ADAMTS-13 activity in plasma is rapidly measured by a new ELISA method that uses recombinant VWF-A2 domain as substrate

Authors


Miguel A. Cruz, Thrombosis Research Section, Baylor College of Medicine, 1 Baylor Plaza, N1314, Houston, TX 77030, USA.
Tel.: +1 713 798 3485; fax: +1 713 798 1385; e-mail: miguelc@bcm.tmc.edu

Abstract

Summary.  The metalloprotease ADAMTS-13 cleaves von Willebrand factor (VWF) at the Y842/M843 peptide bond located in the A2 domain. Measurement of ADAMTS-13 activity is a clinical utility for thrombotic diseases, but the current assays used for diagnostic and clinical research are non-physiological and time consuming. We have expressed in bacteria a recombinant VWF-A2 peptide (aa 718–905) that contains both a 6xHis tag at the N-terminal end and a Tag-100 epitope at the C-terminal end. Diluted plasma was mixed with the VWF-A2 peptide and digestion was allowed to proceed in a Ni2+-coated microtiter well plate for 2 h. The immobilized Ni2+ captures the VWF-A2 peptide by its 6xHis tag and cleavage of the A2 peptide is measured by the removal of the C-terminus fragment of the A2 peptide that contains the Tag-100. The cleavage activity for this assay was defined by the low detection of A2 peptide containing the Tag-100 epitope by the antiTag-100 monoclonal antibody. The assay was completed in <5 h. We then used the assay to analyze ADAMTS-13 activity in plasma from 39 healthy donors and 16 samples from patients diagnosed as thrombotic thrombocytopenic purpura. The average of enzyme activity ± SEM for normal plasmas diluted 1 : 50 was 40 ± 4.2% while the value obtained for the patients was 2.4 ± 0.7%. These results were validated by a traditional long incubation assay (24 h). Our assay provides significant advantages over currently used assays because it is quicker, reproducible, cost effective and measures ADAMTS-13 activity under physiological and non-denaturing conditions. This assay is clinically useful and significant in measuring ADAMTS-13 activity in plasma.

Introduction

The metalloprotease ADAMTS-13 cleaves the ‘unusually large’ (UL) von Willebrand factor (VWF) multimers newly released from the endothelial cells under physiological flowing conditions. VWF multimers are cleaved at the Y842-M843 peptide bond within the VWF-A2 domain [1–3]. The critical function of the ADAMTS-13 is underscored by clinical thrombotic manifestations caused by the deficiency of this metalloprotease in patients with thrombotic thrombocytopenic purpura (TTP). Deficiency of the enzyme activity in these patients results in the plasma accumulation of the ULVWF multimers, which bind spontaneously with circulating platelets, leading to platelet aggregation and thrombotic microangiopathy (TM) [4–6].

Although deficiency of ADAMTS-13 activity is associated with TM and is often diagnosed as TTP, reduced enzyme activity has also been found in inflammation, pregnancy, liver disease [7], disseminated intravascular coagulation (DIC) [8], sepsis and heparin-induced thrombocytopenia [9], suggesting that clinical measurement of ADAMTS-13 activity may serve as a marker not only for TTP, but also a variety of other diseases.

Furlan et al. [10] and Tsai et al. [11] initially developed assays to measure ADAMTS-13 activity in plasma. Both methods use immunoblotting to observe either the disappearance of large VWF multimers or the appearance of 176-kDa and 140-kDa dimers. The dimeric fragments represent each side of the Y842-M843 cleavage site in the A2 domain of two disulfide-linked VWF monomers [1]. Other methods to estimate ADAMTS-13 activity have also been reported. These include measurement of the collagen-binding activity of a cleaved VWF [12], detection of cleaved VWF by antiVWF antibody in an ELISA [13,14], assays using endogenous VWF as substrate [15,16], and estimation of cleaved VWF multimeric size using ristocetin cofactor activity [17]. These assays are done under static conditions, and require long incubation times (up to 24 h), the addition of either Ba2+ or Ca2+ to activate the enzyme, and denaturing conditions (urea or guanidine). All these assays measure ADAMTS-13 activity in a non-physiological environment and they are also time consuming and costly.

