Interleukin-1β and microRNA-146a in an immature rat model and children with mesial temporal lobe epilepsy

Authors


Address correspondence to Fei Yin, Department of Pediatrics, Xiangya Hospital of Central South University, No. 87 Xiangya Road, Changsha, Hunan 410008, China. E-mail: yf_2323@yahoo.com

Summary

Purpose:  Increasing evidence indicates that neuroinflammation plays a critical role in the pathogenesis of mesial temporal lobe epilepsy (MTLE). The aim of this study was to investigate the dynamic expression of interleukin (IL)–1β as a proinflammatory cytokine and microRNA (miR)-146a as a posttranscriptional inflammation-associated microRNA (miRNA) in the hippocampi of an immature rat model and children with MTLE.

Methods:  To study the expression of IL-1β and miR-146a, we performed a reverse transcription polymerase chain reaction, Western blot, and real-time quantitative PCR on the hippocampi of immature rats at 11 days of age. Expression was monitored in the acute, latent, and chronic stages of disease (2 h and 3 and 8 weeks after induction of lithium-pilocarpine status epilepticus, respectively), and in control hippocampal tissues corresponding to the same timeframes. Similar expression methods were applied to hippocampi obtained from children with MTLE and normal controls.

Key Findings:  The expression of IL-1β and miR-146a in both children and immature rats with MTLE differs according to the stage of MTLE development. Both IL-1β and miR-146a are significantly up-regulated, but in opposite ways: IL-1β expression is highest in the acute stage, when expression of miR-146a is at its lowest level; miR-146a expression is highest in the latent stage, when IL-1β expression is at its lowest level. Both IL-1β and miR-146a are up-regulated in the chronic stage, but not as much as in the other stages.

Significance:  Our study is the first to focus on the expression of miR-146a in the immature rat model of lithium-pilocarpine MTLE and in children with MTLE. We have detected that the expression of proinflammatory cytokine IL-1β and posttranscriptional inflammation-associated miR-146a is variable depending on the disease stage. Furthermore, both IL-1β and miR-146a are up-regulated in immature rats and children with MTLE. Our findings elucidate the role of inflammation in the pathogenesis of MTLE in the immature rat model and children. Therefore, modulation of the IL-1β–miR-146a axis may be a novel therapeutic target in the treatment of MTLE.

Seizure is the most common pediatric neurologic disorder, with 4–10% of children having at least one attack of seizure in the first 16 years of life (Friedman & Ghazala, 2006). Despite currently available antiepileptic drugs, 20–40% of all patients with epilepsy remain refractory to medical management (Engel, 1998; Mohanraj & Brodie, 2006; Stephen et al., 2006). Mesial temporal lobe epilepsy (MTLE) is one of the most common and intractable forms of seizure disorder. It usually begins in childhood and is often associated with a history of prolonged or complex (and possibly simple) febrile seizures (Annegers et al., 1987; Berg & Shinnar, 1996). Epilepsy in children is different from that in adults (Spencer & Huh, 2008). It has been well established that the brain is more susceptible to seizure early in life, and that seizures in the immature brain are likely to be dependent on different mechanisms than those in the adult brain (Coppola & Moshe, 2009; Wahab et al., 2011). Epilepsy in early childhood is often difficult to treat, which may be due to physiologic immaturities in ion homeostasis and other developmental characteristics (Sheizaf et al., 2007; Usta et al., 2007).

