviral overexpression (right panel). V, vector control cells; SIRT2, NIH3T3 cells with retroviral SIRT2 overexpression; R1, R2, NIH3T3 cells expressing two different shRNA against SIRT2.

Download figure to PowerPoint

SIRT2 reduces cellular ROS level

The mitochondrial MnSOD is also a FOXO target gene. SIRT2 regulates the expression of MnSOD through FOXO3a in a similar fashion. Constitutive expression of SIRT2 up-regulated MnSOD, while SIRT2 knock-down decreased MnSOD levels (Fig. 5A). As SIRT2 elevated the expression of MnSOD, which converts superoxide (O2) to H2O2, it was expected that SIRT2 might enhance the detoxification of ROS to decrease the cellular ROS level. As shown in Fig. 5B, at basal state, overexpression of SIRT2 slightly lowered cellular ROS levels. Furthermore, SIRT2 significantly blunted the increase of cellular ROS induced by 100 µm H2O2 treatment.

image

Figure 5. SIRT2 activates the expression of manganese superoxide dismutase (MnSOD) and reduces cellular reactive oxygen species (ROS) level in NIH3T3 fibroblasts. (A) The MnSOD protein levels in NIH3T3 cells with SIRT2 retroviral overexpression or lentiviral RNAi knock-down were detected by immunoblot analysis. V, vector control cells; SIRT2, NIH3T3 cells with retroviral SIRT2 overexpression; R1, R2, NIH3T3 cells expressing two different shRNA against SIRT2. (B) NIH3T3 cells with SIRT2 retroviral overexpression were exposed to 100 µm H2O2 for 30 min. To determine the cellular ROS level, cells were stained with 10 mm 2’,7’-dichlorodihydrofluorescein diacetate (DCFHDA) and the fluorescent from the oxidized dye was quantitated by flow cytometry at 525 nm. *P < 0.05, **P < 0.01.

Download figure to PowerPoint

SIRT2 increases cell death induced by H2O2 and staurosporine

As expected, the expression of another FOXO target gene Bim was activated by SIRT2 overexpression and suppressed by SIRT2 RNAi knock-down (Fig. 6A). As Bim is a potent pro-apoptotic factor (Strasser et al., 2000), the elevation of Bim expression by SIRT2 should promote apoptosis. To test this, NIH3T3 cells were treated with different concentrations of H2O2 for 16 h, and cell death was detected by the staining of the viable cells with CellTiter-Blue reagent. The increase of H2O2 concentration gradually increased the rate of cell death. When cells were challenged with 100 µm or more of H2O2, SIRT2 overexpression further promoted cell death (Fig. 6B). Mutation to abolish SIRT2 enzymatic activity attenuated this effect. This increase of cell death by SIRT2 was also confirmed when the SIRT2 overexpressing NIH3T3 fibroblasts were treated with 500 µm H2O2 and cell death was detected by annexin-V labeling (Fig. 6C). We could not detect caspase-3 cleavage in these cells (data not shown). This is consistent with a previous finding that H2O2 treatment causes cell death through caspase-independent pathways (Yu et al., 2002). We then tested whether SIRT2 also promoted caspase-dependent apoptosis. To this end, we treated SIRT2 knock-down NIH3T3 cells with staurosporine, an effective inducer of apoptosis. Caspase-3 activation by cleavage began 2 h after staurosporine treatment and reached the highest level at 6–8 h in control cells (Fig. 6D). However, in SIRT2 knock-down cells, the activation of caspase-3 was delayed and the cleaved caspase-3 level was always lower than that in the control cells. In contrast, SIRT2 overexpressing NIH3T3 fibroblasts have significantly higher levels of cleaved caspase-3 than that in control cells (Fig. 6D). Taken together, SIRT2 enhances both caspase-3 mediated and caspase-3 independent cell death when cells are exposed to severe stresses.

