SEARCH

SEARCH BY CITATION

Keywords:

  • PVRL1;
  • cleft lip with or without cleft palate;
  • Italian population

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Nonsyndromic cleft lip with or without cleft palate (CL/P) is a complex genetic trait and little is known about its aetiology. Recent investigations on rare clefting syndromes provided interesting clues about genes involved in face development. The PVRL1 gene encodes nectin1, a cell-to-cell adhesion molecule. Mutations in its sequence have been shown to cause the rare autosomal recessive syndrome CL/P-ectodermal dysplasia syndrome (CLPED1), while heterozygosity for the mutation W185X seemed to increase the risk of non syndromic CL/P in a population from northern Venezuela. In the present study, we screened 143 Italian CL/P patients for mutations in PVRL1. Three rare sequence variants in exon 3 that create amino-acid changes were detected in a total of 7 patients. Two of these mutations were not found in a panel of 292 unaffected controls, while the third was found in two controls. This study describes new mutations that may represent genetic risk factors for CL/P. Even though a study to look at the effects of the mutations on nectin1 function was not feasible, supporting evidence was reported, thus confirming the involvement of PVRL1 in the aetiology of non-syndromic CL/P malformation.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Clefts of the lip and palate are common craniofacial anomalies, requiring complex multidisciplinary treatment and having lifelong implications for affected individuals. Their incidence is in the range of 1/700–1/1,000 among Caucasians (Fraser, 1970; Bonaiti et al. 1982). The aetiology of both cleft lip with or without cleft palate (CL/P) and isolated cleft palate (CP) is thought to be multifactorial, with both genetic and environmental factors playing a role. Approximately 70% of CL/P cases are non-syndromic, occurring as an isolated condition not associated with any other recognizable anomalies, while the remaining 30% are syndromic cases and present deficits or structural abnormalities occurring outside the region of the cleft (Jones, 1988; Schutte & Murray, 1999). Recently, characterization of the underlying gene defects associated with important Mendelian clefting syndromes has resulted in the identification of the interferon regulatory factor-6 gene (IRF6) as the cause of Van der Woude syndrome (Kondo et al. 2002) and the poliovirus receptor related-1 gene (PVRL1) as being responsible for the autosomal recessive syndrome cleft lip/palate-ectodermal dysplasia (CLPED1; MIM 225060) (Suzuki et al. 2000). PVRL1 encodes nectin1, a cell-to-cell adhesion molecule. Three different PVRL1 mutations, all causing loss of function, have been shown to cause CLPED1 (Sozen et al. 2001). Specifically, a nonsense mutation of codon Trp185 (TGG->TAG) has been identified in Margarita Island CLPED1 patients, while a single-base deletion involving the same nucleotide (TGG->T-G), and resulting in a frame-shift, has been seen in an Israeli family. In a Brazilian family a single-base duplication of codon Gly323 (GGT->GGTT), again resulting in a frame shift, has been identified (Suzuki et al. 2000).

Of interest is the observation that heterozygosity of the common PVRL1 nonsense mutation W185X is a genetic risk factor for non-syndromic CL/P in northern Venezuela (Sozen et al. 2001). Conversely, we found that the W185X mutation is not frequent in Italy, and thus does not constitute a risk factor for non-syndromic CL/P in this population (Scapoli et al. 2004). These data reflect the complex aetiology of the CL/P malformation, which may involve different genetic and environmental factors in various distinct populations. The aim of the present investigation was to verify whether other mutations in the PVRL1 protein, besides W185X, could be detected in our study sample composed of Italian non-syndromic CL/P patients.

Materials and Methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Patient Collection and DNA Extraction

Seventy-one unrelated CL/P patients with a positive family history of the disease, 72 sporadic CL/P cases, and 292 unrelated unaffected individuals were enrolled in this study. All the patients were non-syndromic as clefting was not associated with other clinical characteristics. A venous blood sample was collected from each informed and consenting subject. DNA extraction was performed following Higuchi's protocol (Higuchi, 1989).

Mutation Screening

The six coding exons of the PVRL1 gene were investigated by PCR-SSCP, using pairs of primers designed to obtain PCR products of about 200 bp (Table 1). Each PCR reaction was performed in a 12.5 μl volume containing: 1.25 μl of 10X buffer provided with Taq polymerase (RedTaq, SIGMA), 0.2 mM of each dNTP, 5 pmol of each primer, 100 ng of genomic DNA and 0.5U of Taq, using a Hybaid Express thermocycler. The cycling conditions were: 94°C 30s, 57°C 30s, 72°C 30s, 35 cycles. SSCP analysis was run on 8% non-denaturant polyacrylamide gels for 16 hours at 35 Watts in a cold room (Nataraj et al. 1999). DNA fragments were visualized by silver staining.

