Tissue factor enhances protease-activated receptor-2-mediated factor VIIa cell proliferative properties

Authors


Dr Georges E. Rivard, Division of Hematology, Sainte-Justine Hospital, Room 2617, 3175 Côte Sainte-Catherine, Montreal, Quebec, H3T 1C5, Canada.
Tel.: +1 514 345 4931, ext. 6717; fax: +1 514 345 4884; e-mail: georges-etienne.rivard@umontreal.ca

Abstract

Summary.  In addition to its hemostatic functions, factor (F)VIIa exhibits cell proliferative properties as seen in angiogenesis and tumor growth. A role for tissue factor (TF) and protease-activated receptors (PAR)-1 and -2 in cell proliferation remain to be clarified. We tested the hypothesis that FVIIa induces cell proliferation by a mechanism involving TF and PAR-2. Human recombinant FVIIa induced cell proliferation of human BOSC23 cells transfected with plasmid containing human TF DNA sequence. Because DNA primase 1 (PRIM1) plays an essential role in cell proliferation, we used the cloned PRIM1 promoter upstream of the reporter gene chloramphenicol acetyl transferase (CAT) to elucidate the mode of action of FVIIa. FVIIa evoked a dose-dependent increase in cell proliferation and PRIM1 induction, which were markedly potentiated (4–5-fold) by the presence of TF and abrogated by TF antisense oligonucleotide. PRIM1 induction by FVIIa was also abolished by PAR-2 but not by PAR-1 antisense. In contrast, thrombin induced a small increase in CAT activity which was unaffected by TF, but was prevented only by PAR-1 antisense as well as the thrombin inhibitor hirudin. Proliferative properties of FVIIa were associated with a TF-dependent increase in intracellular calcium and were mediated by a concordant phosphorylation of p44/42 MAP kinase. In conclusion, data reveal that FVIIa induces PRIM1 and ensuing cellular proliferation via a TF- and of the PARs entirely PAR-2-dependent pathway, in distinction to that of thrombin which is PAR-1-dependent and TF-independent. We speculate that FVIIa-TF-PAR-2 inhibitors may be effective in suppressing cell proliferation.

Introduction

The activation of factor (F)VII into FVIIa initiates a coagulation cascade upon binding of this factor to its cell surface receptor, tissue factor (TF), which in turn leads to formation of factor (F)Xa and subsequently to thrombin [1]. There is now abundant evidence that FVIIa can also play a role in numerous functions other than hemostasis, especially in the complex mechanisms of inflammation [2], as well as in cellular mitogenesis in normal tissue development [3] and tumor progression and metastasis [4]; this latter process seems to involve stimulation of MAP kinases [5–7]. Although TF is required for various actions evoked by FVIIa, including those eliciting cell migration [8,9], the need for TF is more contentious with regards to mitogenesis [7,10]. Along the same lines, dependence of FVIIa-induced responses in the presence of FXa is also somewhat unclear [11–13].

TF has been shown to participate in the activation of protease-activated receptors (PARs) [14]. In some cases both PAR-1 and PAR-2 [12,14–16] are activated, while in conditions particularly related to cell migration this signaling exclusively targets PAR-2 [8,9]. Signaling elicited by FVIIa–TF has also been found to be unrelated to that by PARs [17]. Of interest, contrary to other PARs (PAR-1, -3 and -4), PAR-2 is not stimulated by thrombin [18], but can be activated by trypsin and its agonist peptide SLIGKV or SLIGRL depending upon the species [18], as well as by other serine proteases including acrosin present in spermatocytes [19], neuronal protein B-50/GAP-43 [20], brain-derived trypsin-like serine protease [21] and membrane type serine proteases 1 and 3 [22]. Regardless, although activation of PAR-2 by FVIIa is TF-dependent and PAR-2 seems to participate in cell proliferation in cancer and angiogenesis [23–25], one cannot directly assume a role for TF mediated only by PAR-2 in cell proliferation [26], as alluded to above.