image

Figure 6. SIRT2 up-regulates Bim expression and promotes apoptosis. (A) The protein levels of Bim in NIH3T3 cells with SIRT2 retroviral overexpression or lentiviral RNAi knock-down of SIRT2 were detected by immunoblot analysis. (B) NIH3T3 cells overexpressing SIRT2 or SIRT2H187A were treated with 0, 20, 50, 100, 250, and 500 µm of H2O2 for 16 h, and viable cells were detected using CellTiter-Blue kit. (C) SIRT2 overexpressing NIH3T3 cells were treated with 0 or 500 µm of H2O2 for 4 h. After labeling with Annexin V and 7-AAD, cell death was analyzed by flow cytometry. (D) NIH3T3 cells with SIRT2 knock-down or overexpression were treated with 0.5 µm staurosporine for the times indicated above, cleaved Caspase-3 was detected by an antibody against cleaved Caspase-3. V, vector control cells; SIRT2, NIH3T3 cells with retroviral SIRT2 overexpression; R1, NIH3T3 cells expressing shRNA against SIRT2.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References

In this report, we demonstrated that caloric restriction and oxidative stress activate the expression of SIRT2, the mammalian ortholog of yeast Hst2. Our data for the first time demonstrated that SIRT2 interacts with and deacetylates a FOXO transcription factor, FOXO3a. SIRT2 deacetylation of FOXO3a results in the stimulation of the expression of FOXO target genes, such as p27kip1, MnSOD and Bim. As a consequence, SIRT2 regulates cellular responses to oxidative stress by reducing cellular ROS and increasing cell death.

We have observed that caloric restriction significantly activated SIRT1 expression in white adipose and liver, as well as SIRT2 expression in white adipose and kidney. This partially overlapping pattern of response to caloric restriction by SIRT1 and SIRT2 implies that each of them mediates a partial effect of caloric restriction. It is also quite interesting that the expressions of SIRT1, SIRT2 and SIRT3 are all elevated by caloric restriction in adipose tissue. As adipose tissue also functions as an endocrine organ to affect other parts of the body by secreting hormones or cytokines such as leptin and adiponectin, the elevation of sirtuins in fat might be able to exert a systematic effect by regulating the production of adipokines. In addition, it was documented that changes in adipose tissue alone could affect the lifespan of the animal, as mice with adipose-specific deletion of insulin receptor exhibit extended lifespan (Bluher et al., 2003). At this moment, it is still unclear whether or not mammalian SIRT2 contributes to the action of caloric restriction on metabolism and longevity. Animal models with SIRT2 overexpression or deficiency will provide useful tools to address these questions.

Either SIRT1 or SIRT2 is able to deacetylate FOXO3a in the presence of the other, suggesting that they function in a nonredundant manner. In the HEK293T cells, SIRT2, as well as SIRT1, is localized in the cytoplasm. They are likely to deacetylate FOXO factors in the cytoplasm. In these cells, the FOXO factors are acetylated either in the nuclei by acetylases such as p300/CBP-associated factor (PCAF), cAMP response element binding protein (CREB) binding protein (CBP) and p300 (Brunet et al., 2004; Daitoku et al., 2004; Motta et al., 2004; van der Horst et al., 2004) and then shuttle back to the cytoplasm (Van Der Heide et al., 2004) to become SIRT1 or SIRT2 substrates, or FOXO might be acetylated in the cytoplasm. Deacetylated FOXO factor will then enter the nucleus to activate the transcription of its target genes. However, as SIRT2 is also likely to shuttle between nucleus and cytoplasm, we cannot rule out the possibility that even the low amount of SIRT2 in the nucleus contributes significantly to FOXO deacetylation in the nucleus. In addition, in other cells where SIRT1 is nuclear localized, SIRT1 may deacetylate FOXO in the nucleus.