Increasing evidence highlights the activation of inflammatory pathways in temporal lobe epilepsy (TLE) and suggests that a persistent up-regulation of inflammatory gene expression may contribute to the etiopathogenesis of TLE (Vezzani & Granata, 2005; Vezzani et al., 2008). The proinflammatory cytokine interleukin (IL)–1β is thought to play a key role in the development of seizures and epilepsy (Vezzani & Baram, 2007). Many recent studies have shown increased expression of IL-1β after experimental seizures and epilepsy (Rijkers et al., 2009; Akin et al., 2011; Järvelä et al., 2011; Pernot et al., 2011; Vezzani et al., 2011). Seizure-induced IL-1β is found predominantly in brain structures with the most severe seizure-induced neuronal damage (Vezzani et al., 1999; Eriksson et al., 2000; Rizzi et al., 2003; Marini et al., 2004; Ravizza et al., 2005). It is notable that the intracerebral injection of IL-1 receptor antagonist (IL-1Ra) has powerful anticonvulsant effects (Vezzani et al., 2002). Recent findings suggest that targeting proinflammatory events with antiinflammatory therapy could be effective in controlling drug-resistant pediatric seizures by improving the integrity of the blood–brain barrier (BBB) and blocking the epileptogenic process (Marchi et al., 2011; Abraham et al., 2012). A number of posttranscriptional inflammation-associated microRNAs (miRNAs), such as brain-enriched miR-146a, have been strongly implicated in the regulation of innate immune, viral, and inflammatory responses (Lukiw & Pogue, 2007; Nakasa et al., 2008; Sonkoly et al., 2008; Stanczyk et al., 2008; Keiichiro et al., 2009; Tang et al., 2009; Larner-Svensson et al., 2010; Li et al., 2011).

Typically, miRNAs are 18–24 nucleotide long, single-stranded molecules that suppress the expression of protein-coding genes at the posttranscriptional level by directing translational repression, mRNA destabilization, or a combination of the two (Bartel, 2009). Aronica et al. (2010) were the first to report the altered expression pattern of miR-146a, as shown in epileptic rats and adult patients with TLE, shedding new light on molecular mechanisms in the proepileptogenic inflammatory signaling processes. Other studies have examined the relationship between IL-1β and miR-146a in other systems, including alveolar cells (Perry et al., 2008), smooth muscle cells (Larner-Svensson et al., 2010), and pancreatic beta cells (Roggli et al., 2010).

In this study we aimed to detect the dynamic expression of IL-1β as a proinflammatory cytokine and miR-146a as a posttranscriptional inflammation-associated miRNA in the hippocampi of an immature rat model in the three stages of MTLE development (acute, latent, and chronic), and to confirm the results in the chronic stage by examining expression in the hippocampi of children with MTLE. This study provides new insight into the role of inflammation in the pathogenesis of MTLE development in an immature rat model and in children, and suggests that modulation of the IL-1β–miR-146a axis may be a novel therapeutic target in the treatment of MTLE.

Methods

Experimental animals

We started our experiment with 52 immature Sprague-Dawley rats of either sex at postnatal day 11 (PN11) from the Experimental Animal Center of Xiangya Medical College, Central South University. The animals were housed in a room with controlled temperature (20 ± 2°C) and humidity (50–60%) and were kept on an alternating 12-h light-dark cycle. Animals had free access to food and water. The 52 rats were randomly divided into two groups: experimental group E (n = 36) and control group C (n = 16). They were allowed to adapt to laboratory conditions for at least 1 week before starting the experiments. All procedures were approved by the Institutional Animal Care and Use Committee of Central South University.

Epilepsy induction

On PN11, the E rats (n = 36) were injected with lithium chloride (125 mg/kg, i.p.; Sigma-Aldrich Chemie, Deisenhofen, Germany) followed 18–20 h later by pilocarpine hydrochloride treatment (30 mg/kg, i.p.; Boehringer Mannheim, Indianapolis, IN, U.S.A.) to induce status epilepticus. Methylscopolamine (1 mg/kg, i.p.), a muscarinic antagonist that does not cross the BBB, was administered 15 min before pilocarpine treatment to reduce the peripheral effects of the convulsant and thus enhance survival. The severity of convulsions was evaluated by Racine’s classification (Racine, 1972). Only animals classified higher than stage 3 were used in this study. Status epilepticus was defined as seizure-like activity lasting at least 30 min. Intraperitoneal pilocarpine administration (10 mg/kg) was repeated every 30 min if there was no seizure attack or if seizure activities were classified lower than Racine’s stage 4. The maximum dose for pilocarpine injection was 60 mg/kg. Ninety minutes after the onset of status epilepticus, all status epilepticus rats were administered diazepam (10 mg/kg, i.p.; Sigma-Aldrich) to terminate the seizure activity. The C rats (n = 16) received an injection of the same amount of normal saline as a replacement for pilocarpine. Following pilocarpine treatment, the rats were video-monitored for 8 weeks (24 h/day), using an infrared ray monitor during periods of early monitoring. We observed spontaneous seizures occurring mainly around 3 weeks after status epilepticus. Chronic seizures occurred at 8 weeks post–pilocarpine administration with a frequency of 5–12 seizures in 24 h. The time between last spontaneous seizure and analysis was usually <24 h.

