SEARCH

SEARCH BY CITATION

Keywords:

  • cell-surface plasmin activity;
  • fibroblasts;
  • iron depletion;
  • mRNA binding protein;
  • PAI-1;
  • post-transcriptional

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Summary.  The proteinase inhibitor, type-1 plasminogen activator inhibitor (PAI-1), is a major regulator of the plasminogen activator system involved in plasmin formation and fibrinolysis. The present study explores the effects of intracellular iron on the expression of PAI-1 and associated cell-surface plasmin activity in human lung fibroblasts; and reports the presence of a novel iron-responsive protein. ELISA revealed a dose-dependent increase in PAI-1 antigen levels expressed in the conditioned medium of cells treated with deferoxamine, in the three cell lines studied. A concomitant increase in mRNA levels was also observed by Northern analyses. Presaturation with ferric citrate quenched the effect of deferoxamine. Experiments with transcription and translation inhibitors on TIG 3-20 cells demonstrated that intracellular iron modulated PAI-1 expression at the post-transcriptional level with the requirement of de-novo protein synthesis. Electrophoretic mobility shift assay and UV crosslinking assays revealed the presence of an ∼ 81-kDa nuclear protein that interacted with the 3′-UTR of PAI-1 mRNA in an iron-sensitive manner. Finally, we demonstrated that the increased PAI-1 is functional in suppressing cell-surface plasmin activity, a process that can affect wound healing and tissue remodeling.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Type-1 plasminogen activator inhibitor (PAI-1), the major inhibitor of both urokinase- (u-PA) and tissue-type (t-PA) plasminogen activators, is a 50-kDa glycoprotein present in blood platelets and synthesized by endothelial cells, muscle cells and fibroblast cells [1]. It is the primary negative regulator of plasmin generation and extracellular proteolysis, functioning primarily by forming stochiometric complexes with active plasminogen activators, which are subsequently endocytosed and degraded [1]. Through its ability to alter the fibrinolytic environment, PAI-1 could manifest its effects during wound healing by temporally regulating the extent of fibrin-rich provisional matrix, allowing for fibroblast migration into the wound and eventual replacement of fibrin with collagen [2]. Fibroblasts are responsible for extracellular matrix (ECM) deposition and remodeling during wound repair [3]. They are known to migrate into and proliferate within crosslinked fibrin in vitro, and are capable of generating cell-associated plasminogen activation and inhibition. They are thus well equipped as well as well located to modulate fibrinolysis within tissue fibrin deposits [3].

PAI-1 may be an important mediator of pulmonary fibrosis which occurs when the normal regulation of tissue repair process is disrupted [4]. Iron is also believed to be profibrogenic [5] and is released from hemoglobin of degraded erythrocytes, ferritin, hemosiderin, aconitase, etc. via the attack of reactive oxygen species (ROS) and proteolytic enzymes occuring in non-healing wounds [6]. Previous work in our laboratory showed that globin moiety of hemoglobin upregulated u-PA protein in cultured fibroblast cells [7]. Since iron (a component of hemoglobin) modulates the expression of several genes, either transcriptionally or post-transcriptionally [8–12], we proceeded to study the role of iron in the regulation of plasminogen system components. So far, no work has been carried out on iron-mediated regulation of PAI-1 expression in fibroblast cells. In continuance of our research theme involving the iron and plasminogen system, the current study explored the effects of iron depletion on the expression of PAI-1 and the associated cell surface plasmin activity in cultured human lung fibroblasts, as we believe that manipulation of PAI-1 and iron within the microenvironment could help in creating a balance between tissue destructive and repair events.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Cell culture

Human lung fibroblast cells, TIG 3-20, TIG 7-20 and WI-38 (from National Institute of Health Sciences, Japanese Collection of Research Bioresources) were cultured in Eagle's minimal essential medium (MEM) with heat-inactivated 10% fetal bovine serum, 100 U mL−1 penicillin and 100 mg mL−1 streptomycin at 37 °C in a humidified, 5% CO2 environment. Cells in the early passage (30–35 population doubling level) were used for the experiments. Semiconfluent cells were washed with phosphate-buffered saline (PBS) and changed to serum-free medium, 2 h prior to the experiments. All chemicals used were from Sigma Chemical Co. (St Louis, MO, USA) unless otherwise specified.

Determination of PAI-1 antigens

Cells were incubated for 16 h with/without deferoxamine, an iron chelator, or with the chelator presaturated with ferric citrate (specificity control). The conditioned medium was centrifuged at 8000 × g to remove cell debris. Levels of PAI-1 antigens in the conditioned medium were measured by ELISA using Biopool IMULYSETM PAI-1 kits (Meditech, Ventura, CA, USA) according to the manufacturer's instructions. The assay detects active and latent PAI-1 (free forms) while complexes are poorly detected. The results of antigen assays are expressed as mean ± SD of quadruplicate experiments.