In the literature, the findings regarding the effect of SIRT1 deacetylation on the transactivation activity of FOXO factors are not consistent, suggesting a complex regulation of the transactivation activity of FOXO factors by deacetylation (Daitoku et al., 2004; van der Horst et al., 2004; Motta et al., 2004; Yang et al., 2005). In our experiments reported here, results from both SIRT2 overexpression and knock-down suggest that FOXO deacetylation by SIRT2 activates FOXO transactivation activity, this is in agreement with a recent report that deacetylation of FOXO allows monoubiquitination and subsequent increase of transcriptional activity of FOXO factors (van der Horst et al., 2006).

Our results suggest that the overall function of SIRT2 is to enhance the ability of cells to cope with oxidative stress. We have shown that SIRT2 reduces cellular oxidative stress by promoting FOXO transactivation activity to increase the expression of MnSOD and reduce the cellular ROS levels. Meanwhile, SIRT2 also causes cell growth arrest either through the stimulation of p27Kip1 expression, which causes G1 arrest (Tran et al., 2002), or through mitotic arrest as reported (Dryden et al., 2003). The inhibition of cell proliferation minimizes the propagation of mutations induced by oxidative stress and allows for the proper repair of cellular damage. In addition, SIRT2 also increases the levels of another FOXO target gene, the pro-apoptotic Bim. Our data indicate that under lower levels of H2O2 treatment (< 50 µm), SIRT2 does not significantly boost cell death, likely due to a balance between opposite actions of SIRT2 to reduce ROS through MnSOD and increase cell death through Bim. However, when cells are exposed to high levels of oxidative challenges (100 µm or higher), the pro-apoptotic effect of Bim is predominant, suggesting under severe oxidative stress SIRT2 facilitates cell death to clear cells damaged beyond repair. This offers protection against tumor development. In fact, it was found that SIRT2 level is dramatically diminished in gliomas, and overexpression of SIRT2 in glioma cells reduces clony formation, suggesting SIRT2 may function as a tumor suppressor (Hiratsuka et al., 2003). Consistent with our findings, the up-regulation of FOXO activity by MST1 kinase phosphorylation was also found to increase oxidative stress-induced neuronal cell death, while at the whole animal level, C. elegans MST1 ortholog CST-1 promotes longevity of the worm (Lehtinen et al., 2006), suggesting that the beneficial effect of up-regulating FOXO/Daf-16 activity on lifespan extension may be partly due to the clearance of severely damaged cells.

It is worth noting that although we have shown here that SIRT2 regulates cellular oxidative status response through the FOXO factors, we cannot rule out the possibility that SIRT2 also functions through FOXO-independent pathways to regulate ROS levels and cell death. For example, SIRT2 and SIRT3 catalyzed reactions produce O-acetyl-ADP-ribose (OAADPr), which was found to bind to and activate the cytoplasmic domain of the transient receptor potential melastatin-related channel 2 (TRPM2), which is a nonselective cation channel activated by oxidative and nitrative agents and leads to cell death (Grubisha et al., 2006).

Overall, our results linked SIRT2 to caloric restriction, insulin-like signaling pathway and oxidative stress resistance, all known key players in the control of the aging process. Further study is needed to fully elucidate the function of SIRT2 and its role in caloric restriction and the regulation of aging.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References

Animals

For the caloric restriction experiment, C57BL/6 male mice were singly caged. At 8 weeks of age, control mice were fed ad libitum with NIH-31 standard diet (Harlan Teklad, Madison, WI, USA) while food consumption was measured daily. Caloric restricted mice were fed with NIH-31/NIA fortified diet (Harlan Teklad) with a daily food allotment of 90, 70 and then 60% of the amount consumed by the control mice at the first, second and third week, respectively. From then on, daily food allotment stabilized at 60% of ad libitum food intake for the caloric-restricted mice. Eighteen months later, mice were dissected to collect tissues for analysis.

