Novel missense mutations in two patients with factor XI deficiency (Val271Leu and Tyr351Ser) and one patient with combined factor XI and factor IX deficiency (Phe349Val)

Authors


Alok Srivastava, Department of Hematology, Christian Medical College, Vellore, 632 004, India. Tel.: + 91 416 2282352; fax: + 91 416 2232035; e-mail: aloks@cmcvellore.ac.in

Factor XI (FXI) is the zymogen of a trypsin-like serine protease that catalyzes the activation of FIX in the consolidation phase of blood coagulation through a thrombin-generated feedback loop. The human FXI gene is located on the long arm of chromosome 4 (4q35) [1]. It is composed of 15 exons and spread over approximately 23 kilobases [2]. Mutations in this gene result in a relatively mild and variable bleeding diathesis [3]. Although FXI deficiency is common in well-defined populations, including Ashkenazi Jews and French Basques [4,5], only 50 different mutations in this gene have been reported world-wide [6]. An increased frequency of such disorders has been expected in Middle Eastern countries and Southern India where consanguineous marriages are relatively common [6]. We report here for the first time, the molecular data in three South Indian patients with FXI deficiency.

Patients with clinical bleeding or a prolonged activated partial thromboplastin time (APTT) on preoperative screening were further evaluated. A diagnosis of FXI or FIX deficiency was based on a prolonged APTT and a low FIX or FXI coagulant activity (FIX/FXI:C). Genomic DNA was obtained from the peripheral blood of these patients. FXI gene was amplified by 14 pairs of primers (Primer3, http://www.broad.mit.edu/cgi-bin/primer/primer3_http://www.cgi) designed to cover all 15 exons and intron–exon boundaries (Table 1). Mutations were screened by conformation-sensitive gel electrophoresis (CSGE) as previously described [7]. In the patient with a double coagulation defect, FIX gene defects were identified by a multiplex polymerase chain reaction (PCR) and CSGE strategy as reported earlier [8]. Samples displaying abnormal CSGE patterns were sequenced using the Big Dye Terminator cycle sequencing kit (Applied Biosystems, Warrington, UK) on an ABI 310 genetic analyzer (PE Applied Biosystems, Foster City, CA, USA). PCR–restriction enzyme analysis (PCR-REA) was carried out with BsaAI (New England Biolabs, Hitchin, UK) and BamHI (MBI Fermentas, St Leon Rot, Germany) to confirm the novel mutations identified in exons 8 and 9 of the FXI gene and to screen for their presence in 50 normal chromosomes of south Indian descent. Mutations at or near the splice junction consensus sequences were analyzed using the ‘Splice Site Prediction program’ (http://www.fruitfly.org/seq_tools/splice.html) to predict changes in RNA splicing. FXI amino acid sequences from 10 different species/related serine proteases were obtained from the SwissProt and Trembl databases (http://us.expasy.org/sprot/) by psi-blast to study the conservation of novel missense substitutions identified.

Table 1.   Primers used for amplification of factor XI gene
Exon Forward primer (5′−3′) Reverse primer (5′−3′)Amplicon
size (bp)
  1. PCR was performed in a 25-μL reaction volume containing 7.5 pmol of each primer in a 1× concentration of a ready reaction mix (Abgene®, Epsom, UK) containing 1.5 mmol L−1 MgCl2, 75 mmol L−1 Tris–HCl (pH 8.8), 20 mmol L−1 (NH)2SO4, 0.2 mmol L−1 of each of dNTP, 0.01% (v/v) Tween-20 and 1.25 units of Thermoprime plus DNA polymerase. Approximately 250 ng of genomic DNA was used for amplification reactions. Following an initial denaturation at 94 °C for 5 min, 30 cycles of PCR amplification were performed, with denaturation at 94 °C for 40 s, annealing at 58 °C for 40 s and extension at 72 °C for 40 s. The final extension was at 72 °C for 5 min.