Northern blot analysis

Total RNA was isolated from treated cells by phenol- chloroform extraction. Total RNA (10 µg), as determined spectrophotometrically, was subjected to electrophoresis in 1.2% agarose gels containing 2.2 m formaldehyde, transferred to Hybond N filters (Amersham Pharmacia Biotech Ltd, Little Chalfont, UK) and immobilized by UV exposure in a UV crosslinker. The filters were hybridized with flourescein-labeled cDNA probes using the Gene Images Random prime Labelling and Detection System (Amersham, South Clearbrook, IL, USA) according to the manufacturer's instructions. The 1.2-kb human PAI-1 cDNA probe containing the base sequence from nucleotides 107–1345 (GenBank Accession no. BC010860) was used as cDNA probe. mRNA signals obtained were quantified with a Luminescent Image Analyzer LAS-1000 plus (Fuji, Tokyo, Japan). The 3.2-kb blots of PAI-1 mRNA were quantified by densitometry scanning and normalized against corresponding 18s rRNA blots. Values were plotted as the ratio of normalized PAI-1 levels to control, or time zero, as the case may be.

Plasmid construction

Human PAI-1 3′-UTR cDNA was synthesized by reverse transcriptase-polymerase chain reaction (RT-PCR) using total RNA isolated from WI-38 cells. Forward primer 5′-GGAAAGAAGCTTTCATCTGGGACAAAACTGGAGAT-3′ corresponded to nucleotides 1338–1372 of human PAI-1 mRNA sequence, with mutations at positions 1345 (C[RIGHTWARDS ARROW]A) and 1348 (C[RIGHTWARDS ARROW]T) to generate a Hind III site. Reverse primer 5′- TTTTTTCTCGAGTTTAAATAATATTATTTTCCTTAGTAGTTCTCTTTCTC-3′ corresponded to nucleotides 2199–2150 of human PAI-1 mRNA sequence, with mutations at positions 2193 (T[RIGHTWARDS ARROW]C) and 2192 (G[RIGHTWARDS ARROW]T) to generate a Xho I site. Amplification was performed using Pfu Turbo DNA polymerase (Stratagene Cloning Systems, La Jolla, CA, USA) for 35 cycles of 94 °C for 1 min, 45 °C for 1 min and 72 °C for 2 min, followed by extension at 72 °C for 10 min, in a Techne thermocycler (Cyclogene, Cambridge, UK). The PCR product was digested with Xho I and Hind III, subcloned into pBluescript II SK+ vector and the resultant plasmid DNA containing the 3′-UTR sequence was purified using Wizard® Plus SV Minipreps DNA purification system (Promega, Madison, WI, USA).

In vitrotranscription

DNA templates for in vitro transcription were obtained by linearizing the plasmid DNA with Xho I (for sense) or Eco RI (for antisense), followed by phenol-chloroform extraction. Digoxigenin (DIG)-labeled sense and antisense PAI-1 mRNA-3′-UTRs were generated by in vitro transcription of Xho I or Eco RI digests with T3 or T7 RNA polymerases, respectively, using the DIG RNA labeling kit (Roche Diagnostics, Penzberg, Germany).

Preparation of cytoplasmic and nuclear extracts

Cytoplasmic and nuclear extracts from TIG 3-20 cells treated with or without deferoxamine, were prepared as per standard methods [13], with slight modifications. Briefly, cells were washed in cold PBS and suspended in hypotonic buffer containing 20 mm HEPES (pH 7.0), 10 mm KCl, 1 mm MgCl2, 0.5 mm DTT, 2 mm phenylmethylsulfonyl fluoride, 0.1% Triton X and 20% glycerol. Cells were then homogenized and centrifuged at 700 g for 5 min at 4 °C. Supernatant was collected as cytoplasmic fraction. The pellet was resuspended in the hypotonic solution containing 420 mm NaCl, placed on a spinning wheel for 20 min at 4 °C and centrifuged at 18 000 g for 10 min at 4 °C. The supernatant was used as nuclear extract. Protein concentrations of cytoplasmic and nuclear fractions were measured with a BCA protein assay reagent kit (Pierce, Rockford, IL, USA) with serum albumin standards.

Electrophoretic mobility shift assay

Protein binding assays were performed using DIG-labeled transcripts corresponding to 3′-UTR of PAI-1 mRNA. DIG-labeled sense RNA was incubated with either cytoplasmic or nuclear extracts in 15 mm KCl, 5 mm MgCl2, 0.25 mm EDTA, 0.25 mm DTT, 12 mm HEPES (pH 7.9), 10% glycerol and Escherichia coli tRNA (20 µg mL−1) at 30 °C for 30 min. The reaction mixtures were further incubated at 37 °C for 30 min after treating with RNase A (1 mg mL−1) to remove unbound RNA. Heparin was added to avoid non-specific protein binding and the mixture incubated at room temperature for an additional 10 min. The extracts were separately incubated with DIG-labeled 3′-UTR antisense mRNA to serve as controls, to check the specificity of protein binding. The mixtures were electrophoresed in 5% native polyacrylamide gels with 0.5 × TBE buffer. The gels were transferred to Hybond N filters (Amersham Pharmacia Biotech Ltd) using a Sartorius semidry electroblotter and immobilized by UV exposure in a UV crosslinker. mRNA-protein bands were detected by an immunoassay using anti-DIG–alkaline phosphatase conjugate (Enzo, Boehringer Mannheim, Germany) and chemiluminescent substrate CDP-star (Amersham Biosciences UK Ltd).

