SEARCH

SEARCH BY CITATION

Keywords:

  • apoptosis;
  • endothelium;
  • forkheads;
  • gas6;
  • p27kip1;
  • vascular biology

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. Disclosure of Conflict of Interests
  9. References

Summary. Background: Growth Arrest Specific gene product 6 (gas6) is a γ-carboxylated protein that protects endothelial cells against apoptosis. Gas6 has previously been shown to induce phospatidyl-3-inositol-kinase (PI3K)/Akt signaling. Other studies have demonstrated a link between PI3K/Akt signaling and forkhead transcription factors in endothelial cells. Objective: To test the hypothesis that gas6 promotes cell survival via a forkhead-dependent pathway. Results and Conclusions: Treatment of serum-starved human umbilical vein endothelial cells (HUVECs) with gas6 induced time-dependent phosphorylation and nuclear exclusion of FOXO1a. This effect was suppressed by the PI3K inhibitor wortmannin, demonstrating that FOXO1a phosphorylation is PI3-kinase dependent. Transduction of HUVECs with a phosphorylation-resistant form of FOXO1a [triple mutant (TM)-FOXO1a] abrogated the pro-survival effect of gas6 on serum-starved endothelial cells. Finally, treatment of serum-starved HUVECs with gas6 resulted in a reduction of FOXO1a transcriptional activity and downregulation of the pro-apoptotic gene, p27kip1. Taken together, these findings suggest that gas6 protects endothelial cells from apoptosis by a mechanism that involves PI3K-Akt-dependent inactivation of FOXO1a.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. Disclosure of Conflict of Interests
  9. References

The maintenance of a healthy endothelium is essential for homeostasis and proper functioning of the different organs. As the interface between the bloodstream and tissues, the endothelium participates actively as a barrier, in the trafficking of metabolites, in cell adhesion and in interactions with inflammatory cells, among many other physiological processes [1]. The balance between endothelial cell survival and apoptosis is a critical determinant of angiogenesis, which in turn plays an important role in such conditions as renal transplantation [2], wound healing [3] and tumor progression [4].

Growth Arrest Specific gene product 6 (gas6) is a member of the vitamin K-dependent family of proteins [5] that include the procoagulant factors prothrombin, factor (F) VII, FIX, FX and protein Z, as well as the anticoagulant factors, protein C and protein S [6]. Vitamin K is required for γ-carboxylation of glutamic acid residues. This post-translational modification renders the proteins capable of mediating binding to phospholipid membranes. The vitamin K-dependent proteins contain 9–12 γ-carboxyglutamic residues in an N-terminal domain referred to as the Gla domain. An epidermal growth factor (EGF) domain with four EGF repeats and a steroid hormone globulin-like domain with two LamG repeats are C-terminal to the Gla domain of gas6. The globulin-like domain mediates the binding of gas6 to receptors of the tyrosine kinase family such as Axl, Sky and Mer [7]. In particular, gas6 has a structure that is similar to that of protein S, but has no direct effect in the regulation of thrombin generation [8].

Gas6 is expressed in quiescent fibroblasts [5,9], cells from the central nervous system [10], some tumor cells [11–13], hematopoietic cells [14] and endothelial cells [5,15]. Among the in vitro functions attributable to gas6 are inhibition of granulocyte adhesion to endothelial cells [15], proliferation of mesangial and tumor cells [16,17], phagocytosis by apoptotic cells or retinal pigment epithelial cells [18,19] and inhibition of apoptosis in fibroblasts and endothelial cells [20–22]. Putative roles of gas6 in vivo include vascular remodeling [23], bone resorption [24], development of diabetic nephropathy [25] and platelet signaling-mediated stabilization of thrombus formation [26,27].

We have previously demonstrated that the anti-apoptotic effect of gas6 in cultured endothelial cells involves the phosphorylation of the receptor tyrosine kinase, Axl and secondary activation of PI3K and Akt [28]. In addition, our studies implicated a role for NF-κB phosphorylation, increased Bcl-2 expression and reduced caspase-3 activation [22].

FOXO1a, a member of the forkhead family of transcription factors, has been shown to activate a pro-apoptotic gene expression program in many different cell types [29–31]. Akt-mediated phosphorylation of FOXO1a at threonine 24 and serine residues 256 and 319, results in nuclear exclusion, with consequent suppression of FOXO1a transcriptional activity and inhibition of apoptosis [32,33]. Previous studies have shown that the pro-survival effect of VEGF is mediated – at least in part – by PI3K-Akt-dependent attenuation of forkhead transcriptional activity in endothelial cells [34,35].