Plasmids and antibodies

The plasmid pCMVSport6-mSIRT2 was purchased from Open Biosystems (Huntsville, AL, USA). SIRT2 cDNA was excised out with EcoRI and XhoI and inserted into the XhoI and SalI sites of pBabe-puro vector. The H187A mutant of SIRT2 was generated by a polymerase chain reaction (PCR) method (Makarova et al., 2000) with the following primer: 5’-AGGACCTGGTGGAGGCCGCGGGCACCTTCTACAC-3’. SIRT2-Flag was created by PCR amplification using the following primers: 5’-acagagcagtcggtgacagt-3’ and 5’-gttacttgtcgtcatcgtctttgtagtcctgctgttcctctttctct-3’. The resulting SIRT2-Flag PCR fragment was ligated into the pCR-blunt II-TOPO vector (Invitrogen, Carlsbad, CA, USA) and then excised out with BamHI and XhoI and inserted into the corresponding sites of pcDNA3.1 to generate pCDNA3-SIRT2-Flag. The pCl-HA-FOXO3a and pCI-Flag-FOXO3a plasmids were kindly provided by Dr. Mickey C.-T. Hu of the MD Anderson Cancer Center. The following antibodies were used: SIRT1 (Upstate, Temecula, CA, USA, catalog no. 07-131), SIRT2 (Santa Cruz Biotechnology, Santa Cruz, CA, USA; sc-20966), tubulin (Sigma-Aldrich, St. Louis, MO, USA; catalog no. T5168), actin (Santa Cruz Biotechnology; sc-1616), FOXO3a (Upstate; 06-951), MnSOD (Stressgen, Victoria, BC, Canada; SOD-110), p27Kip1 (BD Transduction laboratories, San Diego, CA, USA; 610241), Bim (BD PharMingen, San Diego, CA, USA; 559685), cleaved Caspase-3 (Cell Signaling, Beverly, MA, USA; catalog no. 9664), anti-Flag HRP (Sigma-Aldrich; product no. A8592), anti-Flag M2 agarose affinity gel (Sigma-Aldrich; catalog no. A2220), and protein A-agarose beads (Santa Cruz Biotechnology; catalog no. sc-2001). Rabbit anti-SIRT3 antibody was raised against the C-terminus 15 amino acid residues of mouse SIRT3 (DLMQRERGKLDGQDR) by the Genemed Synthesis, Inc. (South San Francisco, CA, USA).

Cell culture, transfection and retroviral infection

NIH3T3, HEK293 and 293T cells were maintained in Dulbecco's modified Eagle's medium (DMEM) with 10% calf serum. For transient transfection, HEK293 or 293T cells were transfected in 100-mm plates with calcium phosphate method. NIH3T3 cells were transfected using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions. The NIH3T3 stable cells expressing SIRT2 or SIRT2 mutant were established using the pBabe retroviral system (Pear et al., 1993) as previously described (Shi et al., 2005).

RNA interference

NIH3T3 cells with SIRT2 shRNA knock-down were generated using a lentiviral-mediated delivery system as reported (Qin et al., 2003). The DNA cassettes used to generate shRNA against different regions of SIRT2 mRNA in this experiment were: RNAi-1:accgaaacatccggaacccttcttcaagagagaagggttccggatgtttctttttc and RNAi-2: accgccaaccatctgccactacttcaagagagtagtggcagatggttggctttttc. The 19nt sense and reverse complementary targeting sequences were underlined. Briefly, double-stranded oligos were inserted into the BbsI/XhoI site of pBS-hU6-1 vector. The cloned oligo sequence together with an upstream human U6 promoter were excised with XbaI and XhoI and then subcloned into FG12 vector, which contains an enhanced green fluorescent protein (EGFP) marker for cell tracking. FG12-hU6-siRNA lentiviral vectors were transfected into 293T cells together with three packaging plasmids: pMDLg/pRRE, CMV-VSVG and RSV-Rev. The recombinant lentiviruses produced from the transfected 293T cells were used to infect NIH3T3 cells. Seventy-two hours after infection, transduced NIH3T3 cells were sorted by flow cytometry based on EGFP expression.