UV crosslinking assay

Nuclear extracts were incubated with DIG-labeled PAI-1 3′-UTR mRNA and treated with heparin as described for the electrophoretic mobility shift assay (EMSA). Reaction mixtures were then placed on ice and exposed to UV light (UV Stratalinker 1800; Stratagene) at a distance of 2.5 cm from the light source for 10 min (2.5 µJ cm−2). RNase A (1 mg mL−1) was added and incubated at 37 °C for 10 min, to digest unbound RNA probe. The mixtures were electrophoresed on 12.5% SDS–PAGE and electroblotted to Hybond N filters. RNA–protein complexes were detected as for EMSA.

Cell-surface plasmin activity assay

Cell-surface plasmin activity assay was conducted as per standard protocol [14]. Briefly, confluent cells in 12-well plates were treated with or without 0.25 mm deferoxamine, for 16 h, washed in PBS and incubated in serum-free MEM containing 20 µg mL−1 plasminogen for 3 h. Cells were again washed in PBS and incubated in 100 µL of 1 mm tranexamic acid in PBS, pH 7.4 for 15 min, to facilitate dissociation of cell surface plasmin. Fifty microliters of the samples were incubated with chromagenic substrate, S-2251 (1 mm in 75 µL of 0.1 m Tris, pH 8.0) at 37 °C for 2 h. The amount of p-nitroaniline released was measured at 405 nm in a plate reader, and referenced to a plasmin standard curve, run parallel to the samples. In separate experiments, cells were incubated with 200 µg mL−1 PAI-1 mAb for 1 h following treatment with deferoxamine, and proceeded as described above.

Statistical analysis

Multiple means were compared with one-way anova, followed by Student's t-test for paired comparisons with the control. Statistical analysis was carried out using GraphPad Prism™ v2.0 (San Diego, CA, USA).

Each experiment was conducted in quadruplicates; a representative set of data is provided in the figures.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Preliminary experiments (data not shown) and earlier reports [15,16] demonstrated that serum in culture medium causes an increase in PAI-1 expression. Moreover, intracellular iron levels of cells and their response to deferoxamine is growth medium dependent [11,17–19]. Hence, to avoid aberrant results, serum-free medium was used in all experiments. Culture of cells in serum-free medium resulted in low PAI-1 expression by cells. This finding is in agreement with earlier reports that young cells show decreased PAI-1 expression under serum starvation [20,21]. The three fibroblast cell lines studied differed in their amounts of PAI-1 expression, as determined by ELISA. The WI-38 cell line expressed relatively low amounts of PAI-1 antigen in comparison with TIG 3-20 and TIG 7-20 cell lines. The cell lines also differed in their degree of response to iron depletion. TIG 3-20 cells were observed to be more sensitive to deferoxamine. A 2-fold increase in PAI-1 antigen level was noticed in TIG 3-20 cells at a deferoxamine concentration of 0.5 mm, while TIG 7-20 and WI-38 cells required a higher concentration of 1 mm deferoxamine to attain the 2-fold increase (Fig. 1). Iron-presaturated deferoxamine did not elicit an increase in PAI-1 expression.

image

Figure 1. Plasminogen activator inhibitor (PAI)-1 antigen levels measured by ELISA, in conditioned media of the three cell lines after 16 h of incubation with deferoxamine, at concentrations ranging from 0 to 1000 µm. 250+ Fe denotes presaturation of deferoxamine with equimolar concentrations (250 µm) of ferric citrate. Data represent mean ± SD of quadruplicate experiments. *P < 0.01; **P < 0.001 in comparison with controls.

Download figure to PowerPoint

Northern analysis was conducted to address the question whether the increase in PAI-1 expression was due to increased levels of PAI-1 mRNA. As shown in Fig. 2, PAI-1 mRNA increased with deferoxamine treatment in a dose-dependent manner, with TIG 3-20 displaying higher sensitivity to deferoxamine than TIG 7-20 and WI-38 cells. Since TIG 3-20 demonstrated a higher degree of sensitivity than the other cell lines, we proceeded with further experiments using TIG 3-20 fibroblasts.

image

Figure 2. Dose-dependent effect of deferoxamine on plasminogen activator inhibitor (PAI)-1 mRNA in the three cell lines, measured after 16 h of incubation. Fe3+ denotes presaturation of deferoxamine with equimolar concentrations (0.25 mm) of ferric citrate. PAI-1 mRNA expression was analyzed by Northern blotting. mRNA blots were quantified by densitometric scanning of the 3.2-kb species and normalized against corresponding 18s rRNA blots. Values were plotted on graph as a ratio of normalized PAI-1 levels to that of control. Data represent the mean ± SD of quadruplicate experiments. *P < 0.01; **P < 0.001 in comparison with controls.

Download figure to PowerPoint

The effect of deferoxamine on PAI-1 mRNA was studied over a period of 8 h. Figure 3 depicts the difference between deferoxamine-treated and non-treated (control) cells. Incubation of cells in serum-free medium resulted in a gradual decline in PAI-1 mRNA expressed by the cells. However, in similar conditions, deferoxamine caused an initial increase followed by a steady-state level of PAI-1 mRNA to be established. The steady-state mRNA expression was obtained even in the event of transcription inhibition by 5, 6-dichloro-1-β-D-ribofuranosyl benzamidole (DRB)(Fig. 4). Cells pretreated with deferoxamine for 2 h were exposed to DRB to prevent new RNA synthesis. Time 0 denoted the time of DRB addition. Northern analyses was conducted over a period of 8 h, during which deferoxamine-treated cells expressed a relatively stable state of PAI-1 mRNA in comparison with the control cells, which revealed a gradual fall in the mRNA expression.

image

Figure 3. Time course effect of deferoxamine (0.25 mm) on plasminogen activator inhibitor (PAI)-1 mRNA in TIG 3-20 fibroblasts. Cells were pretreated with serum-free medium for 2 h, followed by incubation in fresh serum-free medium with deferoxamine (DFO) or without deferoxamine (control). Total RNA was isolated at specified time intervals and subjected to Northern analysis. mRNA blots were quantified by densitometric scanning of the 3.2-kb species and normalized against corresponding 18s rRNA blots. Values were plotted on graph as a ratio of normalized PAI-1 levels to that of time zero. Data represent mean ± SD of quadruplicate experiments.