Based on the epilepsy development stages, the sample size was divided randomly into six groups: (1) acute control group, AC (control rats, 2 h after pilocarpine administration; n = 8); (2) acute seizure group, AS (induced rats, 2 h after pilocarpine administration; n = 8); (3) latent control group, LC (control rats, 3 weeks after pilocarpine administration; n = 8); (4) latent seizure group, LS (induced rats, 3 weeks after pilocarpine administration; n = 8); (5) chronic spontaneous seizure group, SS (induced rats that showed spontaneous seizures 8 weeks after pilocarpine administration; n = 8); and (6) chronic no spontaneous seizure group NSS (induced rats that did not show spontaneous seizures 8 weeks after pilocarpine administration; n = 8). The rats that failed to develop status epilepticus after pilocarpine treatment were euthanized and were rejected from the experiment.

MTLE children and controls

Specimens were obtained at surgery from five children undergoing unilateral selective amygdalohippocampectomy for drug-resistant MTLE with typical imaging features and pathologic confirmation of hippocampal sclerosis. The decision for surgery was based on convergent evidence of clinical and electroencephalography (EEG) recordings during prolonged video-EEG monitoring, high-resolution magnetic resonance imaging (MRI) indicating mesial temporal lobe seizure onset, and invasive electroencephalography recordings. Surgical specimens were examined by routine pathology. As control tissue, five normal hippocampal samples were obtained at autopsy from children (postmortem delay: max. 12 h) with no history of any brain disease. Neuropathologic studies confirmed that control tissues were normal. Clinical information on children with MTLE and controls is presented in Table 1. This study was approved by the Institutional Ethics Committee of Central South University and written informed consent was obtained from the parents of all patients before analysis.

Table 1.   Clinical characterization of MTLE children and controls
IDSexAge (years)Duration of epilepsy (years)Side of hippocampus sampleAntiepileptic drugs MTS Grading (Blümcke et al., 2007)
  1. E1-E5 represents 5 children with MTLE; C1-C5 represents 5 children without brain disease; CS, child seizure; CC, child control; L, Left; R, Right; CBZ, carbamazepine; LAM, lamotrigine; LEV, levetiracetam; OXC, oxcarbazepine; PB, phenobarbitone; PHT, phenytoin; VPA, valproate; TOP, topiramate; MTS, mesial temporal sclerosis.

Child seizure (CS)     
 E1F 85LPB, LAM, VPAMTS type 1b
 E2F 93RLEV, LAM, VPAMTS type 1a
 E3M106RCBZ, VPA, LEVMTS type 1b
 E4M103LCBZ, VPA, LAMMTS type 1a
 E5F125RCBZ, VPA, PHTMTS type 1b
IDSexAge (years)Postmortem interval (h)Side of hippocampus sampleCauses of death
Child control (CC)     
 C1F 810RFatal chest trauma
 C2M10 8RFatal abdominal trauma
 C3M1012LFatal chest trauma
 C4F1110LCardiomyopathy
 C5M1211RAcute pancreatitis

Rat tissue preparation for RNA isolation

The immature rats were sacrificed under deep anesthesia by intraperitoneal injection of chloral hydrate (10%, 5 ml/kg) at 2 h and 3 and 8 weeks after pilocarpine-induced status epilepticus. Rats were decapitated in the acute phase (2 h after status epilepticus; n = 8), latent period (3 weeks after status epilepticus, without any spontaneous seizures; n = 8), and in the chronic epileptic phase (8 weeks after status epilepticus; n = 8; only rats that exhibited daily seizures were included in this group). Control rats for the three subgroups were also included. After decapitation, the hippocampus was removed quickly using RNase-free instruments. All material was frozen on dry ice and stored at −80°C until use.