DNA primase 1 (PRIM1), the smallest subunit of the tetrameric complex DNA polymerase α-primase, is the only known enzyme priming nuclear DNA replication in eukariotic cells [27]. Accordingly, since PRIM1 is inducible in a cell cycle-dependent manner [28,29] and essential for cellular proliferation, we mapped the PRIM1 gene [30] and ascertained its amplification in human tumors [31]. We therefore tested the hypothesis that FVIIa induces cell proliferation by a process that requires TF and (of the PARs) is primarily PAR-2-dependent. FVIIa indeed elicited human (BOSC23) cell proliferation. Using the cloned PRIM1 promoter upstream of the reporter gene chloramphenicol acetyl transferase (CAT), we hereby clearly demonstrate activation of the PRIM1 promoter by FVIIa. The latter was found to be both TF- and PAR-2-dependent and was associated with calcium signaling and dependent MAP kinase activation; thrombin could also activate PRIM1 promoter, but its effect was independent of TF and mainly mediated via PAR-1.

Materials and methods

DNA clones

PRIM1 human genomic DNA clones in λ phage vectors were selected from a human genomic DNA library as described before [30]. After sequencing, PRIM1 promoter-specific sequences were subcloned into expression plasmids upstream of the CAT reporter gene. Plasmid pl361 containing 1.7 kb of the PRIM1 immediate promoter region (− 1700.. + 47) was used for the transient transfection experiments described in this report. The transcription start site (nucleotide position + 1) corresponds to the nucleotide position 2146 of the human genomic DNA sequence from the same region deposited with GenBank, under the accession number AC021586. Assessment of PRIM1 promoter induction was determined by fusing the CAT reporter gene to the PRIM1 promoter according to standard protocols, and by determination of CAT activity [32].

Full-length PAR-2 plasmid was kindly provided by N. W. Bunnett (University of California, San Francisco, CA, USA) [33]. The human TF full-size cDNA containing expression construct has previously been documented [34].

Antisense oligonucleotide preparations

Antisense experiments were performed according to the method [35] using mixed phosphorothioated-phosphodiester oligos, whereby only the three 5′-end and the three 3′-end nucleotides were linked by phorphorothioate backbone, while the middle portion of the oligonucleotides had a normal phosphodiester backbone. The following sequences were synthesized and used in the experiments (listed in their 5′- to 3′-orientation): human anti-PAR-1 antisense GGCCCCATTGTCCCGG; human PAR-1 sense control CCGGGACAATGGGGCC; human anti-PAR-1 randomized (scrambled) control CACGCGCTGTCGCTCG; human anti-PAR-2 antisense GGGGCTCCGCATCCTCCTGG; human PAR-2 sense control CCAGGAGGATGCGGAGCCCC; human anti-PAR-2 randomized control GAGCTCGCGCGCTCGCTCTG; human anti-TF antisense AGGGGTCTCCATGTCTACCA; human TF sense control TGGTAGACATGGAGACCCCT; human anti-TF randomized control GAGACGTGTCTGCCTCATCA. All oligonucleotides were used in concentrations of 1 µm.

Cell line and culture

The embryonic human kidney BOSC23 cell line was obtained through the American Type Culture Collection (ATCC, Manassas, VA, USA). These cells which express PAR-2 contain low levels of TF (see below), enabling a more rigorous evaluation of FVIIa dependence of TF.

Transfections

Transfections of plasmids (containing TF and PAR-2) were performed with Superfect reagent (Qiagen Inc., Mississauga, ON, Canada) according to the instructions of the manufacturer. The plasmid concentrations were 2 µg DNA per 1 mL transfection medium; 1 mL was used to overlay 30–50% confluent cells grown in six-well culture plates (well diameter 35 mm). After 48 h of protein expression verified by immunoblotting, transfected cells were ready for 3H-thymidine incorporation, CAT activity, measure of intracellular calcium concentrations, and p44/42 MAP kinase immunoreactivity following stimulation with human recombinant FVIIa (Novo Nordisk, Malov, Denmark), human PAR-2 agonist peptide SLIGKV, human PAR-1 agonist peptide SFLLRN, and human thrombin (Sigma-Aldrich Canada, Markham, ON, Canada), in the presence or absence of PAR-1, PAR-2 and/or TF antisense.