Download figure to PowerPoint

image

Figure 4. Transcription inhibition study of deferoxamine action on plasminogen activator inhibitor (PAI)-1 mRNA. TIG 3-20 cells were pretreated with serum-free medium for 2 h followed by incubation in fresh serum-free medium with (DFO) or without deferoxamine (control), for a further 2 h. DRB (10 µg mL−1) was then added to prevent new transcription. Total RNA was isolated at various time intervals and subjected to Northern analysis. mRNA blots were quantified by densitometric scanning of the 3.2-kb species and normalized against corresponding 18s rRNA blots. Values were plotted on graph as a ratio of normalized PAI-1 levels to that of time zero. Time zero is the time of DRB addition. Data represent mean ± SD of quadruplicate experiments.

Download figure to PowerPoint

The effect of deferoxamine on PAI-1 mRNA expression was tested in the event of translation inhibition, wherein cells were treated with cycloheximide, either alone or with deferoxamine. Protein synthesis inhibition elicited significant increase in PAI-1 mRNA (Fig. 5). Comparison of PAI-1 blots of the control groups of Figs 3 and 5 reveals the effect of cycloheximide on PAI-1 expression. However, within Fig. 5, no significant difference was obtained between control and deferoxamine-treated groups, with the levels of PAI-1 mRNA increasing about 3-fold in both groups (Fig. 5). This indicated that iron depletion failed to affect the rate of PAI-1 turnover in the absence of de novo protein synthesis. In other words, de novo protein synthesis was necessary for the deferoxamine action of PAI-1. Probably, iron depletion causes an increase in the expression of a protein factor which in turn affects PAI-1 mRNA stability. It is noteworthy that iron availability regulates transferrin receptor, ferritin and several other genes by a post-transcriptional mechanism [22], wherein stability of mRNA is regulated by the iron-dependent interaction of members of the IRP (iron regulatory protein) family with iron responsive elements (IREs) in the 3′-UTR or 5′-UTR. This striking analogy prompted us to test whether an IRP played a role in PAI-1 mRNA stability in TIG 3-20 fibroblasts. To this effect, cytosolic and nuclear extracts of deferoxamine-treated and control cells were incubated separately with DIG-labeled PAI-1 3′UTR sense and antisense mRNAs, treated with RNase A and heparin and analyzed by EMSA. As shown in Fig. 6A, nuclear extracts revealed the presence of a single, specific complex with the PAI-1 3′-UTR sense (lanes 3–5), but not with the antisense mRNA (lanes 6–8). The intensity of the RNA–protein complex was stronger in deferoxamine-treated cells (lane 3), in comparison with both the controls (lanes 4 and 5). No complex was detected in the absence of the extracts (lanes 1 and 2). Complex formation was not detected with cytosolic extracts either (data not shown). These data suggest the specificity of the nuclear protein to the 3′-UTR of PAI-1 mRNA.

image

Figure 5. Translation inhibition study of deferoxamine action on plasminogen activator inhibitor (PAI)-1 mRNA. TIG 3-20 cells were pretreated with serum-free medium for 2 h followed by treatment with 10 µg mL−1 cycloheximide alone (control) or along with 0.25 mm deferoxamine (DFO). Total RNA was isolated at indicated time intervals and analyzed for PAI-1 mRNA signals, as mentioned above. Data represent mean ± SD of quadruplicate experiments.

Download figure to PowerPoint

image

Figure 6. (A) Electrophoretic mobility shift assay showing specific interaction between nuclear extracts and 3′-UTR of plasminogen activator inhibitor (PAI)-1 mRNA. Nuclear extracts of TIG 3-20 cells treated with/without deferoxamine were separately incubated with digoxigenin (DIG)-labeled 3′-UTR sense and antisense PAI-1 mRNAs, and analyzed by native PAGE. Arrow indicates RNA–protein complex. FP, Free probe. (B) Stable RNA–protein complex of nuclear extract from deferoxamine-treated (DFO) and control cells was analyzed by UV crosslinking assay to determine the relative size of the nuclear protein. Standard molecular markers of known molecular weight were run parallel to the samples.

Download figure to PowerPoint

The RNA–protein complex was next subjected to UV irradiation and analyzed by SDS–PAGE, to obtain the apparent size of the binding protein. Parallel running of standard molecular markers revealed the nuclear protein to be approximately 81 kDa in size (Fig. 6B).