RNA isolation

For RNA isolation, frozen material was homogenized in 1 ml Trizol Reagent (Invitrogen, Carlsbad, CA, U.S.A.) for each 50 mg of hippocampal tissue. After adding 0.2 ml of chloroform, the aqueous phase was isolated using Phase Lock tubes (Eppendorf, Hamburg, Germany). RNA was precipitated with 0.5 ml isopropyl alcohol, washed twice with 75% ethanol, and dissolved in nuclease-free water. The concentration and purity of RNA were determined at 260/280 nm using a nanodrop spectrophotometer (Ocean Optics, Dunedin, FL, U.S.A.).

Protein extraction

A total of 30–80 mg of hippocampus was ground to powder in liquid nitrogen, dissolved in 400 ml lysis buffer (7 m urea, 2 m thiourea, 2% NP-40, 1% Triton X-100, 100 mm dithiothreitol (DTT), 5 mm phenylmethylsulfonyl fluroide (PMSF), 4% (3-[(3-Cholamidopropyl)dimethylammonio]-1 propanesulfonate) CHAPS, 0.5 mm ethylenediaminetetraacetic acid (EDTA), 40 mm Tris, 2% pharmalyte, 1 mg/ml DNase I, and 0.25 mg/ml RNase A), vortexed, and incubated (4°C, 60 min) Chemicals for protein extraction were obtained from Amresco (Solon, OH, U.S.A.). The mixture was centrifuged (12 000 g/min, 60 min, 4°C). The resulting supernatants, containing proteins, were then precipitated with acetone (1:4, overnight, −20°C, followed by centrifugation at 12 000 g, 10 min, at 4°C) for deionization. After removing residual acetone by air-drying, the protein pellets were redissolved with lysis buffer. After being centrifuged (12 000 g/min, 10 min, 4°C) again, the supernatant was the total protein solution. The concentration of the total proteins was determined by a 2D-Quant Kit (GE Healthcare, Piscataway, NJ, U.S.A.). Each sample was prepared individually.

IL-1β expression by reverse transcription polymerase chain reaction in the hippocampi of immature rats and children with MTLE

Total hippocampal RNA (1 μg) was reverse-transcribed using a RevertAid First Strand complementary DNA (cDNA) Synthesis Kit (Thermo Scientific’s Fermentas Molecular Biology Tools, Waltham, MA, U.S.A.) in the presence of oligo -(dT)- 18 primers Table 2. PCR was performed in a total volume of 25 μl using Taq PCR MasterMix (Qiagen, Valencia, CA, U.S.A.) according to the manufacturer’s instructions. The amplification products were visualized by electrophoresis at 90 V for 30 min in 1.5% (w/v) agarose gels and stained with ethidium bromide (0.5 μg/ml). The images were acquired by a gel image system (Tanon 1600; Tanon, Sanghai, China). Values were normalized to β- actin.

Table 2.   Primer sequences and PCR conditions
PrimerForwardReverseCondition
Rat IL-1βTGGCAGCTACCTATGTCTTGCCCACTTGTTGGCTTATGTTCTG94°C 4 min, 26 cycles of 94°C 30 s, 58°C 30 s, 72°C 30 s, 72°C 8 min
Human IL-1βAGTGGCAATGAGGATGACTTGTAGATGAAGGGAAAGAAGGTGCT94°C 4 min, 28 cycles of 94°C 30 s, 59°C 30 s, 72°C 30 s, 72°C 8 min
Rat β- actinGAGAGGGAAATCGTGCGTGACCATCTGCTGGAAGGTGGACA94°C 4 min, 25 cycles of 94°C 30 s, 60°C 30 s, 72°C 30 s, 72°C 8 min
Human β- actinCTGGGACGACATGGAGAAAAAAGGAAGGCTGGAAGAGTGC94°C 4min, 28 cycles of 94°C 30 s, 58°C 30 s, 72°C 30 s, 72°C 8 min

Detection of IL-1β expression by Western blot in the hippocampi of immature rats and children with MTLE