f11-exon 1AAAGCAAGCAATTCTCTCAAGGTCTCTACAAAGCTAAATCAGACACA379
f11-exon 2TTGAATGCCACACACAGTCATTATTTCCTTCCCGGCATAA359
f11-exon 3GAGCTACTTGCCTTGCCTTTTGGAAATGTGTTAAGAATAGCAATC326
f11-exon 4TTTGTTTTGGCATGAGATAAAGCCGATGTGGCGATATGTGTA294
f11-exon 5GAGTCAGGAGGGACAGTTGCGGCATAAAGTTGATGGCAAAA321
f11-exon 6CAGGTGCTTAGCAACACTGCGTCCGTTTCATCGTGAGCAT380
f11-exon 7GACCGGAATTTTCCTGATAGCTGATGGATTTTGATCAGCTATTTT284
f11-exon 8+9ACTTTCTCTAGGTGCTGTAAAAATGGGGTGTCTGCATAACCCTTC481
f11-exon 10TCTGCCTGTGAGGTGCATTATGGTCAGCTTGAGTGACAGG318
f11-exon 11TGAAGGAGCATAATTACTGATGGATGTGTGAAGAAGATGAACTAATAAAAA280
f11-exon 12GCCACACACTTCACAATGTCTAGGGTCAGGCCGTAAGTCTA334
f11-exon 13CGATATCGTGCTGAACCTGATTGACAGGGCAGAAAAGGTT328
f11-exon 14TTGTGTATGGTTATTCTACAAACGAAGGGCAACAGAGCGAGACT310
f11-exon 15GAAGATGGGAAGCGTCTGAGCAACGATCATAGAACGGGAGT410

The clinical and hematological data for these patients (Table 2), show that those patients with severe FXI deficiency alone, had no spontaneous bleeding. The measurement of plasma levels of factor activity usually helps to predict the severity and frequency of clinical manifestations, but for FXI deficiency this relationship is poor as is evident from this study and as reported previously [9]. However, the patient with combined deficiency (FIX and FXI) had a clinical phenotype consistent with severe hemophilia. It is of interest to note that replacement of FIX concentrates alone relieved the bleeding symptoms of hemarthroses in this patient.

Table 2.   Clinical features, hematological parameters and mutation data on patients with hereditary factor XI deficiency
UPNAge at
diagnosis
/sex
Consan-
guinity
Family
history
Bleeding
symptoms
APTT
(s)
FXI:CDomain Exon/
intron
Mutation/codon Amino
acid
Restriction
site
altered
Comments Conservation§
  • *

    Severe bleeding symptoms characterized by hemarthroses, easy bruisability, excessive bleeding from tooth sockets and repeated episodes of bleeding from minor injuries since childhood.

  • †Amino acid numbering according to Asakai et al. [2].

  • (+) sign indicates that a mutation creates a restriction site and a (–) indicates that the mutation abolishes a restriction site for the restriction enzyme.

  • §Alignment of amino acid sequence derived from FXI from different species and its related serine proteases. FXI amino acid sequences from 10 different species/related serine proteases were obtained from SwissProt and Trembl databases (http://us.expasy.org/sprot/) by PSI-BLAST. Their accession numbers are (left to right) P03951, human coagulation factor XI precursor; Q95ME7, rabbit coagulation factor XI; Q91Y47, mouse coagulation factor XI precursor; Q6PZ62, bovine coagulation factor XI; Q6Q0I7, bovine coagulation factor IX; P03952, human plasma kallikrein precursor; O97506, pig kallikrein; Q8ROP5, mouse kallikrein B; P26262, mouse plasma kallikrein precursor; P14272, rat plasma kallikrein precursor.

  • Single letter amino acid codes: E, glutamic acid; G, glycine; N, asparagine; S, serine; V, valine.

  • **

    Patient with severe combined deficiency of factors IX and XI.

  • †† Novel mutations, not reported previously in Peyvandi et al.[17] or in http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=Details&DB=PubMed.