Cell surface plasmin activity

To investigate if iron depletion had a substantial effect on cell-surface plasmin generation, we conducted a cell-surface plasmin activity assay using the chromogenic substrate, S-2251. Treatment with deferoxamine significantly suppressed plasmin activity (P < 0.01) (Fig. 7), while presaturation with iron nullified the deferoxamine-induced suppression. Effect of deferoxamine was also not observed in the presence of PAI-1 mAb, implying that the deferoxamine influence on cell-surface plasmin activity was a result of increased PAI-1 expression induced by intracellular iron depletion.

image

Figure 7. Effect of deferoxamine on cell-surface plasmin activity. Cells were treated with (+) or without (–) plasminogen activator inhibitor (PAI)-1 mAb as described in Materials and methods. *P < 0.01 for control vs. deferoxamine.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

PAI-1 is the major negative regulator of plasmin formation and fibrinolysis [1]. Accumulation of PAI-1 at sites of fibrin formation inhibits fibrinolysis and matrix metallo-proteinase (MMP) activation and it has a vital role in matrix remodeling [1]. Induced expression of PAI-1 accompanies wound repair in vitro and in vivo[15,23]. Appropriate expression of the inhibitor is necessary to prevent both premature as well as excessive proteolysis, both of which will affect normal tissue repair/remodeling processes. While elevated levels are associated with artherosclerosis and thrombosis, PAI-1 deficiency leads to increased fibrinolysis and bleeding [24]. PAI-1 gene expression can be modulated by various factors including growth factors, hormones, endotoxins and cytokines, acting at either the transcriptional or post-transcriptional levels [25–31]. The 3.2-kb species of human PAI-1 mRNA, characterized by a long-3′-UTR, has a relatively short half-life [32]. Growth factors and hormones regulate PAI-1 gene expression by increasing the stability of the unstable 3.2-kb PAI-1 mRNA species [33]. Our study reports the stability of the 3.2-kb PAI-1 mRNA species caused by iron depletion in normal human lung fibroblasts.

Iron depletion was caused by exposure to deferoxamine, an iron chelator, which binds stoichiometrically to ferric iron available in free form in the intracellular pool [34,35]. It is widely used in in vitro studies on intracellular iron, to deplete the cells of transient low-molecular-weight iron pool [36]. It is reported to be effective in increasing the expression of vascular endothelial growth tissue, GLUT-1, transferrin receptor, cyclooxygenase (COX)-2 and decreasing XOR activity [11,37–39]. Deferoxamine caused a dose-dependent increase in PAI-1 expression relative to both the controls, in all the fibroblast cell lines studied. The specificity control with iron-presaturated deferoxamine confirmed that the effect was specifically due to iron depletion, since ferric citrate combines at a 1 : 1 ratio with deferoxamine, rendering it unavailable to act on intracellular iron pool. Iron modulates the expression of several genes either at the transcriptional or post-transcriptional level. In the current study, DRB- and cycloheximide-based experiments emphasized a post-transcriptional regulation that depended on de novo protein synthesis. DRB, an inhibitor of polymerase II-mediated transcription [40], failed to abrogate the deferoxamine-induced steady-state level of PAI-1 mRNA. A similar post-transcriptional influence has been reported on transferrin receptor mRNA, COX-2 and XOR activity [22,41]. Ongoing protein synthesis played a crucial role in deferoxamine-mediated stability of PAI-1 mRNA. Protein synthesis inhibition causes PAI-1 mRNA accumulation or super-induction [15,42–44]. We observed similar results, where cycloheximide by itself caused PAI-1 mRNA accumulation in TIG 3-20 cells. However, deferoxamine did not induce further PAI-1 mRNA accumulation in the presence of cycloheximide. A similar inhibitory effect of cycloheximide on deferoxamine action has been previously observed in GLUT-1, COX-2 and transferrin receptor expression [9,39,45]. Deferoxamine-induced PAI-1 mRNA stability may be dependent on the synthesis of protein factor(s). Subsequent EMSA and UV crosslinking experiments revealed the presence of an 81-kDa nuclear protein, which seemingly interacted with the 3′-UTR of PAI-1 mRNA in an iron-sensitive manner. This mRNA–protein complex formation could regulate PAI-1 mRNA stability in an iron-dependent manner. Reports on protein factors binding to and regulating the stability of mRNAs are profuse [46]. These proteins can occur in either the cytoplasm [47] or nucleus [48–51], in addition to shuttling between the two compartments [46,52]. The best studied example of mRNA stabilizing proteins is the 98-kDa iron responsive protein 1 (IRP1), which stabilizes transferrin receptor mRNA in an iron-responsive manner [53], in addition to modulating the expression of other genes such as ferritin, m-aconitase, EACA, etc. [41]. Iron deprivation causes a structural conformation change in IRP1, increasing its affinity to the mRNAs. Another cytoplasmic protein, IRP2 (105 kDa), specifically modulates the ferritin expression in an iron-responsive fashion [41,54]. In this case, iron deprivation prevents the degradation of IRP2 which subsequently binds to and stabilizes ferritin mRNA. Since PAI-1 mRNA stability induced by iron deprivation was dependent on de novo protein synthesis, it is interesting to hypothese that iron depletion increased the expression of a protein that is expressed at low levels in normal conditions. A greater amount of protein could result in more protein–RNA complex formation and subsequent stabilization of PAI-1 mRNA. The iron-responsive proteins, IRP1 and IRP2, bind specifically to sequences termed iron-responsive elements occurring at either 3′-UTR or 5′-UTR of the mRNAs [55–57]. These consensus iron-responsive sequences are lacking in the 3′-UTR of PAI-1 mRNA, ruling out the possibilities of IRP1 or IRP2 binding to PAI-1 mRNA. We assume that a protein other than IRP1 or IRP2 interacts with PAI-1 mRNA in an iron-responsive manner. Reports on PAI-1 mRNA binding proteins are also emerging with discoveries of cytoplasmic proteins destabilizing PAI-1 mRNA in human lung carcinoma [44] and rat hepatoma cells [26]. We believe that our protein is novel in that it differs from the above-mentioned proteins in size (81 kDa), location (nuclear) and function (stabilizes PAI-1 mRNA). Further work on isolating and characterizing the protein is ongoing in our laboratory.