In addition to the above static condition assays, there are two reports that used flow conditions to measure ADAMTS-13 activity. First, Shenkman et al.[18] evaluated the ability of TTP plasma to increase the platelet deposition on a polystyrene surface from normal plasma under flow conditions using a cone and plate(let) analyzer (CPA) method. Second, we recently described that ULVWF multimers, upon release, form extremely long and platelet-decorated string-like structures on the surface of endothelial cells under fluid shear stress [19]. These ULVWF strings are rapidly cleaved by ADAMTS-13 in a kinetic that is 1000-fold faster than under static conditions. These results suggest that the process of ULVWF by ADAMTS-13 may occur on endothelial cells and provide a new way to measure ADAMTS-13 activity in a more physiologically relevant way. However, this flow-based assay is also time consuming (in preparation of endothelial cells) and expensive. It is therefore highly desirable to develop a rapid and cost-effective clinical method to test ADAMTS-13 activity.

Very recently, we reported that a recombinant VWF-A2 peptide (aa 718–905) is sensitive to proteolysis by ADAMTS-13 under physiological pH and non-denaturing conditions and it does not require addition of metal ions [20]. This cleavage is specific and occurs more rapidly than the cleavage of either VWF or ULVWF multimers. We now report the expression of a modified recombinant VWF-A2 peptide in bacteria, to develop an ELISA assay capable of measuring ADAMTS-13 activity in human plasma in <5 h.

Materials and methods

Construction of the double-tagged VWF-A2 peptide

As previously described for the construction of VWF-A2 [20,21], complementary DNA encoding the human VWF-A2 domain (aa 718–905) was generated by polymerase chain reaction (PCR) using full-length human VWF cDNA as a template. The PCR end primers were designed to introduce a BamHI restriction site at the 5′ end (AAGGCCGGATCCGGGCTCTTGGGGGTTTCG) and SalI restriction site at the 3′ end (AAGGCCGTCGACTCCTCTGCAGCACCAGGTC). The PCR product was digested with BamHI and SalI restriction enzymes and inserted into pQE-100 double tag vector (Qiagen, Chatsworth, CA, USA) for expression in Escherichia coli. The recombinant VWF-A2 domain was expressed with the 6xHis tag at the N-terminus (MRGSHHHHHHGS) and the Tag-100 epitope (ETARFQPGYRS) at the C-terminus from the expression vector.

Expression and purification of the double-tagged VWF-A2 peptide

Escherichia coli M15 (pREP4) (Qiagen) containing the pQE100-VWF-A2 domain was cultured, induced and lyzed as described previously [20]. For purification, the washed pellet was solubilized in 7.5 m urea in 50 mm Tris–HCl pH 7.5. The solubilized protein was passed over a Co2+-chelated Sepharose (TALON Superflow; Clontech, Palo Alto, CA, USA) column equilibrated with 5 m urea, 50 mm Tris–HCl, 500 mm NaCl pH 7.4 buffer. The VWF-A2 peptide was eluted from the column with 150 mm imidazole. The buffer was rapidly exchanged with 25 mm Tris–HCl, 150 mm NaCl, 0.05% Tween-20 pH 7.4 (TBS–T) using a desalting column (Amersham, Piscataway, NJ, USA). Protein concentration was determined by the BCA method (Pierce Chemical Co., Rockford, IL, USA).

Measurement of ADAMTS-13 activity in plasma by ELISA

Plasma samples from healthy donors or patients with TTP were collected for the studies. Blood was drawn under a protocol approved by the Institutional Review Board for Human Subject Research at the Baylor College of Medicine and Affiliated Hospitals. All donors signed consent forms before blood was obtained.