3H-thymidine incorporation

Cell proliferation-dependent DNA replication was assayed by 3H-thymidine incorporation. After 48 h protein expression, TF-transfected BOSC23 cells were thoroughly washed three times to remove fetal calf serum from the culture medium before being transferred to a 293 serum-free medium-II (SFM-II; Gibco/Invitrogen, Burlington, ON, Canada). Cells were kept in SFM-II for 16 h and then treated with FVIIa, thrombin, or PAR-2 agonist SLIGKV in the presence of 3H-thymidine (Amersham-Pharmacia Biotech, Baie d'Urfe, Quebec, Canada) for 8 h. The 3H-thymidine incorporation assay was carried out as described [36].

CAT assay

CAT assays [32] for measuring promoter activity were performed using 3H-acetyl-CoA radioactive substrate (Amersham-Pharmacia Biotech, Baie d'Urfe, Quebec, Canada). CAT activity was measured in a liquid scintillation counter as counts per minute, resulting from the CAT enzyme produced by the transfected cells under the control of the PRIM1 promoter. Induced CAT activities were reported relative to basal (untreated) conditions.

Northern blotting and reverse transcriptase-polymerase chain reaction

mRNA for PAR-1, PAR-2 and TF were determined by Northern blotting using respective full cDNA probes, according to a standard protocol [32]; S28 or actin probes were used as internal controls. PRIM1 mRNA was determined by reverse transcriptase-polymerase chain reaction (RT-PCR) using the following respective oligonucleotide upstream and downstream primers: 5′-GCCATACGCATCATTGACAG-3′ and 5′-CCACCCTTTACAAGGCTCAA-3′; QuantumRNA™ universal 18S primers were used as internal controls. PCR cycles were 94 °C for 15 s, 62 °C for 30 s and 72 °C for 30 s, and repeated 30 times.

Western blotting

Protein immunoreactivity for p44/42 MAP kinase and phosphorylated p44/42 MAP kinase (New England Biolabs, Beverly, MA, USA) were performed by Western blotting; immunoreactivity was detected after SDS–PAGE electrophoresis of cellular extracts, followed by electrophoretic transfer of the gel-separated proteins into a nitrocellulose membrane according to standard protocols described in detail [32]. Similar techniques were utilized for Western blots using antibodies of PAR-1, PAR-2 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and TF (Accurate Chemical and Scientific Corp., Westbury, NY, USA).

Measurement of intracellular calcium

Intracellular calcium was measured by the fura-2-acetoxymethyl ester technique [37]. Cells were grown on glass slips coated with poly L-lycine (Mr 70 000; Sigma Chemical). Cells were loaded at 37 °C for 1 h with 4 µm fura-2-acetoxymethyl ester. Unincorporated fura-2 acetoxymethyl ester was then washed off. The intracellular calcium concentration [Ca2+]i was measured with a spectrofluorometer (LS 50; Perkin Elmer, Beaconsfield, UK) by using excitation wavelengths of 340 and 380 nm and emission at 510 nm. Changes in [Ca2+]i in response to FVIIa were calculated as reported [37–39].

Statistical analysis

Data were analyzed by two-way analysis of variance factoring for transfectant type and treatment, followed by comparison among means using the Tukey–Kramer method. Statistical significance was set at P < 0.05.

Results

Effects of FVIIa on cell proliferation and PRIM1 induction

FVIIa stimulated proliferation of BOSC23 cells transfected with plasmid containing TF DNA as reflected by 3H-thymidine incorporation (Fig. 1); this was confirmed by cell counting. Transfection of TF into BOSC23 cells was confirmed by Western and Northern blots (Fig. 2A). TF-untransfected cells hardly responded to FVIIa (not shown). Proliferative effects of thrombin [even at maximum concentrations (see Fig. 2D)] were less pronounced than those of FVIIa (Fig. 1A). PRIM1 plays an essential role in priming DNA replication [27–29]; FVIIa induced PRIM1 mRNA expression in TF-containing cells (Fig. 1B). To elucidate further the mode of action of FVIIa on PRIM1 induction we fused its promoter to the reporter gene CAT. FVIIa increased CAT activity in a dose- and time-dependent manner (Fig. 2B,C); as expected, PRIM1 induction exceeded 3H-thymidine incorporation 8 h (time at which latter was measured) following FVIIa stimulation (Figs 1A and 2B), since the former precedes the latter. Based on time-dependence CAT activity in response to FVIIa and thrombin were from then on studied 10 and 6 h, respectively, after treatments (maximum efficacy). The effects of FVIIa were markedly potentiated in cells containing TF (Figs 2B and 3B) and abrogated by TF antisense (Fig. 3A); TF antisense effectively diminished TF expression in BOSC23 cells (Fig. 3A). Consistent with its proliferative effects, thrombin induced a smaller increase in CAT activity, which was independent of TF (Figs 2D and 3B), but as expected was blocked by the thrombin inhibitor hirudin (Fig. 3B).