PAI-1 has a broad array of biological activity. This study reveals the functional efficacy of the increased PAI-1 expression in suppressing cell-surface plasmin generation, an event capable of affecting cell-mediated proteolysis and migration.

In conclusion, this study demonstrates that cellular iron status regulates the expression of PAI-1 via mRNA stability and subsequently the cell-surface plasmin activity in cultured human lung fibroblasts. Low intracellular iron availability stabilizes PAI-1 mRNA, with the probable involvement of a nuclear protein that shows high specificity for the 3′-UTR of PAI-1 mRNA.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References
  • 1
    Rerolle J-P, Hertig A, Nguyen G, Sraer J-D, Rondeau EP. Plasminogen activator inhibitor type 1 is a potential target in renal fibrogenesis. Kidney Int 2000; 58: 184150.
  • 2
    Chan JCY, Duszczyszyn DA, Castellino FJ, Ploplis VA. Accelerated skin wound healing in plasminogen activator inhibitor-1-deficient mice. Am J Pathol 2001; 159: 16818.
  • 3
    Hagood JS, Olman MA, Godoy JA, Rivera KE, Fuller GM. Regulation of type I plasminogen activator inhibitor by fibrin degradation products in rat lung fibroblasts. Blood 1996; 87: 374957.
  • 4
    Andrew A, Barchowsky A. Nickel-induced plasminogen activator inhibitor-1 expression inhibits the fibrinolytic activity of human airway epithelial cells. Toxicol Appl Pharmacol 2000; 168: 507.DOI: 10.1006/taap.2000.9009
  • 5
    Gardi C, Arezzini B, Fortino V, Comporti M. Effect of free iron on collagen synthesis, cell proliferation and MMP-2 expression in rat hepatic stellate cells. Biochem Pharmacol 2002; 64: 113945.DOI: 10.1016/S0006-2952(02)01257-1
  • 6
    Wenk J, Foitzik A, Achterberg V, Sabiwalsky A, Dissemond J, Meewes C, Reitz A, Brenneisen P, Wlaschek M, Meyer-Ingold W, Scharffetter-Kochanek K. Selective pick-up of increased iron by deferoxamine-coupled cellulose abrogates the iron-driven induction of matrix-degrading metalloproteinase 1 and lipid peroxidation in human dermal fibroblasts in vitro: a new dressing concept. J Invest Dermatol 2001; 116: 8339.DOI: 10.1046/j.1523-1747.2001.01345.x
  • 7
    Yoshida E, Ohmura S, Sugiki M, Anai K, Maruyama M. A novel function of extraerythrocytic hemoglobin: identification of globin as a stimulant of plasminogen activator biosynthesis in human fibroblasts. Thromb Haemost 2001; 86: 15217.
  • 8
    Mattia E, Den Blaauwen J, Ashwell G, Van Renswoude J. Multiple post-transcriptional regulatory mechanisms in ferritin gene expression. Proc Natl Acad Sci USA 1989; 86: 18015.
  • 9
    Tanji K, Imaizumi T, Matsumiya T, Itaya H, Fujimoto K, Cui X, Toki T, Ito E, Yoshida H, Wakabayashi K, Satoh K. Desferrioxamine, an iron chelator, upregulates cyclooxygenase-2 expression and prostaglandin production in a human macrophage cell line. Biochim Biophys Acta 2001; 1530: 22735.
  • 10
    Ye Z, Connor JR. Screening of transcriptionally regulated genes following iron chelation in human astrocytoma cells. Biochem Biophys Res Commun 1999; 264: 70913.DOI: 10.1006/bbrc.1999.1554
  • 11
    Beerepoot LV, Shima DT, Kuroki M, Yeo KT, Voest EE. Up-regulation of vascular endothelial growth factor production by iron chelators. Cancer Res 1996; 56: 374751.
  • 12
    Templeton DM, Liu Y. Genetic regulation of cell function in response to iron overload or chelation. Biochim Biophys Acta 2003; 1619: 11324.
  • 13
    Dignam JD, Martin PL, Shastry BS, Roeder RG. Eukaryotic gene transcription with purified components. Methods Enzymol 1983; 101: 58298.
  • 14
    Stephens RW, Pollanen J, Tapiovaara H, Leung KC, Sim PS, Salonen EM, Ronne E, Behrendt N, Dano K, Vaheri A. Activation of pro-urokinase and plasminogen on human sarcoma cells: a proteolytic system with surface-bound reactants. J Cell Biol 1989; 108: 198795.DOI: 10.1083/jcb.108.5.1987
  • 15
    Ryan MP, Kutz SM, Higgins PJ. Complex regulation of plasminogen activator inhibitor type-1 (PAI-1) gene expression by serum and substrate adhesion. Biochem J 1996; 314: 10416.
  • 16
    Arts J, Grimbergen J, Toet K, Kooistra T. On the role of c-Jun in the induction of PAI-1 gene expression by phorbol ester, serum, and IL-1{alpha} in HepG2 cells. Arterioscler Thromb Vasc Biol 1999; 19: 3946.