Samples were also obtained from patients who had been clinical diagnosed as familial or adult acquired idiopathic TTP and were all under the care of hematologists in the Texas Medical Center. The diagnosis of TTP is based on profound thrombocytopenia (platelet <30 000 µL−1), schistocytosis, extremely high levels of lactate dehydrogenase (LDH), variable neurological findings, and subcutaneous and mucus bleedings. Furthermore, all patients responded to either plasmapheresis (familial TTP) or plasma exchange (adult acquired idiopathic TTP). We did not examine for mutations in the ADAMTS-13 gene for patients with familial TTP.

To measure ADAMTS-13 activity in plasma, samples of either citrated (0.38% sodium citrate) or D-phenylalanyl-prolyl-arginine chloromethyl ketone (PPACK) (75 µm) normal plasma or plasma from patients with TTP (either acquired TTP with very low ADAMTS-13 activity as a result of an inhibitor, or congenital TTP with near-absent ADAMTS-13 activity) were diluted in 25 mm Tris–HCl, 150 mm NaCl pH 7.4 (TBS) and mixed with recombinant VWF-A2 peptide (5 µg mL−1 in TBS). Three different dilutions of plasma (1 : 1, 1 : 5 and 1 : 50) from both healthy controls (n = 39) and TTP patients (n = 16) were tested. The mixture was added into microtiter wells (80 µL per well) coated with Ni2+ (Ni-NTA HisSorb Strips; Qiagen) and incubated for 2 h at 37 °C. In addition, congenital TTP plasma was mixed 1 : 1 with normal plasma and incubated with the A2 peptide to demonstrate that the ADAMTS-13 from the normal plasma restores cleavage activity. The assay was performed at conditions of 1 : 1 dilution plasma. A range of dilutions of partially isolated ADAMTS-13 enzyme from plasma (275 µg mL−1 total protein) [20] was also incubated with the VWF-A2 peptide to assure that isolated ADAMTS-13 specifically cleaves recombinant VWF-A2 peptide. After incubation for 2 h, the wells were washed three times (approximately 1 min per wash) with TBS, and monoclonal antibody Tag-100 (against Tag-100) (Qiagen) (1 : 2000 in TBS) was added and incubated for one additional hour at 37 °C. The wells were then washed four times with TBS and incubated with a 1 : 3000 dilution of goat peroxidase-conjugated monoclonal antimouse IgG antibody (Sigma, St Louis, MO, USA) for 45 min at 37 °C. The wells were washed four times, and the substrate (o-phenylenediamine; Sigma) was added. After 10–15 min of substrate conversion, reactions were stopped with 0.025 mL of 2 N H2SO4, and the plates were read at 490 nm.

In each Ni2+-coated microtiter plate, TBS containing A2 protein was incubated in wells to obtain the value of captured VWF-A2 substrate. This absorbance value represents the undigested VWF-A2. For background, wells were incubated with the diluted plasma without VWF-A2 peptide. Thus, to summarize binding data in the percentage of ADAMTS-13 activity, optical density (OD) (490 nm) values obtained for each sample at specific plasma dilution were converted as follows:

image(1)

Endothelial cell culture and preparation of ULVWF

Endothelial cells were obtained from human umbilical veins (HUVEC) as described previously [19] and used for ULVWF string assay and as the source of ULVWF. Endothelial cell cultures were prepared under a protocol approved by the Institutional Review Board of the Baylor College of Medicine. The umbilical cords were first washed with phosphate buffer (140 mm NaCl, 0.4 mm KCl, 1.3 mm NaH2PO4, 1.0 mm Na2HPO4, 0.2% glucose pH 7.4) and then infused with a collagenase solution (0.02%; Invitrogen Life Technologies, Carlsbad, CA, USA). After a 30-min incubation at room temperature, the cords were rinsed with 100 mL of the phosphate buffer. Eluates containing endothelial cells were centrifuged at 250 × g for 10 min. The cell pellets were resuspended in Medium 199 (Invitrogen Life Technologies) containing 20% heat-inactivated fetal calf serum and 0.2 mm of l-glutamine. The endothelial cells were then plated on a culture dish coated with 1% gelatin and grown until confluent (3–5 days).