Immunoprecipitation and immunoblotting

Cells were lysed with a lysis buffer [50 mm Tris, 50 mm KCl, 20 mm NaF, 1 mm Na3VO4, 10 mm ethylenediaminetetraacetic acid (EDTA), 1% NP-40, 10 mm nicotinamide, 1 mm TSA, 1 mm phenylmethanesulphonylfluoride (PMSF), 5 µg mL−1 leupeptin, pH 8.0]. Equal amounts of cell lysates were incubated with 20 µL anti-Flag agarose beads at 4 °C on a shaker overnight. After washing five times with lysis buffer, the precipitated proteins were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) followed by immunoblot analysis. For endogenous SIRT2 and FOXO3a interaction, 4 mg brain proteins were incubated with 2 µg anti-SIRT2 antibody and 20 µL protein A beads.

Measurement of cellular ROS levels

NIH3T3 cells were trypsinized and washed once with phosphate-buffered saline (PBS), and incubated with 10 µm 2’,7’-dichlorodihydrofluorescein diacetate (DCFH2DA) (Sigma) for 10 min at 37 °C. After washing with PBS, 10 000 cells of each sample were analyzed by flow cytometry, which measured the fluorescent emitted by the oxidized dye at 525 nm. The results are presented as means ± SD of three independent experiments.

Chromatin immunoprecipitation analysis (ChiP)

The ChIP assay of FOXO3a binding to the p27kip1 promoter was based on a published work (You et al., 2004). Briefly, 107 cells were fixed with 1% formaldehyde and then harvested in SDS lysis buffer. After sonication and centrifugation, lysates containing soluble chromatin were incubated overnight with 5 µg of anti-FOXO3a antibody. DNA–protein immunocomplexes were collected with protein A-agarose beads, and then the crosslinks were reversed by incubation with sodium chloride (final concentration of 0.2 m) at 65 °C for 4 h. Two microliters of proteinase K (10 mg mL−1) were added to the samples and incubated for 1 h at 45 °C. DNA samples were then purified with phenol/chloroform extraction and precipitated with ethanol. Murine p27kip1 promoter region was amplified using the following primers: mp27-PF: 5’-acacacacatcctggcaaag-3’; mp27-PR: 5’-agtgtcccaaagaagcatgg-3’.

Apoptosis measurement

SIRT2 overexpressing or knock-down NIH3T3 cells were treated with up to 1000 µm of H2O2 for 16 h in 96-well plates. Cells in each well were then stained with 20 µL CellTiter-Blue reagent (Promega, Madison, WI, USA) in 100 µL fresh medium. After incubation for 3 h, fluorescence produced by living cells was measured using a SPECTRAmax GEMINI XS spectrofluorometer (Molecular Devices, Sunnyvale, CA, USA). Annexin V and 7-AAD labeling of cells was performed using the Annexin V-PE Apoptosis Detection Kit I (BD Pharmingen) according to manufacturer's instructions, followed by flow cytometry analysis. The results are presented as means ± SD of three independent experiments.

Statistical analysis

The quantitative analysis of the Northern and Western images was performed using ImageQuant (GE Healthcare, Piscataway, NJ, USA). The Statistical significance was determined by the Student's t-test. Differences between groups were considered statistically significant if P < 0.05.