  • 17
    Rao K, Harford JB, Rouault T, McClelland A, Ruddle FH, Klausner RD. Transcriptional regulation by iron of the gene for the transferrin receptor. Mol Cell Biol 1986; 6: 23640.
  • 18
    Goto Y, Paterson M, Listowsky I. Iron uptake and regulation of ferritin synthesis by hepatoma cells in hormone-supplemented serum-free media. J Biol Chem 1983; 258: 524855.
  • 19
    Voest EE, Rooth H, Neijt JP, Van Asbeck BS, Marx JJ. The in vitro response of human tumour cells to desferrioxamine is growth medium dependent. Cell Prolif 1993; 26: 7788.
  • 20
    West MD, Shay JW, Wright WE, Linskens MH. Altered expression of plasminogen activator and plasminogen activator inhibitor during cellular senescence. Exp Gerontol 1996; 31: 17593.DOI: 10.1016/0531-5565(95)02013-6
  • 21
    Mu XC, Staiano-Coico L, Higgins PJ. Increased transcription and modified growth state-dependent expression of the plasminogen activator inhibitor type-1 gene characterize the senescent phenotype in human diploid fibroblasts. J Cell Physiol 1998; 174: 908.DOI: 10.1002/(SICI)1097-4652(199801)174:1<90::AID-JCP10>3.0.CO;2-S
  • 22
    Rouault TA. Post-transcriptional regulation of human iron metabolism by iron regulatory proteins. Blood Cells Mol Dis 2002; 29: 30914.DOI: 10.1006/bcmd.2002.0571
  • 23
    Pepper MS. Extracellular proteolysis and angiogenesis. Thromb Haemost 2001; 86: 34655.
  • 24
    Van Meijer M, Pannekoek H. Structure of plasminogen activator inhibitor 1 (PAI-1) and its function in fibrinolysis: an update. Fibrinolysis 1995; 9: 26376.
  • 25
    Irigoyen JP, Munoz-Canoves P, Montero L, Koziczak M, Nagamine Y. The plasminogen activator system: biology and regulation. Cell Mol Life Sci 1999; 56: 10432.
  • 26
    Heaton JH, Dlakic WM, Dlakic M, Gelehrter TD. Identification and cDNA cloning of a novel RNA-binding protein that interacts with the cyclic nucleotide-responsive sequence in the type-1 plasminogen activator inhibitor mRNA. J Biol Chem 2001; 276: 33417.DOI: 10.1074/jbc.M006538200
  • 27
    Shetty S, Bdeir K, Cines DB, Idell S. Induction of plasminogen activator inhibitor-1 by urokinase in lung epithelial cells. J Biol Chem 2003; 278: 1812431.DOI: 10.1074/jbc.M207445200
  • 28
    Sandler M, Zhang J, Westerhausen D Jr, Billadello J. A novel protein interacts with the major transforming growth factor- beta responsive element in the plasminogen activator inhibitor type-1 gene. J Biol Chem 1994; 69: 215004.
  • 29
    Hasegawa T, Sorensen L, Ooi H, Marshall BC. Decreased intracellular iron availability suppresses epithelial cell surface plasmin generation. Transcriptional and post-transcriptional effects on u-PA and PAI-1 expression. Am J Respir Cell Mol Biol 1999; 21: 27582.
  • 30
    Yeh LC, Mikhailov V, Lee JC. Regulation of expression of plasminogen activator inhibitor-1 in cultured rat osteoblastic cells by osteogenic protein-1 (BMP-7). J Cell Biochem 2001; 81: 4654.DOI: 10.1002/jcb.1071
  • 31
    Horton MR, Olman MA, Bao C, White KE, Choi AMK, Chin B-Y, Noble PW, Lowenstein CJ. Regulation of plasminogen activator inhibitor-1 and urokinase by hyaluronan fragments in mouse macrophages. Am J Physiol Lung Cell Mol Physiol 2000; 279: L70715.
  • 32
    Bosma PJ, Kooistra T. Different induction of two plasminogen activator inhibitor 1 mRNA species by phorbol ester in human hepatoma cells. J Biol Chem 1991; 266: 178459.
  • 33
    Fattal P, Schneider D, Sobel B, Billadello J. Post-transcriptional regulation of expression of plasminogen activator inhibitor type 1 mRNA by insulin and insulin-like growth factor 1. J Biol Chem 1992; 267: 124125.
  • 34
    Faa GCG. Iron chelating agents in clinical practice. Coordination Chem Rev 1999; 184: 291310.DOI: 10.1016/S0010-8545(99)00056-9
  • 35
    Cazzola M, Bergamaschi G, Dezza L, Arosio P. Manipulations of cellular iron metabolism for modulating normal and malignant cell proliferation: achievements and prospects. Blood 1990; 75: 190319.
  • 36
    Rothman RJ, Serroni A, Farber JL. Cellular pool of transient ferric iron, chelatable by deferoxamine and distinct from ferritin, that is involved in oxidative cell injury. Mol Pharmacol 1992; 42: 70310.
  • 37