To obtain ULVWF, confluent HUVEC cultures were first washed with PBS and incubated with a serum-free medium (insulin 5–10 µg mL−1, transferrin 5 µg mL−1, M199, 1% glutamine) for 48–72 h. The cells were then treated with 100 µm histamine for 30 min at 37 °C to induce the release of ULVWF. After incubation, the conditioned medium was collected and centrifuged at 150 × g for 10 min to remove cell debris and the supernatant was used as the source of ULVWF multimers. The multimeric composition of purified plasma VWF and ULVWF was evaluated by SDS−1% agarose gel electrophoresis and chemiluminescence.

Measurement of ADAMTS-13 activity in plasma by immunoblotting techniques

Two immunoblotting methods were used to verify the results from the ELISA assay. Assay 1 uses ULVWF multimers (VWF:Ag = 15 ± 2%) from the supernatant of cultured HUVEC in place of smaller, plasma-type VWF forms. ADAMTS-13 activity is estimated by the disappearance of UL and large VWF multimers in the presence of test plasma, compared with the presence of dilutions of pooled normal plasma. ADAMTS-13 activity in either normal plasma (NP) or TTP plasma (each diluted 1 : 5 in 10 mm Tris–Cl, 150 mm NaCl buffer pH 8.0) is determined by mixing each plasma sample with HUVEC supernatant (containing ULVWF multimers), 1.5 m urea, and 10 mm BaCl2 at pH 8 for 24 h at 37 °C [10,22]. As one negative control (no ADAMTS-13 activity), buffer is substituted for diluted normal plasma in the mixture; as a second negative control, EDTA is added to the normal plasma mixture before incubation. Electrophoresis of non-reduced SDS samples is into 1% agarose, and VWF multimers are displayed by rabbit polyclonal antihuman VWF antibody and chemiluminescence. Pooled normal plasma sample has, by definition, 100% ULVWF multimer cleaving capacity (ADAMTS-13 activity). Most of the TTP patient plasma samples studied have <5% ADAMTS-13 activity.

Assay 2 was done under static conditions using the single tag recombinant VWF-A2 as substrate [20]. Ten-microliter samples of PPACK (75 µm) plasma were incubated with the single tag VWF-A2 peptide (30 µg mL−1 in TBS) at 37 °C (total volume 25 µL). Two microliters from the mixture were collected after 1 h incubation and added to 10 µL of non-reduced sample buffer. Cleavage was assessed by electrophoresis and immunoblotting. Densitometric quantification (Scientific Imaging Systems; Kodak, Rochester, NY, USA) of the 16-kDa band [ratio of 16-kDa band to total A2 bands (16 kDa + 25 kDa) in arbitrary units] was performed in order to obtain a relative cleavage activity of the ADAMTS-13 on the A2 protein.

Measurement of ADAMTS-13 activity in plasma under flow

The formation and cleavage of ULVWF strings by ADAMTS-13 in test plasma were studied under flow in a parallel-plate flow chamber system and observed by phase-contrast video microscopy [19]. The endothelial cells were grown as a monolayer on the coverslip that formed the bottom of a parallel-plate flow chamber. The chamber was kept at 37 °C with a thermostatic air bath during the experiments. The assembled parallel-plate flow chamber was mounted onto an inverted-stage microscope (Eclipse TE300; Nikon, Garden City, NY, USA) equipped with a high-speed digital camera (Model Quantix; Photometrics, Tucson, AR, USA). A syringe pump connected to the outlet port draws a washed platelet suspension through the chamber at a defined flow rate to generate a wall shear stress of 2.5 dyn cm−2. The formation and cleavage of ULVWF strings were recorded using a digital camera and acquired images were analyzed offline using MetaMorph software (Universal Images, West Chester, PA, USA). The formation and cleavage of ULVWF multimeric strings were quantitated in 20 continuous 40 × view-fields over the course of 2–5 min.