Figure 1.

(A) Effects of factor (F)VIIa compared with thrombin on 3H-thymidine incorporation. Tissue factor (TF)-transfected BOSC23 cells were treated for 8 h with FVIIa or thrombin at indicated concentrations. 3H-thymidine incorporation was determined as described in Materials and methods. Values are mean ± SEM of at least three experiments each conducted in triplicate. *P < 0.05 compared with other values (anova). (B) Reverse transcriptase-polymerase chain reaction of PRIM1 mRNA in BOSC23 cells transfected or not with TF and stimulated or not with FVIIa (100 nm) for 8 h; 18S mRNA served as control.

Figure 2.

Effects of factor (F)VIIa and thrombin on induction of PRIM1 promoter. The PRIM1 promoter was fused to the chloramphenicol acetyl transferase (CAT) reporter gene and construct transfected in BOSC23 cells as detailed in Materials and methods. (A) Western and Northern blots of tissue factor (TF) in BOSC23 cells transfected or not with TF-containing plasmid, treated or not with TF antisense oligonucleotide. (B) Time-dependent changes in CAT activity in response to FVIIa (100 nm) or thrombin (100 U L−1) in BOSC23 cells transfected with TF-containing plasmid; based on these findings CAT activity was from hereon studied 10 and 6 h, respectively, after FVIIa and thrombin treatments. (C) CAT activity in response to FVIIa in BOSC23 cells transfected or not with TF-containing plasmid. (D) Effects of thrombin on CAT activity in BOSC23 cells transfected or not with TF-containing plasmid. Each value is the mean of at least three different experiments each performed in triplicate.

Figure 3.

Tissue factor (TF)-dependent induction of PRIM1 promoter by factor (F)VIIa. BOSC23 cells were prepared as described in Fig. 2 and treated with TF antisense, TF sense or TF scrambled antisense oligonucleotides, all at 1 µm. Chloramphenicol acetyl transferase (CAT) activity in response to (A) FVIIa (100 nm) and (B) thrombin (100 U L−1) in presence or not of hirudin (1000 U L−1). Values are mean ± SEM of at least three experiments each conducted in duplicate. *P < 0.05 compared with other corresponding values.

Role of PAR-1 and PAR-2 in FVIIa-induced PRIM1 induction

We proceeded to investigate whether PAR-1 and/or PAR-2 contributed to FVIIa-induced PRIM1 induction. Native BOSC23 cells contained both PAR-1 and -2, and respective antisense downregulated their expression (Fig. 4A); PAR-3 and -4 were not detected. PAR-1 antisense did not alter FVIIa-induced CAT activity, while PAR-2 antisense abolished it (Fig. 4B,C). The converse was observed for thrombin, consistent with its established actions on PAR-1 [18]. PAR-1 and to a greater extent PAR-2 agonist peptides, respectively, SFLLRN and SLIGKV, as well as trypsin (which activates PAR-2) also stimulated CAT activity (not shown).

Figure 4.

Protease-activated receptor (PAR)-dependent induction of PRIM1 promoter by factor (F)VIIa. BOSC23 cells were prepared as described in Fig. 2 and treated with PAR-1 or -2 antisense, PAR-1 or -2 sense or PAR-1 or -2 scrambled antisense oligonucleotides, all at 1 µm. (A) Representative Western and Northern blots on BOSC23 cells treated as described above; actin expression was used as control. Experiment was performed three times. Chloramphenicol acetyl transferase (CAT) activity in response to FVIIa (100 nm) and thrombin (100 U L−1), treated or not with (B) PAR-1 or (C) -2 oligonucleotides. Values are mean ± SEM of at least three experiments each performed in triplicate. *P < 0.01 compared with other corresponding values.