Acknowledgments

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References

This work was supported by a US Department of Agriculture grant (6250-51000-040) to Q. T. We would like to thank Dr. Mickey C.-T. Hu and Mien-Chie Hung for providing the FOXO3a constructs.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References
  • Accili D, Arden KC (2004) FoxOs at the crossroads of cellular metabolism, differentiation, and transformation. Cell 117, 421426.
  • Anderson MJ, Viars CS, Czekay S, Cavenee WK, Arden KC (1998) Cloning and characterization of three human forkhead genes that comprise an FKHR-like gene subfamily. Genomics 47, 187199.
  • Bluher M, Kahn BB, Kahn CR (2003) Extended longevity in mice lacking the insulin receptor in adipose tissue. Science 299, 572574.
  • Borra MT, O’Neill FJ, Jackson MD, Marshall B, Verdin E, Foltz KR, Denu JM (2002) Conserved enzymatic production and biological effect of O-acetyl-ADP-ribose by silent information regulator 2-like NAD+dependent deacetylases. J. Biol. Chem. 277, 1263212641.
  • Brunet A, Sweeney LB, Sturgill JF, Chua KF, Greer PL, Lin Y, Tran H, Ross SE, Mostoslavsky R, Cohen HY, Hu LS, Cheng H-L, Jedrychowski MP, Gygi SP, Sinclair DA, Alt FW, Greenberg ME (2004) Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science 303, 20112015.
  • Burgering BM, Kops GJ (2002) Cell cycle and death control: long live Forkheads. Trends Biochem. Sci. 27, 352360.
  • Chen D, Steele AD, Lindquist S, Guarente L (2005) Increase in activity during calorie restriction requires Sirt1. Science 310, 1641.
  • Cohen HY, Miller C, Bitterman KJ, Wall NR, Hekking B, Kessler B, Howitz KT, Gorospe M, De Cabo R, Sinclair DA (2004) Calorie restriction promotes mammalian cell survival by inducing the SIRT1 deacetylase. Science 305, 390392.
  • Daitoku H, Hatta M, Matsuzaki H, Aratani S, Ohshima T, Miyagishi M, Nakajima T, Fukamizu A (2004) Silent information regulator 2 potentiates Foxo1-mediated transcription through its deacetylase activity. Proc. Natl Acad. Sci. USA 101, 1004210047.
  • Dijkers PF, Medema RH, Lammers JW, Koenderman L, Coffer PJ (2000) Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription factor FKHR-L1. Curr. Biol. 10, 12011204.
  • Dryden SC, Nahhas FA, Nowak JE, Goustin AS, Tainsky MA (2003) Role for human SIRT2 NAD-dependent deacetylase activity in control of mitotic exit in the cell cycle. Mol. Cell. Biol. 23, 31733185.
  • Finnin MS, Donigian JR, Pavletich NP (2001) Structure of the histone deacetylase SIRT2. Nat. Struct. Biol. 8, 621625.
  • Furuyama T, Nakazawa T, Nakano I, Mori N (2000) Identification of the differential distribution patterns of mRNAs and consensus binding sequences for mouse DAF-16 homologues. Biochem. J. 349, 629634.
  • Grubisha O, Rafty LA, Takanishi CL, Xu X, Tong L, Perraud AL, Scharenberg AM, Denu JM (2006) Metabolite of SIR2 reaction modulates TRPM2 ion channel. J. Biol. Chem. 281, 1405714065.
  • Hiratsuka M, Inoue T, Toda T, Kimura N, Shirayoshi Y, Kamitani H, Watanabe T, Ohama E, Tahimic CG, Kurimasa A, Oshimura M (2003) Proteomics-based identification of differentially expressed genes in human gliomas: down-regulation of SIRT2 gene. Biochem. Biophys. Res. Commun. 309, 558566.