Results

The soluble double-tagged VWF-A2 peptide was identically purified by the procedures previously used to isolate the single-tag A2 peptide [20]. The yield of purified double-tagged VWF-A2 peptide was 1–2 mg L−1 of bacterial culture, with a calculated molecular mass of 23.7 kDa. The protein does not contain cysteine residues, in good agreement with the 27-kDa molecular mass estimated by non-reducing SDS–PAGE (data not shown).

The cleavage of the double-tagged VWF-A2 peptide by ADAMTS-13 was efficiently detected by immunoblotting, as previously demonstrated using the single-tag VWF-A2 peptide (data not shown). The addition of the Tag-100 epitope in the C-terminal of the VWF-A2 peptide does not change its cleavage susceptibility.

We have investigated the potential use of the double-tagged VWF-A2 peptide as substrate for measurement of ADAMTS-13 activity in plasma using an ELISA method. In each Ni2+-coated microtiter plate, TBS containing A2 protein was incubated in at least three wells to obtain the mean value of captured VWF-A2 substrate. This value was defined as 100% undigested VWF-A2. For background, wells were incubated with the diluted plasma without VWF-A2 peptide. Thus, we defined the cleavage of VWF-A2 peptide by the reduction of absorbance (Fig. 1A). The absorbance was then converted into the percentage of ADAMTS-13 activity using equation 1 described above (Fig. 1B).

Figure 1.

Detection of recombinant VWF-A2 peptide by the monoclonal antibody Tag-100. Recombinant VWF-A2 peptide was incubated in microtiter wells coated with Ni2+ in the presence of either buffer or different dilutions of normal plasma. Binding of the A2 peptide was determined as described in Materials and methods. (A) Specific binding of intact A2 peptide. As the plasma concentration decreases the absorbance that represents bound of intact A2 peptide increases. (B) The absorbance values corresponding to each plasma dilution were converted to percentage of ADAMTS-13 activity following the equation described in Materials and methods.

Using this new ELISA method, the difference in mean value between normal (n = 39) and TTP subjects (n = 16) was significant (Fig. 2). The measurements were made at three different plasma dilutions with TBS buffer. One interesting observation is that four patients who had clinically been diagnosed as TTP showed ADAMTS-13 activity >50% at 1 : 1 dilution, but ADAMTS-13 deficiency became apparent at 1 : 50 dilution of plasma (Fig. 2). Furthermore, at this plasma dilution three normal individuals had enzyme activity <5%.

Figure 2.

Activity of ADAMTS-13 in 39 normal controls and 16 samples from thrombocytopenic purpura (TTP) patients. Three different plasma dilutions were used to measure ADAMTS-13 activity in plasma from normal and TTP patients. As the panel shows, a highly significant difference was obtained in the mean of enzyme activity between the normals and patients in all the dilutions tested. The highest plasma dilution tested (1 : 50), proved to be the most sensitive as 13 (81%) of the 16 TTP samples had <6% activity. In contrast, with the exception of three (7.7%) that had <5% activity, 36 normals had an enzyme activity of >17%. For each sample, the value represents the average of triplicate experiments.

To ensure reproducibility, pooled normal plasma (n = 25 donors) was analyzed 10 times and the coefficient of variation (CV) measured to be approximately 2.4%.

The specificity of ADAMTS-13 cleavage of the recombinant VWF-A2 was further determined by two means. First, cleavage of VWF-A2 substrate was measured using plasma from two congenital TTP patients. As shown in Fig. 3A, the ADAMTS-13 deficiency in these two patients was partially restored by mixing the ADAMTS-13-deficient plasma one to one with normal plasma. Second, the specific cleavage activity by ADAMTS-13 on the VWF-A2 peptide was also demonstrated using three different dilutions of partially isolated ADAMTS-13 (Fig. 3B).

Figure 3.