Table 1.  Summary of primers used in PCR-SSCP. Exons 2, 3, and 6 were partitioned in different overlapping segments.
Exonic fragmentLength in bpPrimers sequence 5′->3′Annealing Temp.
1182ATCTTCCGGGCTGGTTTCT60°C
 GGTGGGGACAGCAGAGGT 
2a178ACCACTTGCTGCCATCCT57°C
 TTCTGCTTGGAGCCATTG 
2b180TGAAGATCACCCAGGTCACA57°C
 CCTCATCCTCCAGCTCCA 
2c165CTTCACCGATGGCACTATCC57°C
 ACAGGCCTCTGGATGAACAG 
3a199AACAGGGCTAGTCCCATCAC57°C
 TCCTGGTACTCTGCCTCACC 
3b201TCCTGGGAAACTCGGTTAAA57°C
 CAGCCAGCCCTGCTCAC 
4195CCTACGCTGTGTCTCCCACT57°C
 GGAGAGGCTGGGGAGGAT 
5210CCTACGCTGTGTCTCCCACT57°C
 GGAGAGGCTGGGGAGGAT 
6a198TCCCCTCCATCTCTTTTCCT57°C
 TGGTGCTGTAGTCACCCTTG 
6b220CATCCTGCTGGTGTTGATTG57°C
 ATAGCTGCTTCCACCCAGTG 
6c198CGACTCAGACGACGAGAAGA57°C
 AGAGTCCGGTCCCCGTAG 
6d194GCCCTACTTCACCGTGGAT57°C
 GGAGGAGCGGTCACAGAC 

Bands with aberrant electrophoresis migration were excised from the gel. Purified DNA was amplified by PCR and amplimers were sequenced using a standard protocol.

Fisher exact tests were used to compare the allele frequencies between cases and controls. Two-sided P values were calculated using the method of summing small P values.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

All 143 CL/P patients were screened for mutations in the PVRL1 gene. Seven were found to be heterozygous for non-synonymous mutations. All the mutations were identified in exon 3, and had not been previously described in or were they present in the NCBI SNP database. Specifically, R199Q (CGG->CAG) was found in one familial and two sporadic CL/P patients, R210H (CGC->CAC) in one familial and two sporadic cases, and R212H (CGC->CAC) in one familial proband (reference protein sequence NP_002846). Analysis of the 292 unaffected controls revealed that mutations in exon 3 are rare. Only two control samples showed an altered SSCP pattern caused by the variant R199Q (P = .18), while no control carried the R210H or R212H variants (P = .03 and .33 respectively). De novo mutation in probands was ruled out, because all seven of these patients had inherited the mutation from a parent. When available, all the relatives of probands with a positive family history of CL/P were examined for exon 3 mutations. Segregation of mutations never coincided with the segregation of CL/P. In fact, we observed both unaffected parents carrying a mutation and/or affected relatives without the mutation. This evidence rules out the possibility that such mutations account for the inheritance of the disease in these families; however it does not formally exclude the possibility of PVRL1 mutations having a role in CL/P development.

In addition to the exon 3 variants, the synonymous D424D (GAC->GAT) mutation was detected in exon 6. D424D was present in one proband only and was not found in any controls.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The aetiology of non syndromic cleft lip with or without palate (CL/P) is still largely unknown. Its complexity is exemplified by the large number of candidate genes and loci that seem to be involved (Marazita et al. 2004). Mutations in candidate genes have already been identified in a small proportion of cases of CL/P (Wong & Hagg, 2004). The nature and function of the genes involved in CL/P varies widely, illustrating high vulnerability within the craniofacial developmental pathways. One example of a clefting gene is PVRL1 which encodes the cell-to-cell adhesion protein nectin 1. Mutations of PVRL1 cause the autosomal recessive syndrome CL/P-ectodermal dysplasia (CLPED1). So far three mutations causing CLPED1 have been described. All of them clearly disrupt the gene function: two introduce a frame shift, and the third results in a stop codon. Heterozygosity for the W185X mutation was found in association with non syndromic CL/P in a North Venezuelan population (Sozen et al. 2001). We previously found that in the Italian population the W185X mutation is absent or very rare (Scapoli et al. 2004).

In the present study we investigated a collection of 143 Italian patients with CL/P for the presence of mutations in the PVRL1 gene that would possibly be responsible for an increased risk of CL/P in the Italian population. We found seven patients carrying a mutated allele. In particular, three different non-synonymous mutations were found, namely R199Q, R210H, and R212H. They have never been described before as mutations, nor were they included in any polymorphism databases.

Considering that SSCP, like other mutation screening methods, does not have 100% sensitivity, we cannot exclude the possibility of undetected mutations being present in patients. Moreover, sequence variations that may affect gene expression may exist in non-screened sequences, such as the promoter region or introns.