  • Van Der Horst A, De Vries-Smits AM, Brenkman AB, Van Triest MH, Van Den Broek N, Colland F, Maurice MM, Burgering BM (2006) FOXO4 transcriptional activity is regulated by monoubiquitination and USP7/HAUSP. Nat. Cell Biol. 8, 10641073.
  • Van Der Horst A, Tertoolen LG, De Vries-Smits LM, Frye RA, Medema RH, Burgering BM (2004) FOXO4 is acetylated upon peroxide stress and deacetylated by the longevity protein hSir2 (SIRT1). J. Biol. Chem. 279, 2887328879.
  • Imai S, Armstrong CM, Kaeberlein M, Guarente L (2000) Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403, 795800.
  • Kim HS, Skurk C, Maatz H, Shiojima I, Ivashchenko Y, Yoon SW, Park YB, Walsh K (2005) Akt/FOXO3a signaling modulates the endothelial stress response through regulation of heat shock protein 70 expression. FASEB J. 19, 10421044.
  • Kops GJ, Dansen TB, Polderman PE, Saarloos I, Wirtz KW, Coffer PJ, Huang TT, Bos JL, Medema RH, Burgering BM (2002) Forkhead transcription factor FOXO3a protects quiescent cells from oxidative stress. Nature 419, 316321.
  • Lamming DW, Latorre-Esteves M, Medvedik O, Wong SN, Tsang FA, Wang C, Lin SJ, Sinclair DA (2005) HST2 mediates SIR2-independent life-span extension by calorie restriction. Science 309, 18611864.
  • Landry J, Sutton A, Tafrov ST, Heller RC, Stebbins J, Pillus L, Sternglanz R (2000) The silencing protein SIR2 and its homologs are NAD-dependent protein deacetylases. Proc. Natl Acad. Sci. USA 97, 58075811.
  • Langley E, Pearson M, Faretta M, Bauer UM, Frye RA, Minucci S, Pelicci PG, Kouzarides T (2002) Human SIR2 deacetylates p53 and antagonizes PML/p53-induced cellular senescence. EMBO J. 21, 23832396.
  • Lehtinen MK, Yuan Z, Boag PR, Yang Y, Villen J, Becker EB, DiBacco S, De La Iglesia N, Gygi S, Blackwell TK, Bonni A (2006) A conserved MST-FOXO signaling pathway mediates oxidative-stress responses and extends life span. Cell 125, 9871001.
  • Libina N, Berman JR, Kenyon C (2003) Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell 115, 489502.
  • Lin SJ, Defossez PA, Guarente L (2000) Requirement of NAD and SIR2 for life-span extension by calorie restriction in Saccharomyces cerevisiae. Science 289, 21262128.
  • Lin K, Hsin H, Libina N, Kenyon C (2001) Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat. Genet. 28, 139145.
  • Luo J, Nikolaev AY, Imai S, Chen D, Su F, Shiloh A, Guarente L, Gu W (2001) Negative control of p53 by Sir2α promotes cell survival under stress. Cell 107, 137148.
  • Makarova O, Kamberov E, Margolis B (2000) Generation of deletion and point mutations with one primer in a single cloning step. Biotechniques 29, 970972.
  • Motta MC, Divecha N, Lemieux M, Kamel C, Chen D, Gu W, Bultsma Y, McBurney M, Guarente L (2004) Mammalian SIRT1 represses forkhead transcription factors. Cell 116, 551563.
  • Nemoto S, Finkel T (2002) Redox regulation of forkhead proteins through a p66shc-dependent signaling pathway. Science 295, 24502452.
  • North BJ, Marshall BL, Borra MT, Denu JM, Verdin E (2003) The human Sir2 ortholog, SIRT2, is an NAD+dependent tubulin deacetylase. Mol. Cell 11, 437444.
  • Pear WS, Nolan GP, Scott ML, Baltimore D (1993) Production of high-titer helper-free retroviruses by transient transfection. Proc. Natl Acad. Sci. USA 90, 83928396.
  • Perrod S, Cockell MM, Laroche T, Renauld H, Ducrest AL, Bonnard C, Gasser SM (2001) A cytosolic NAD-dependent deacetylase, Hst2p, can modulate nucleolar and telomeric silencing in yeast. EMBO J. 20, 197209.