ADAMTS-13 specifically cleaves recombinant VWF-A2 peptide in the ELISA assay. The specific involvement of ADAMTS-13 in digesting the A2 peptide in the new method was tested. (A) The restoration of enzyme activity in congenital thrombocytopenic purpura (TTP) plasmas after they were mixed 1 : 1 with normal plasma. The assay was performed at 1 : 1 dilution of plasma. The graph represents the average (±SD) of two different congenital TTP plasmas tested in triplicates. (B) Three different dilutions of partially isolated ADAMTS-13 enzyme (275 µg mL−1 of total protein) were used to demonstrates the ability of the enzyme to cleave recombinant VWF-A2 peptide.

All the samples tested in our assay were concurrently analyzed under static conditions by two immunoblotting methods that analyze ADAMTS-13 cleavage of either ULVWF or recombinant VWF-A2 peptide [20], and by a flow-based assay that measures ADAMTS-13 cleavage of ULVWF strings secreted by stimulated HUVECs [19]. The enzyme activity determined for the normal plasmas in the ELISA assay (20% plasma or 1 : 5 dilution) correlated well with the immunoblotting method that used recombinant VWF-A2 as substrate (40% plasma) (Fig. 4A, R2 = 0.554) and with the assay that uses ULVWF as the substrate and requires Ba2+, urea and a long incubation period (20% plasma) (Fig. 4B, R2 = 0.594). Although the correlation with the flow-based ULVWF multimer string-cleavage assay was less significant among normal plasmas (R2 = 0.24), severe deficiencies found in plasma from TTP patients were detected in both assays.

Figure 4.

Comparison between the ELISA assay and two other methods. (A) Correlation between the ELISA assay and the quantitative immunoblotting method that uses recombinant VWF-A2 peptide as substrate. (B) Correlation between the ELISA and the long incubation period (24 h) immunoblotting method that uses ‘unusually large’ von Willebrand factor (ULVWF) as substrate.

Discussion

ADAMTS-13 has been identified as the plasma enzyme that cleaves the endothelial cell-derived ULVWF multimers [23–26]. This enzyme cleaves the Y842/M843 peptide bond that is located within the A2 domain of the VWF. Very recently, we reported the expression of a protein encompassing the A2 domain (aa 718–905) in E. coli[20] and showed that ADAMTS-13 specifically cleaved the recombinant VWF-A2 peptide within 1 h of incubation under static non-denaturing conditions. Quantitative immunobloting analysis was used to show the appearance of the 16-kDa fragment. This fragment is the direct evidence of the product from the enzymatic activity of ADAMTS-13 that results from the cleavage of the VWF-A2 peptide at the bond between Y842 and M843. Further, we have also demonstrated that monoclonal antibody VP-1 (against a peptide from L828 to Y842 of VWF), EDTA and inhibitors from acquired TTP patients inhibited the proteolytic activity [20].

After establishing that our recombinant VWF-A2 peptide is rapidly cleaved by ADAMTS-13 under physiological buffer saline and non-denaturing conditions, we modified the peptide to develop an ELISA method. The new double-tagged VWF-A2 peptide is as effective a substrate for ADAMTS-13 as is the previously used single-tagged A2 peptide. The new method uses microtiter wells coated with Ni2+ that interacts with the 6xHis tag in the N-terminal end of VWF-A2 peptide and a monoclonal antibody against the Tag-100 epitope tag in the C-terminal end. During the 2-h cleavage process, the immobilized Ni2+ captures the N-terminal fragment of the cleaved A2 peptide and the released C-terminal fragment is removed by washing. Antibody against the Tag-100 tag no longer recognizes intact VWF-A2 peptide, and cleavage is indicated by the apparent loss of substrate.

The new method was validated by several techniques. The apparent loss of VWF-A2 peptide was markedly observed in the presence of normal plasma or partially isolated ADAMTS-13 but not in the presence of buffer or congenital TTP plasma. Proteolysis of the VWF-A2 peptide occurred, in contrast, if congenital TTP plasma was mixed 1 : 1 with normal plasma. Results with the ELISA method correlated with two other static methods and one flow method for measuring VWF-A2 and ULVWF cleavage by ADAMTS-13.