Interestingly, all three mutations detected in this study were clustered in exon 3, where two out of the three previously described mutations were found. They are located in a functional domain, specifically in the second of the three Ig loop motifs of the protein (Lopez et al. 1995). Unfortunately it is not possible to predict whether the amino-acid changes affect protein folding, and to date no functional assay has been available to test the PVRL1 protein. Based only on sequence information, without any functional data on the activity of the mutated protein, the assertion that these mutations are involved in the onset of CL/P may be incorrect. However, the evidence that R210H and R212H were not found in 292 healthy controls supports the hypothesis that these mutation are involved in CL/P. In addition, all three arginine residues that we found mutated in PVRL1 proved to be conserved among the organisms whose gene sequences are available (human, chimpanzee, rat, mouse, pig, cow and chicken). On the other hand, the mutations were present in healthy parents of patients, and were not linked with CL/P in multiplex pedigrees. This evidence indicates that such mutations are not necessary or sufficient to cause CL/P, though it does not formally exclude the possibility of PVRL1 mutations having a role in CL/P development. Our data agree with the low penetrance of the W185X mutation, as observed by Sozen (Sozen et al. 2001), which could be related to the complex inheritance of CL/P where each single mutation contributes to increasing the risk of developing the disease without being crucial.

In this report we have shown that mutations can be identified in some patients with CL/P. Although it remains to be proven that these particular mutations are causal, supporting data have been reported here. PVRL1 mutations do appear to constitute a genetic risk factor for non-syndromic CL/P in the Italian population.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This study was supported in part by grants from Telethon E. 1147 (P.C.), MIUR local projects (F.C. and P.C.), Fondazione Cassa di Risparmio di Verona (F.C.), and Fondazione Cassa di Risparmio di Bologna (P.C.).

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Bonaiti, C., Briard, M. L., Feingold, J., Pavy, B., Psaume, J., Migne-Tufferaud, G. & Kaplan, J. (1982) An epidemiological and genetic study of facial clefting in France. I. Epidemiology and frequency in relatives. J Med Genet 19, 815.
  • Fraser, F. C. (1970) The genetics of cleft lip and cleft palate. Am J Hum Genet 22, 336352.
  • Higuchi, R. (1989) PCR technology. New York : Stocton Press.
  • Jones, M. C. (1988) Etiology of facial clefts: prospective evaluation of 428 patients. Cleft Palate J 25, 1620.
  • Kondo, S., Schutte, B. C., Richardson, R. J., Bjork, B. C., Knight, A. S., Watanabe, Y., Howard, E., De Lima, R. L., Daack-Hirsch, S., Sander, A., McDonald-McGinn, D. M., Zackai, E. H., Lammer, E. J., Aylsworth, A. S., Ardinger, H. H., Lidral, A. C., Pober, B. R., Moreno, L., Arcos-Burgos, M., Valencia, C., Houdayer, C., Bahuau, M., Moretti-Ferreira, D., Richieri-Costa, A., Dixon, M. J. & Murray, J. C. (2002) Mutations in IRF6 cause Van der Woude and popliteal pterygium syndromes. Nat Genet 32, 285289.
  • Lopez, M., Eberle, F., Mattei, M. G., Gabert, J., Birg, F., Bardin, F., Maroc, C. & Dubreuil, P. (1995) Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene. Gene 155, 261265.
  • Marazita, M. L., Murray, J. C., Lidral, A. C., Arcos-Burgos, M., Cooper, M. E., Goldstein, T., Maher, B. S., Daack-Hirsch, S., Schultz, R., Mansilla, M. A., Field, L. L., Liu, Y. E., Prescott, N., Malcolm, S., Winter, R., Ray, A., Moreno, L., Valencia, C., Neiswanger, K., Wyszynski, D. F., Bailey-Wilson, J. E., Albacha-Hejazi, H., Beaty, T. H., McIntosh, I., Hetmanski, J. B., Tuncbilek, G., Edwards, M., Harkin, L., Scott, R. & Roddick, L. G. (2004) Meta-analysis of 13 genome scans reveals multiple cleft lip/palate genes with novel loci on 9q21 and 2q32–35. Am J Hum Genet 75, 161173.
  • Nataraj, A. J., Olivos-Glander, I., Kusukawa, N. & Highsmith, W. E., Jr. (1999) Single-strand conformation polymorphism and heteroduplex analysis for gel-based mutation detection. Electrophoresis 20, 11771185.
  • Scapoli, L., Palmieri, A., Pezzetti, F., Carinci, F., Marchesini, J., Martinelli, M., Delaiti, G., Tognon, M., Carinci, P. & Gombos, F. (2004) Investigation of the W185X nonsense mutation of PVRL1 gene in Italian nonsyndromic cleft lip and palate patients. Am J Med Genet 127A, 211.
  • Schutte, B. C. & Murray, J. C. (1999) The many faces and factors of orofacial clefts. Hum Mol Genet 8, 18531859.
  • Sozen, M. A., Suzuki, K., Tolarova, M. M., Bustos, T., Fernandez Iglesias, J. E. & Spritz, R. A. (2001) Mutation of PVRL1 is associated with sporadic, non-syndromic cleft lip/palate in northern Venezuela. Nat Genet 29, 141142.
  • Suzuki, K., Hu, D., Bustos, T., Zlotogora, J., Richieri-Costa, A., Helms, J. A. & Spritz, R. A. (2000) Mutations of PVRL1, encoding a cell-cell adhesion molecule/herpesvirus receptor, in cleft lip/palate-ectodermal dysplasia. Nat Genet 25, 427430.
  • Wong, F. K. & Hagg, U. (2004) An update on the aetiology of orofacial clefts. Hong Kong Med J 10, 331336.