In total, 30 μg of total protein was run on a 12% sodium dodecyl sulfate–polyacrylamide (SDS-polyacrylamide) gel, and the polyvinylidene fluoride (PVDF) membranes were incubated overnight at 4°C with polyclonal antibodies against IL-1β (Novus Biologicals, Littleton, CO, U.S.A.) at 1:500 dilutions. This was subsequently incubated with horseradish peroxidase (HRP)-conjugated sheep anti-rabbit IgG (Amersham Biosciences, Piscataway, NJ, U.S.A.) at 1:5,000 dilutions. β-Actin was used as a loading control. The reactions were visualized using an enhanced chemiluminescence (ECL) detection system. Signals on the blots were visualized by autography. The film signals were digitally scanned and then quantified using FluorChem software (Alpha Innotech, San Leandro, CA, U.S.A.).

miR-146a expression by qPCR in the hippocampi of immature rats and children with MTLE

cDNA was generated using an Invitrogen miRNA reverse-transcription kit according to the manufacturer’s instructions. miR-146a and U6B small nuclear RNA gene (rnu6b) expression was analyzed using Invitrogen miRNA assays, which were run on the Applied Biosystems 7900HT (Foster City, CA, U.S.A.) according to the instructions and manufacturer set conditions. Data analysis was performed with the software provided by the manufacturer, using the 2-(ÄÄCt) method to determine the relative-quantitative level of miR-146a and expressed as a fold-difference to the relevant control. Values were normalized to the U6B small nuclear RNA gene (rnu6b).

Statistical analysis

All of the data are expressed as means ± standard deviation (SD). A Student’s t-test was performed to determine significant differences between two groups. One-way analysis of variance (ANOVA) followed by Student-Neuman-Keuls post hoc tests was utilized to determine significant differences among multiple groups. p < 0.05 was considered to be statistically significant.

Results

Behavior and seizures in an immature rat model

In each pilocarpine-treated animal, clinical signs of seizure activity were observed. All rats exhibited a well-defined pattern of behavior after pilocarpine treatment, such as akinesia, ataxic lurching, tremor, head bobbing, masticatory automatisms with myoclonus of facial muscles, and wet dog shakes at onset. Behavioral changes were consistent with the features of human MTLE.

Eighty-nine percent of all pilocarpine-induced rats (n = 32) progressed to status epilepticus with bilateral limb clonus, rearing, and falling after a 15–35 min injection of pilocarpine.

The acute seizure and acute control groups were sacrificed 2 h after status epilepticus. Spontaneous seizures occurred mainly 3 weeks after pilocarpine administration. Seizures were generally characterized by a focal onset (immobility, mechanical mutation, mouth clonus, forelimb clonus), occasionally culminating in a generalized convulsive stage, lasting about 30 s to 1.5 min. The latent seizure and latent control groups were sacrificed 3 weeks after status epilepticus.

Chronic seizures occurred 8 weeks after pilocarpine administration. At this time point, 50% of the remaining pilocarpine-induced rats manifested with chronic MTLE, experiencing seizures one to several times per day with symptoms as described above. These rats were considered the SS group. The remaining rats had no spontaneous seizures, and were considered the NSS group.

Dynamic expression pattern of IL-1β in immature rats

RT-PCR results showed significant up-regulation of IL-1β mRNA expression in all hippocampal tissues in both the acute and chronic stages (p < 0.05) of MTLE development in the immature rat model, whereas the control group had greater up-regulation in the acute stage. In the latent stage, IL-1β mRNA expression was almost equal to expression values in the control group. In immature rat tissues, IL-1β expression was normalized to that of β-actin (Fig. 1A,B). We confirmed our results by detecting IL-1β protein expression by Western blot (WB), which showed the same dynamic changes as IL-1β mRNA (Fig. 1C). The comparison of IL-1β mRNA expression means in the MTLE immature rat models and control groups in the three stages are shown in Table 3.

Figure 1.


IL-1β dynamic expression patterns in the three stages of MTLE development in an immature rat model. (A) Gray value rate of IL-1β and β-actin expressions in the three stages of MTLE development compared with control groups. (B) Significant up-regulation occurred in the acute and chronic stages, with higher expression in the acute stage. In the latent stage of MTLE, expression was nearly equal to the control group (n = 8/group). *p < 0.05. (C) IL-1β and β-actin protein expression in the three stages of MTLE development compared with control groups. (AC, acute control; AS, acute seizure; LC, latent control; LS, latent seizure; NSS, no spontaneous seizure; SS, spontaneous seizure).