The finding that gas6 promotes cell PI3K-Akt signaling and endothelial cell survival, together with the established role for forkhead in VEGF signaling, led us to hypothesize that gas6-dependent rescue of apoptosis requires forkhead transcription factor inactivation.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. Disclosure of Conflict of Interests
  9. References

Endothelial cells

Multiple donor human umbilical vein endothelial cells (HUVECs) (Clonetics; Cambrex Corp, Walkersville, MD, USA) were grown in endothelial growth media-2 (EGM-2) (Clonetics) in gelatin-coated 100-mm dishes, six-well plates or 24-well plates. Cells from up to passage 4 were utilized in all the experiments.

Gas6

Recombinant gas6 was purified from stably-transfected Human Embryonic Kidney (HEK) 293 cells as previously described [28].

Western blotting

Anti-Akt, anti-phospho Akt (ser473), anti-FOXO1a and anti-phospho FOXO1a (ser256) antibodies were purchased from Cell Signaling (Beverly, MA, USA). After various treatments as indicated, cells were washed twice with phosphate-buffered saline (PBS) and incubated on ice for 10 min with lysis buffer [50 mm Tris-HCl, 2 mM EDTA, 1% nonidet 40, 0.05% SDS, 50 mm NaCl, 10 mm sodium phosphate, 10% glycerol, 1 mm orthovanadate and supplied with complete protease inhibitor (Roche, Penzberg, Germany)]. Whole cell extracts were quantified using the Bradford protein Assay and a volume corresponding to 100 μg of protein was used for SDS-PAGE. Gels were transferred to a PVDF membrane (GE Healthcare, Piscataway, NJ, USA), blocked with 5% milk in TBST, and incubated with the primary antibody solution according to the manufacturer’s protocol. The membrane was washed with TBST and incubated with an HRP-conjugated secondary antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) solution. After subsequent washes, the membrane was developed with enzymatic chemiluminescence (ECL) detection reagent (GE Healthcare) according to the manufacturer’s protocol.

Immunofluorescence microscopy

HUVECs were seeded on gelatin-coated cover slips, in six-well plates (1.5 × 105 cells per well) and grown in EGM-2 for 48 h. Medium was then removed and, after washes with PBS, cells were serum-starved for 6 h with serum- and growth factor-free endothelial basal media-2 (EBM-2). Cells were treated for 10 min with 100 ng mL−1 gas6, washed with PBS, fixed with 1% paraformaldehyde for 20 min and permeabilized with 0.1% Triton X-100 in PBS. Subsequently, cells were blocked with 10% fetal swine serum (FSS) (Dako, Carpinteria, CA, USA) in PBS for 1 h, and incubated with 1:50 dilution of the primary anti-FOXO1a antibody (Cell Signaling) in 5% FSS in PBS overnight. Thereafter, the HUVECs were treated with FITC-labeled swine-anti-rabbit IgG (DAKO) in 5% FSS in PBS for 30 min, followed by a 10-min incubation with 0.2% DAPI (Sigma, St. Louis, MO, USA) in PBS. Finally, the cells were mounted on microscope slides with gel mount (Biomeda, Foster City, CA, USA) after several 5-min washes with PBS. To quantify the percentage of cells containing nuclear vs. nuclear excluded FOXO1a, at least 100 stained cells were counted in three independent experiments. The cells were assigned a nuclear status if the nuclei were stained green (FITC) or a nuclear excluded status if the nuclei were not stained. The DAPI counterstain facilitated the localization of the nuclei.

Survival experiments

HUVECs were plated on 100-mm cell culture plates and incubated overnight in EGM-2 in the presence of adenoviral constructs expressing either wild-type (WT)-FOXO1a, triple mutant FOXO1a (TM-FOXO1a), or an empty vector (20 MOI for all three constructs). The HUVECs were then washed with PBS and serum starved for 48 h with EBM-2 in the presence or absence of 100 ng mL−1 gas6. After starvation, the cells were washed with PBS, trypsinized, harvested and centrifuged for 5 min at 200 × g. The cell pellets were then washed in PBS, centrifuged for 5 min at 200 × g and fixed in 70% ethanol at −20 °C for at least 30 min. After fixation, the cells were centrifuged for 5 min at 200 × g, washed with PBS and re-centrifuged under the same conditions for 5 min at 200 × g. Finally, the pellets were resuspended in 0.1% Triton in PBS and Propidium Iodide was added to the suspension, at a final concentration of 20 μg mL−1. Cell survival was analyzed by flow cytometry using sub-G1 analysis [28].