FVIIa signaling concords with PRIM1 induction and ensued cell proliferation

PRIM1 induction by TF-dependent FVIIa (Fig. 2C, 3A, 4B,C) could not be explained by an increased expression of PAR-2 (Fig. 5A). On the other hand, calcium and calcium-dependent MAP kinase activation are known to contribute significantly to DNA replication [40,41]. We therefore investigated the effects of FVIIa on these signaling events. FVIIa increased intracellular calcium concentrations (Fig. 5B); comparable calcium changes were observed with SLIGKV. In addition, early (within 30 min) p44/42 MAP kinase activation (phosphorylation) correlated with CAT activity induced by FVIIa in a TF-dependent manner (Fig. 5C). More importantly, cell proliferative properties of FVIIa were fully abrogated by the specific p44/42 MAP kinase pathway inhibitor PD98059 (Fig. 5D). PAR-2 agonist SLIGKV (as well as trypsin) reproduced proliferative effects of FVIIa (Fig. 5D).

Figure 5.

(A) Western blot of protease-activated receptor (PAR)-2 in BOSC23 cells stimulated or not factor (F)VIIa for 10 h; BOSC23 cells were transfected or not with tissue factor (TF)-containing plasmid, treated or not with TF antisense oligonucleotide. One notes that PAR-2 expression adjusted for protein loading based on β-actin immunodensity was unaffected by FVIIa. (B) Peak intracellular calcium transients in response to FVIIa (100 nm). BOSC23 cells were prepared as described in (A), and some cells also overexpressed PAR-2 by cotransfecting them with PAR-2-containing plasmid. (C) Chloramphenicol acetyl transferase (CAT) activity (10 h) and phospho-p44/42 MAP kinase intensity (30 min after stimulation) relative to baseline (untreated) in response to FVIIa (100 nm) and PAR-2 agonist peptide SLIGKV (50 µm). BOSC23 cells were prepared as in (A). (D)  3H-thymidine incorporation in TF-containing BOSC23 cells treated with FVIIa (8 h) in presence or not of p44/42 MAP kinase pathway inhibitor PD98059 (PD, 1 µm). Dose–response to PAR-2 agonist SLIGKV on 3H-thymidine incorporation is also presented. Values are mean ± SEM of at least three experiments each performed in triplicate. *P < 0.01 compared with other corresponding values without asterisks; †P < 0.05 compared with basal values.

Discussion

There is strong evidence that the complex FVIIa–TF is involved in a number of biological processes, including inflammation and cell migration [8,9,42,43]. But the requirement for TF in FVIIa-induced mitogenesis has been questioned [10] and, furthermore, remains to be clearly demonstrated in human cells. Likewise, although PAR-1 and -2 have been suggested to mediate various biological actions of TF [14], different signaling pathways seem to be activated by separate stimulation of TF and PARs [17]. Moreover, the contribution of both PAR-1 and PAR-2 in response to TF, especially with regard to cell proliferation, needs clarification. We proceeded to investigate the mode of action of FVIIa on cell proliferation. Our findings explicitly reveal that FVIIa induces human DNA replication and specifically the required promoter of PRIM1, a critical enzyme in this process and thus in cell proliferation [27–29], via a TF- and PAR-2-dependent pathway associated with calcium signaling and mediated via p44/42 MAP kinase.

FVIIa was found to increase DNA replication (Fig. 1A). We further explored the action of FVIIa on DNA replication by determining induction of the essential PRIM1 gene using the PRIM1 promoter fused to the sensitive and reproducible CAT-reporter gene [32], after showing induction of the native PRIM1 gene by FVIIa (Fig. 1B). The human embryonic kidney BOSC23 cell line was utilized in order to work exclusively with human cells, and because this cell line expresses negligible levels of endogenous TF (Fig. 2A), although it does express PAR-1 and PAR-2 but not PAR-3 and -4. Some parallel experiments were conducted with thrombin, a known mitogen and well-recognized agonist for PAR-1 [44], to attempt to distinguish effects from those observed with FVIIa. In order to characterize better the contribution of TF, PAR-1 and PAR-2 in the activation of PRIM-CAT by FVIIa and thrombin, we used antisense oligonucleotides, in addition to using TF-expressing transfectants. To reduce non-specific binding secondary to abundant phosphorothioate modifications [35] we introduced fewer phosphorothioate changes of the antisense (and control) oligonucleotides; only the three 5′-end and the three 3′-end nucleotides were linked by phosphorothioated backbone. Sense and randomized scrambled oligonucleotides were also used for controls.