Table 3.   Expression means of IL-1β in the three stages of MTLE development in an immature rat model and controls
Diseases stageMTLEControl
Acute stage0.36 ± 0.010.11 ± 0.01
Latent stage0.27 ± 0.080.12 ± 0.02
Chronic stage0.096 ± 0.010.08 ± 0.02

IL-1β expression in children with MTLE

RT-PCR results showed significantly higher expression of IL-1β mRNA in the hippocampal tissues of children with MTLE than controls (patients, mean ± SD 0.48 ± 0.084; controls, mean ± SD 0.25 ± 0.088 p < 0.05). This result was confirmed by detecting the expression of IL-1β protein by WB, which also showed higher expression in the patients’ tissues compared to the control group. In the children’ tissues, IL-1β expressions was normalized to that of β-actin (Fig. 2A–C).

Figure 2.


IL-1β expression in hippocampal tissues obtained from MTLE children and normal controls. (A) Gray value rate of IL-1β and β-actin expression in children with MTLE compared to normal controls. (B) Significant up-regulation occurred in the MTLE children compared to normal controls. (n = 5/group). *p < 0.05 (C) IL-1β and β-actin protein expression in children with MTLE compared to normal controls. (CC, child control; CS, child seizure).

Dynamic relative expression pattern of miR-146a in immature rats

Quantitative PCR (qPCR) results showed significant up-regulation of miR-146a expression in all hippocampal tissues in the latent and chronic stages of MTLE development in the immature rat model. Expression was higher in the latent stage, with a mean of 2.8 ± 0.2 compared to the control group mean of 1 ± 0.1 (p < 0.05), and a mean of 1.8 ± 0.2 in the chronic stage compared to the control group mean of 1 ± 0.1 (p < 0.05). In the acute stage, miR-146a expression levels were no different between the epileptic and control groups. In rat tissues, miR-146a expression was normalized to that of the U6B small nuclear RNA gene (rnu6b) (Fig. 3).

Figure 3.


miR-146a relative dynamic expression in the three stages of MTLE development in an immature rat model. Significant up-regulation occurred in the latent and chronic stages, with higher expression in the latent stage. In the acute stage, there was no difference in expression between the epileptic and control groups. (n = 8/group) *p < 0.05 (AC, acute control; AS, acute seizure; LC, latent control; LS, latent seizure; NSS, no spontaneous seizure; SS, spontaneous seizure).

Relative expression of miR-146a in children with MTLE

qPCR results showed significantly higher expression of miR-146a in the hippocampal tissue of children with MTLE compared to tissue from the control group, with a mean of 3 ± 0.2 compared to the control group mean of 1 ± 0.2 (p < 0.05). In the tissues obtained from children, miR-146a expression was normalized to that of the U6B small nuclear RNA gene (rnu6b) (Fig. 4).

Figure 4.


Relative expression of miR-146a in the hippocampal tissues obtained from MTLE children and normal controls. Significant up-regulation occurred in the MTLE children compared to normal controls. (n = 5/group). *p < 0.05 (CC, child control; CS, child seizure).

The dynamic expression pattern of IL-1β and miR-146a in the three stages of MTLE development in the hippocampi of immature rats

IL-1β showed its highest expression in the acute stage, whereas miR-146a expression levels were no different from the expression levels of controls. Meanwhile, miR-146a showed its highest expression in the latent stage, whereas IL-1β had its lowest expression in that stage, nearly similar to the expression levels of the controls. In the chronic stage, miR-146a was still significantly up-regulated, as was the expression of IL-1β, through lower expression levels than in the acute stage (Fig. 5A,B).

Figure 5.


Dynamic expression patterns of the IL-1β and miR-146a in the three stages of MTLE development. (A,B) In the acute stage, IL-1β showed its highest expression when miR-146a was at its lowest level. In the latent stage, miR-146a showed its highest expression when IL-1β was at its lowest level. In the chronic stage, both were up-regulated. (AS, acute seizure; LS, latent seizure; SS, spontaneous seizure).