    Fast B, Kremp K, Boshart M, Steverding D. Iron-dependent regulation of transferrin receptor expression in Trypanosoma brucei. Biochem J 1999; 342: 6916.DOI: 10.1042/0264-6021:3420691
  • 38
    Martelin E, Lapatto R, Raivio KO. Regulation of xanthine oxidoreductase by intracellular iron. Am J Physiol Cell Physiol 2002; 283: C17228.
  • 39
    Hoepken HH, Korten T, Robinson SR, Dringen R. Iron accumulation, iron-mediated toxicity and altered levels of ferritin and transferrin receptor in cultured astrocytes during incubation with ferric ammonium citrate. J Neurochem 2004; 88: 1194202.DOI: 10.1046/j.1471-4159.2003.02236.x
  • 40
    Yankulov K, Yamashita K, Roy R, Egly J-M, Bentley DL. The transcriptional elongation inhibitor 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole inhibits transcription factor IIH-associated protein kinase. J Biol Chem 1995; 270: 239225.DOI: 10.1074/jbc.270.41.23922
  • 41
    Posch M, Sutterluety H, Skern T, Seiser C. Characterization of the translation-dependent step during iron-regulated decay of transferrin receptor mRNA. J Biol Chem 1999; 274: 166118.DOI: 10.1074/jbc.274.23.16611
  • 42
    Mayer M, Lund LR, Riccio A, Skouv J, Nielsen LS, Stacey SN, Dano K, Andreasen PA. Plasminogen activator inhibitor type-1 protein, mRNA and gene transcription are increased by phorbol esters in human rhabdomyosarcoma cells. J Biol Chem 1988; 263: 1568893.
  • 43
    Van Den Berg EA, Sprengers ED, Jaye M, Burgess W, Maciag T, Van Hinsbergh VW. Regulation of plasminogen activator inhibitor-1 mRNA in human endothelial cells. Thromb Haemost 1988; 60: 637.
  • 44
    Shetty S, Idell S. Posttranscriptional regulation of plasminogen activator inhibitor-1 in human lung carcinoma cells in vitro. Am J Physiol Lung Cell Mol Physiol 2000; 278: L14856.
  • 45
    Koeller DM, Horowitz JA, Casey JL, Klausner RD, Harford JB. Translation and the stability of mRNAs encoding the transferrin receptor and c-fos. Proc Natl Acad Sci USA 1991; 88: 777882.
  • 46
    Ross J. mRNA stability in mammalian cells. Microbiol Rev 1995; 59: 42350.
  • 47
    Leibold EA, Munro HN. Cytoplasmic protein binds in vitro to a highly conserved sequence in the 5′ untranslated region of ferritin heavy- and light-subunit mRNAs. Proc Natl Acad Sci USA 1988; 85: 21715.
  • 48
    Shih SC, Claffey KP. Regulation of human vascular endothelial growth factor mRNA stability in hypoxia by heterogeneous nuclear ribonucleoprotein L. J Biol Chem 1999; 274: 135965.DOI: 10.1074/jbc.274.3.1359
  • 49
    Rajagopalan LE, Westmark CJ, Jarzembowsk JA, Malter JS. hnRNP C increases amyloid precursor protein (APP) production by stabilizing APP mRNA. Nucl Acids Res 1998; 26: 341823.DOI: 10.1093/nar/26.14.3418
  • 50
    Kiledjian M, DeMaria CT, Brewer G, Novick K. Identification of AUF1 (heterogeneous nuclear ribonucleoprotein D) as a component of the alpha-globin mRNA stability complex. Mol Cell Biol 1997; 17: 48706.
  • 51
    Zaidi SH, Malter JS. Nucleolin and heterogeneous nuclear ribonucleoprotein C proteins specifically interact with the 3′-untranslated region of amyloid protein precursor mRNA. J Biol Chem 1995; 270: 172928.DOI: 10.1074/jbc.270.29.17292
  • 52
    Shetty S. Cytoplasmic–nuclear shuttling of the urokinase mRNA binding protein regulates message stability. Mol Cell Biochem 2002; 237: 5567.DOI: 10.1023/A:1016558200199
  • 53
    Klausner RD, Harford JB. Cis-trans models for post-transcriptional gene regulation. Science 1989; 246: 8702.
  • 54
    Henderson BR, Menotti E, Kuhn LC. Iron regulatory proteins 1 and 2 bind distinct sets of RNA target sequences. J Biol Chem 1996; 271: 49008.DOI: 10.1074/jbc.271.9.4900
  • 55
    Casey JL, Hentze MW, Koeller DM, Caughman SW, Rouault TA, Klausner RD, Harford JB. Iron-responsive elements: regulatory RNA sequences that control mRNA levels and translation. Science 1988; 240: 9248.
  • 56
    Menotti E, Henderson BR, Kuhn LC. Translational regulation of mRNAs with distinct IRE sequences by iron regulatory proteins 1 and 2. J Biol Chem 1998; 273: 18214.DOI: 10.1074/jbc.273.3.1821
  • 57
    Erlitzki R, Long JC, Theil EC. Multiple, conserved iron-responsive elements in the 3′-untranslated region of transferrin receptor mRNA enhance binding of iron regulatory protein 2. J Biol Chem 2002; 277: 4257987.DOI: 10.1074/jbc.M207918200