A major role for TF in FVIIa induction of DNA primase-1 promoter and ensuing human BOSC23 cell proliferation was evidenced using cells containing or not the TF gene, and was further corroborated using TF antisense (Figs 1–3). A similar strategy was applied to demonstrate that FVIIa induction of the PRIM1 promoter required PAR-2 but not PAR-1 (Fig. 4); accordingly, PAR-2 agonist SLIGKV and PAR-2 activator trypsin also reproduced these effects. In contrast, another coagulant, thrombin, caused a smaller induction of PRIM1 by acting only via PAR-1. Since PAR-1 and PAR-2 exhibit mitogenic properties [23–26] and TF can couple to both receptors through its effect on initiation of coagulation [12,14], one would have predicted involvement of both PAR-1 and -2 in inducing PRIM1 in response to FVIIa. Divergence of these inferences with results obtained in the present study may be caused by different coupling between TF with these two PARs which may require a cofactor, as previously alluded to [12,45], and/or by different cell signaling by PAR-1 and -2 [46]; on the other hand, our findings, which highlight a dominant role for PAR-2 but not PAR-1 on FVIIa–TF-evoked cellular actions, concord with those of others [8,9]. Likewise, a robust cell proliferation and PRIM1 induction were evoked by FVIIa in the absence of FXa (Figs 1–4). These findings at first diverge from the reported presumed requirement of FXa to activate PAR-2 [12]; but more specifically, it seems that FXa potentiates the effects of FVIIa on PAR-2 activation without altering maximum efficacy [14], consistent with our observations.

Coherent with stimulation of cell proliferation, FVIIa as well as PAR-2 evoked calcium mobilization and p44/42 MAP kinase activation (Fig. 5), which are established signals involved in triggering DNA replication [40,41]. Interestingly, the degree of CAT activation corresponded to that of p44/42 MAP kinase, which in turn contributed significantly to mediating the PRIM1-dependent DNA replication (Fig. 5D). Our findings are consistent with documented FVIIa–TF- and PAR-2-induced calcium transients [12] as well as activation of p44/42 MAP kinase and its major contribution to cell proliferation [5–7,24].

In summary, we believe the present data disclose the first clear evidence for both TF- and PAR-2-mediated activation of the human PRIM1 promoter and ensuing cell proliferation in response to FVIIa; these effects are distinct from those evoked by another important mitogenic coagulation factor, thrombin. Further studies are needed to elucidate the molecular mechanisms which participate in the coupling of TF with a specific PAR, including the role of the TF cytoplasmic domain [11,34,42] and other possible interacting factors. On the whole, FVIIa–TF–PAR-2 inhibitors may be beneficial to control undesired cell proliferation.

Acknowledgements

The authors acknowledge technical assistance from E. Levy and R. L. Momparler. The authors acknowledge the support by grants from the Canadian Institutes of Health Research, the March of Dimes Birth Defects Foundation, the Center de Recherche de l'Hôpital Ste. Justine and Bayer Inc. J-S.J. is a recipient of a Novo Nordisk/Canadian Blood Services Hemostasis Research fellowship and S.C. holds a Canada Research Chair (perinatology).

Contribution of authors

L. Fan: experimentation, writing and data analysis and interpretation; W. Yotov: conception of project and experimentation; T. Zhu: experimentation; L. Esmaizadeh: experimentation; J.S. Joyal: experimentation; F. Sennlaub: data analysis and interpretation; N. Heveker: data analysis and interpretation; S. Chemtob: organization of experimental activities, writing, data analysis and interpretation; G.E. Rivard: conception, organization of experimental activities, writing, data analysis and interpretation.

Ancillary