Discussion

Despite extensive research, the mechanism for the cause and progression of epilepsy is still unknown (Koh, 2009).

Pharmacologic findings suggest that brain inflammation in epilepsy contributes to seizures (Hulkkonen et al., 2004; Iyer et al., 2010). This concept is further supported by the fact that both experimental and clinical studies show that various mediators of inflammation are present in the brain, cerebrospinal fluid (CSF), and blood in epileptic conditions (Peltola et al., 2000, 2002; Hulkkonen et al., 2004). Stéphane et al. (2010) reported that there are accumulating data showing that inflammation worsens the consequences of epilepsy models in both mature and immature brains.

Understanding the mechanisms by which early life epilepsy develops would permit the design of selective, preventative, or interventional strategies. In our previous work (Damaye et al., 2011; Wu et al., 2011), we found that lithium-pilocarpine caused hippocampal pathology in an immature rat model. To uncover whether neuroinflammation enhances epileptogenesis in the immature brain, we started our experiment with immature rats on PN11, which corresponds to the same term in the human brain (Vannucci et al., 1999), and used human tissues from children surgically treated for drug-resistant MTLE. We focused on the dynamic expression pattern of IL-1β as a proinflammatory cytokine and miR-146a as an inflammation-associated miRNA in the three stages of MTLE development in the immature rat model, and we confirmed our results by detecting their expression in children with MTLE, which is equal to the chronic stage in the animal model.

Our results revealed an up-regulation of both IL-1β and miR-146a expression levels associated with seizures, supporting the hypothesis that IL-1β and miR-146a are mediators of inflammation, which facilitates the epileptic process. Although our experiments show a fluctuating pattern with IL-1β mRNA and protein expression, its chronic expression in the immature rat model and in children supports the idea that this proinflammatory cytokine plays a role in the process of seizure generation, rather than being merely a biochemical epiphenomenon of seizures.

The first evidence of an active role for IL-1β in seizures was provided by Vezzani et al. (1999, 2000), and showed that the intracerebral application of IL-1β increases seizure activity. Ravizza et al. (2006) later showed that seizures are dramatically reduced when endogenous IL-1β synthesis is blocked by inhibiting interleukin-1 converting enzyme (ICE) or in mice with a null mutation of ICE.

We also showed that the expression of IL-1β and miR-146a differs according to the stage of MTLE development in the immature rat model. Both IL-1β and miR-146a are significantly up-regulated in children and seem to be regulated in opposite ways: IL-1β expression was highest in the acute stage, when expression of miR-146a was at its lowest level; miR-146a expression was highest in the latent stage, when IL-1β expression was at its lowest level. Both IL-1β and miR-146a are up-regulated in the chronic stage, when compared to their expression levels in control groups, and the same is true in children with MTLE at the same stage, when compared with controls.

We therefore agree with other studies that found the seizure-induced peak in IL-1β expression to occur in the acute stage of epilepsy (Eriksson et al., 2000; Voutsinos-Porche et al., 2004). In PN15 rats, Ravizza et al. (2005) also found that IL-1β was significantly induced in the acute stage 4 h after status epilepticus. This observation can be explained by the fact that neuronal injury leads to rapid production of IL-1β (Allan et al., 2005). Immediate seizure-induced IL-1β expression has been described in several animal models for seizures and epilepsy, and is believed to stem from seizure-induced opening of the BBB, which allows circulating proteins to enter (Van Vliet et al., 2007). IL-1β–expressing leukocytes appear to enter the central nervous system (CNS) after seizure-induced changes in the expression of vascular cell adhesion molecules (Fabene et al., 2008), which would explain why IL-1β levels were also significantly higher in the hippocampi of rats that became epileptic after febrile status epilepticus (Heida & Pittman, 2005).

In the latent stage, IL-1β expression decreased to a level similar to that in the control group. This result is supported by findings that show no up-regulation of IL-1β in the latent period after pilocarpine-induced status epilepticus (Rijkers et al., 2009). This significant decrease in IL-1β expression and its association with the highest level of miR-146a expression in this animal model support the hypothesis that miR-146a may represent an attempt to modulate the inflammatory response triggered by IL-1β by decreasing its expression level. Further studies are required to investigate the direct relationship between these two markers in this animal model.