     Control
27-31.4
        
BL-869/MaleNoSporadicPost-op only86.71.6%Apple-38GTG→CTG††Val271LeuBsaAI+HeterozygousVVVVVEEEEE
Catalytic12GGG→AGGGly460ArgAciI–HeterozygousGGGGGNGNNS
BL-154**11/MaleNoFamilialSevere*137.3<1%Catalytic12GGG→AGGGly460ArgAciI–HomozygousGGGGGNGNNS
BL-1666/FemaleYesSporadicNone82<1%Apple-410TAC→TCC††Tyr351SerBamHI+HomozygousYYYYYYYYYY

Mutations in FXI or FIX genes were identified in all three subjects by PCR and CSGE. In all, four different causative missense mutations (FXI, n = 3; FIX, n = 1) were detected of which three were novel (Table 2). Two previously reported [5] polymorphisms in FXI gene, −138A→C in intron A and Gly379Gly (GGT→GGC) were also identified in a heterozygous (BL-86) or a homozygous state (BL-154) in two patients. In the patient (BL-154) with a double coagulation defect, a novel T→G transversion at nucleotide 31166 of FIX gene (http://www.kcl.ac.uk/ip/petergreen/haemBdatabase.html//) resulted in a phenylalanine to valine missense substitution at codon 349 affecting the FIX catalytic domain. A Phe394Ile missense change has been shown [10] to be causative of hemophilia B. Both these amino acids differ in size and shape and Phe349 is present in a disulfide loop formed by Cys336 and Cys350. The Phe349Val missense change identified in this study may cause hemophilia B by a similar mechanism, as both isoleucine and valine mutants are structurally similar aliphatic amino acids. This mutation was coinherited with a previously reported, homozygous, Gly460Arg missense change in the catalytic domain of FXI and has been shown to be causative of FXI deficiency [11].

In another patient (BL-86), the Gly460Arg mutation was detected in a compound heterozygosity with a novel, Val271Leu (GTG→CTG) amino acid change affecting the apple-3 domain of FXI. This substitution is also likely to be disease causative. As Val271 is the last codon of exon 8, located at its 3′ splice donor junction, a mutation at this consensus splice sequence (CA G-GTA→CA C-GTA) is predicted to abolish (calculated splice site consensus value 0) the physiological donor splice site (normal splice consensus value 0.91) for exon 8 and probably results in an abnormal FXI transcript. Evaluation of 50 normal chromosomes from the same geographic region did not reveal this sequence change (data not shown).

A novel A→C transversion in exon 10 causing a Tyr351Ser (TAC→TCC) missense change was found in patient BL-166. This sequence change was absent in the 50 normal chromosomes screened. Tyr351 is highly conserved in the FXI amino acid sequences or related proteases in the 10 different species studied (Table 2), indicating the importance of this residue to the structure of apple-4 domain in FXIa. Apple-4 domain is important for the dimerization of FXIa [3]. A missense substitution at the adjoining residue Gly350Glu (factor XI Nagoya II) has been demonstrated [12] by expression studies to have a profound effect on FXIa dimerization. It is possible that Tyr351Ser could have a similar effect on FXIa dimerization but further studies are required to demonstrate the functional effect of this mutation.

In summary, we report for the first time the molecular basis of severe FXI deficiency in three unrelated Indian patients. Combined deficiency of coagulation factors is rare. Many of them represent a chance inheritance of disease genes [13], with implications for genotype–phenotype correlations [14]. Only two patients [15,16] with a combined deficiency of factors IX and XI deficiency have been described but without data of genetic evaluation. The molecular data provided in this report on combined FIX and FXI deficiency therefore acquires significance.

Acknowledgements

This study was supported in part by a research grant from Bayer Healthcare, USA and grant BT/PRO 948/Medical/13/034/98 from the Department of Biotechnology, Ministry of Science and Technology, Government of India.

Ancillary