  • Qin XF, An DS, Chen IS, Baltimore D (2003) Inhibiting HIV-1 infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5. Proc. Natl Acad. Sci. USA 100, 183188.
  • Rodgers JT, Lerin C, Haas W, Gygi SP, Spiegelman BM, Puigserver P (2005) Nutrient control of glucose homeostasis through a complex of PGC-1α and SIRT1. Nature 434, 113118.
  • Rogina B, Helfand SL (2004) Sir2 mediates longevity in the fly through a pathway related to calorie restriction. Proc. Natl Acad. Sci. USA 101, 1599816003.
  • Shi T, Wang F, Stieren E, Tong Q (2005) SIRT3, a mitochondrial sirtuin deacetylase, regulates mitochondrial function and thermogenesis in brown adipocytes. J. Biol. Chem. 280, 1356013567.
  • Smith JS, Brachmann CB, Celic I, Kenna MA, Muhammad S, Starai VJ, Avalos JL, Escalante-Semerena JC, Grubmeyer C, Wolberger C, Boeke JD (2000) A phylogenetically conserved NAD+dependent protein deacetylase activity in the Sir2 protein family. Proc. Natl Acad. Sci. USA 97, 66586663.
  • Strasser A, Puthalakath H, Bouillet P, Huang DCS, O’connor L, O’reilly LA, Cullen L, Cory S, Adams JM (2000) The role of Bim, a proapoptotic BH3-only member of the Bcl-2 family, in cell-death control. Ann. N. Y. Acad. Sci. 917, 541548.
  • Tanno M, Sakamoto J, Miura T, Shimamoto K, Horio Y (2007) Nucleocytoplasmic shuttling of the NAD+dependent histone deacetylase SIRT1. J. Biol. Chem. 282, 68236832.
  • Tran H, Brunet A, Grenier JM, Datta SR, Fornace AJ, Jr, DiStefano PS, Chiang LW, Greenberg ME (2002) DNA repair pathway stimulated by the forkhead transcription factor FOXO3a through the Gadd45 protein. Science 296, 530534.
  • Van Der Heide LP, Hoekman MF, Smidt MP (2004) The ins and outs of FoxO shuttling: mechanisms of FoxO translocation and transcriptional regulation. Biochem. J. 380, 297309.
  • Vaquero A, Scher MB, Lee DH, Sutton A, Cheng HL, Alt FW, Serrano L, Sternglanz R, Reinberg D (2006) SirT2 is a histone deacetylase with preference for histone H4 Lys 16 during mitosis. Genes Dev. 20, 12561261.
  • Vaziri H, Dessain SK, Ng Eaton E, Imai SI, Frye RA, Pandita TK, Guarente L, Weinberg RA (2001) hSIR2(SIRT1) functions as an NAD-dependent p53 deacetylase. Cell 107, 149159.
  • Weindruch R, Walford RL (1988) The Redardation of Aging and Disease by Dietary Restriction, Springfield, IL: Thomas.
  • Yang YH, Chen YH, Zhang CY, Nimmakayalu MA, Ward DC, Weissman S (2000) Cloning and characterization of two mouse genes with homology to the yeast Sir2 gene. Genomics 69, 355369.
  • Yang Y, Hou H, Haller EM, Nicosia SV, Bai W (2005) Suppression of FOXO1 activity by FHL2 through SIRT1-mediated deacetylation. EMBO J. 24, 10211032.
  • Yeung F, Hoberg JE, Ramsey CS, Keller MD, Jones DR, Frye RA, Mayo MW (2004) Modulation of NF-κB-dependent transcription and cell survival by the SIRT1 deacetylase. EMBO J. 23, 23692380.
  • You H, Jang Y, You-Ten AI, Okada H, Liepa J, Wakeham A, Zaugg K, Mak TW (2004) p53-dependent inhibition of FKHRL1 in response to DNA damage through protein kinase SGK1. Proc. Natl Acad. Sci. USA 101, 1405714062.
  • Yu SW, Wang H, Poitras MF, Coombs C, Bowers WJ, Federoff HJ, Poirier GG, Dawson TM, Dawson VL (2002) Mediation of poly (ADP-ribose) polymerase-1-dependent cell death by apoptosis-inducing factor. Science 297, 259263.