We observed a chronic IL-1β expression similar to what has been described in other studies (De Simoni et al., 2000; Chapman et al., 2006). We found an up-regulation of IL-1β in children with MTLE and immature rats in the chronic stage, as compared with the normal control group. Ravizza et al. (2008) reported that specimens from adult patients with TLE showed increased production of IL-1β. This increase in IL-1β expression was associated with the onset of chronic spontaneous seizures. This finding, as well as the absence of seizure activity in the latent stage, supports the idea of a role for this proinflammatory cytokine in the process of seizure generation.

miR-146a was up-regulated during epileptogenesis and in the chronic epileptic stage in the immature rat model of MTLE, and also in children. Many researchers have suggested a link between miR-146a and human inflammatory diseases (Taganov et al., 2006; Pedersen & David, 2008; Sheedy & O’Neill, 2008). The involvement of miR-146a in the regulation of inflammatory/innate immune pathways suggests that its overexpression or underexpression may contribute to inflammatory diseases (Sonkoly & Pivarcsi, 2009). Aronica et al. (2010) was the first to report an altered expression pattern of miR-146a in epileptic rats and temporal lobe epilepsy patients, and showed up-regulation of miR-146a in the latent and chronic stages of disease in the rat model and in human tissues. Our study is the first to focus on the expression of miR-146a in the immature rat model of lithium-pilocarpine MTLE and in children with MTLE. Hu et al. (2011) studied the expression profile of miRNAs in rat hippocampus following lithium-pilocarpine–induced status epilepticus and did not report any difference in the expression pattern of miR-146a in the acute stage between the epilepsy model and control, which coincides with our findings in this study.

The prominent expression of miR-146a in the latent stage after 3 weeks of status epilepticus induction corresponds to the time of maximal astroglial and microglial activation and up-regulation of several other genes involved in the immune response (Aronica et al., 2000, 2001; Hendriksen et al., 2001; Gorter et al., 2006). In association with our results, Song et al. (2011) showed significant up-regulation of miR-146a as one of the 18 up-regulated miRNAs in the hippocampus of chronic TLE rats, suggesting that it may play a potential role in TLE pathogenesis. The chronic expression of miR-146a in the immature rat model and in children with MTLE supports the role of this posttranscriptional inflammation-associated miRNA in the process of MTLE development.

In conclusion, to address the effect of inflammation on epileptogenesis in the developing brain, we examined the dynamic expression pattern of IL-1β as a proinflammatory cytokine and miR-146a as a posttranscriptional inflammation–associated miRNA, in both immature rats and children with MTLE. Our observations demonstrated up-regulation of both IL-1β and miR-146a associated with seizures and changing with disease stage. The different expression patterns of both IL-1β and miR-146a at different stages suggest an interactive relationship. We are the first to examine the expression of miR-146a in the immature brain of this animal model and in children with MTLE. Our findings support the role of inflammation in the pathogenesis of MTLE development and, consequently, modulation of the IL-1β–miR-146a axis may be a new target for antiepileptic therapy.

Acknowledgments

This work was kindly supported by the National Natural Science Foundation of China (NO. 30872790, 30901631, 81171226, 81100846) and, the Scientific and Technological Department of Hunan Province (2011FJ3163). Additional support was received from the Ph.D. Programs Foundation of the Ministry of Education of China (20090162110041). We are most grateful to Dr. Zhiquan Yang (Department of Neurosurgery, Xiangya Hospital, China) for providing child epilepsy and control tissues and Dr. Dalia Elimam (Department of Pediatrics, Suez Canal University, Egypt) for critically reviewing the manuscript. All coauthors have been substantively involved in the study and/or the preparation of the manuscript. There are no undisclosed groups or persons who have had a primary role in the study and/or in manuscript preparation and all co-authors have seen and approved the submitted version of the paper and accept responsibility for its content.

Disclosure

None of the authors has any conflict of interest to disclose. We also confirm that we have read the Journal’s position on issues involved in ethical publication and affirm that this report is consistent with those guidelines.

Ancillary