It has been reported that severe ADAMTS-13 deficiency (<5% activity) is associated specifically with patients with TTP [9,27,28]. In our group, we observed that in some patients, the severe deficiency of ADAMTS-13 becomes apparent only when plasma samples were diluted 50-fold. At this dilution, the results obtained are intriguing, because regardless of the substantial differences in methodology, our assay detected 13 of the 16 samples (81%) with an activity of <6% (11 samples showed 0% activity). Only three samples showed activity of 6–12%. Early reports using VWF multimers as substrate have detected ADAMTS-13 deficiency in more concentrated samples [10,11]. It is possible that at higher plasma dilution in buffer (i.e. changes in ionic strength and pH) there is a direct effect on the structure conformation of either or both ADAMTS-13 and substrate (recombinant VWF-A2 peptide) affecting the proteolytic activity. It is likely that ADAMTS-13 cleaves the purified VWF-A2 peptide differently compared with native VWF multimers. The difference could influence the threshold for minimal ADAMTS-13 activity that is used to distinguish severe deficiency from low or normal enzyme activity. For example, we observed that the threshold for ADAMTS-13 deficiency in TTP using our method is approximately 15% at 1 : 50 dilution of the plasma samples.

Our new assay offers several advantages over methods currently in use. First, the time for completing the assay is <5 h. All of the static methods reported to date require at least 24 h to obtain results [10,12–14,17]. Second, since it is an ELISA-based method, lengthy electrophoresis is avoided. In addition, a large number of samples can be tested at the same time. Third, the use of purified recombinant VWF-A2 peptide as substrate allows standardizing VWF substrate, avoiding variations among different batches of VWF preparation such as antigen levels and multimer distribution. Fourth, the cleavage of the A2 peptide occurs without the addition of metal ions and under physiological buffer saline, pH 7.4. This is in clear contrast to other currently used assays that require the addition of specialized buffers containing Ba2+ or Ca2+ ions and higher pH to stimulate the enzyme to cleave full-length VWF. The Ni2+ present in our assay does not activate ADAMTS-13 because we obtained identical results when monoclonal antibody Tag-100 was immobilized on wells to capture the A2 peptide through its Tag-100 epitope and detected by using anti6xHis tag antibody (data not shown). Further, our assay requires neither urea nor guanidine to unfold the substrate, because, as we previously demonstrated, the cleavage site of the A2 peptide is constitutively exposed [20].

The cleavage of the VWF-A2 peptide requires significantly shorter incubation time and less plasma (activity detected at 1 : 50 dilution of plasma). This result indicates that our recombinant VWF-A2 domain is in an open conformation that is readily accessible to ADAMTS-13 metalloprotease. Thus, the A2 domain in native VWF multimers appears to be hidden or masked by other structures such as adjacent A1 and A3 domains. This possibility may also explain why the ULVWF formed under fluid shear stress can be cleaved by ADAMTS-13 in a kinetic that is a 1000-fold faster than static conditions [19]. These ULVWF strings with tethered platelets are subject to significant amounts of wall shear stress that may stretch VWF to such an extent as to expose the VWF-A2 domain. It is also consistent with previous studies by Tsai et al. [29] showing that fluid shear stress accelerates the cleavage of VWF by ADAMTS-13.

In summary, we report the development of a quicker and simple method for quantifying ADAMTS-13 activity in plasma. Purified recombinant VWF-A2 peptide has been used as substrate. Comparison between the novel assay and a currently used long incubation immunoblotting method verified the accuracy of the ELISA assay. The method is reproducible and can be performed in <5 h, providing a fast and cost-effective means to measure ADAMTS-13 activity clinically. The fast turnaround of the ELISA method may allow rapid diagnosis of TTP and other conditions that may result in ADAMTS-13 deficiency, so that proper treatment can be timely administered.

Ancillary