Luciferase assays

HUVECs were plated on 12-well plates at a density of 3.5 × 104 cells per well and incubated overnight in EGM-2. HUVECs were then co-transfected with three different plasmids: (i) a plasmid expressing FOXO1a (pWT-FOXO1a, or pTM-FOXO1a, or an empty vector), (ii) a plasmid containing the forkhead-binding region in the Fas-Ligand promoter after a minimum SV40 promoter and the firefly luciferase gene (pFHRE-Luc, [32]) and (iii) a plasmid containing the Renilla luciferase gene (pRL3). The HUVECs were incubated for 24 h in EGM-2, washed with PBS and serum starved in EBM-2 for 24 h in the presence or absence of 100 ng mL−1 gas6. Finally, the cells were washed with PBS and lysed immediately at room temperature with passive lysis buffer (Promega, Madison, WI, USA). Luciferase assay was carried out with the Stop and Glow dual-luciferase reporter assay system (Promega) according to the manufacturer’s protocol.

Gene expression analyses

HUVECs were plated (0.6 × 106 cells per plate) in 100-mm plates and transduced 4 h later with adenoviruses expressing WT-FOXO1a, TM-FOXO1a, or empty vector. After an overnight incubation in EGM-2, the cells were then washed with PBS and incubated overnight in basal medium EBM-2 followed by a 1-h treatment with 100 ng mL−1 gas6 (or no treatment). The media was then aspirated from the plates and RNA was extracted from the cells with RNeasy (Qiagen, Dusseldorf, Germany). The levels of p27kip1 gene expression were determined as a ratio to actin gene expression by real time (RT)-PCR using faststart DNA Master SYBR green I reaction mix (Roche, Mannheim, Germany) in a Lightcycler thermocycler (Roche). The following primers were used for amplification of p27kip1 and β-actin: p27kipF, CTGCAACCGACGATTCTTCTACT; p27kipR, GGGCGTCTGCTCCACAGA; βactinF, ACAATGAGCTGCGTGTGGCT; βactinR, CTCGTAGATGGGCACAGTGT.

Statistical analyses

Data were compared using the Student’s t-test. Differences with P-values of < 0.05 were considered significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. Disclosure of Conflict of Interests
  9. References

Gas6 induces PI3K/Akt-dependent FOXO1a phosphorylation in primary endothelial cells

We first asked whether gas6 signaling results in phosphorylation of Akt and FOXO1a. To that end, serum-starved HUVECs were treated for varying time points with 100 ng mL−1 gas6 and assayed for phospho-Akt and phospho-FOXO1a by Western blot. As shown in Fig. 1A, gas6 resulted in increased phosphorylation of Akt beginning at 5 min and persisting for at least 15 min. Gas6 promoted FOXO1a phosphorylation at 5 and 15 min. To determine whether the effect of gas6 on FOXO1a phosphorylation was mediated by PI3K/Akt, we incubated serum-starved HUVECs in the absence or presence of the PI3K inhibitor, wortmannin and the cells were then treated with gas6. As demonstrated by Western blot analysis, pretreatment with wortmannin abrogated gas6-mediated phosphorylation of Akt and FOXO1a (Fig. 1B).

image

Figure 1.  Treatment of serum-starved endothelial cells with gas6 results in a time-dependent phosphorylation of Akt and FOXO1a. Serum-starved endothelial cells were treated with phosphate-buffered (PBS) or 100 ng mL−1 gas6 for 5 and 15 min. (A) Membranes blotted with anti phospho-Akt antibodies show Akt phosphorylation after 5 min. Blots with anti phospho-FOXO1a (ser256) antibodies show maximal FOXO1a phosphorylation between 5 and 15 min. Membranes were stripped and blotted with anti Akt, anti FOXO1a and anti β-Actin antibodies as loading controls. (B) Apoptotic human umbilical vein endothelial cells (HUVECs) were incubated with and without 1 μm wortmannin for half an hour prior to a 10-min incubation with 100 ng mL−1 gas6 or PBS as a negative control. Akt and FOXO1a phosphorylation were analyzed by Western blotting of whole cell extracts as described in Materials and methods.

Download figure to PowerPoint

Gas6 induces PI3K-dependent nuclear exclusion of FOXO1a phosphorylation in primary endothelial cells

FOXO transcription factors are normally located in the nucleus, but migrate to the cytoplasm after phosphorylation by Akt, a mechanism triggered during cellular rescue from apoptosis [32]. We therefore investigated whether gas6-mediated phosphorylation of FOXO1a was associated with nuclear exclusion of the transcription factor. Control (PBS) or gas6-treated serum-starved HUVEC were assayed by immunofluorescence, using a primary antibody against FOXO1a followed by a FITC-labeled secondary antibody. Cells were counter stained with DAPI to visualize the nuclei. In the absence of gas6, the majority of FOXO1a was localized in the nucleus. Treatment with gas6 resulted in nuclear exclusion of FOXO1a (Fig. 2A). Quantitative analyses revealed significant differences in the proportion of FOXO1a positive nuclei in control cells (89 ± 4%) and gas6-treated cells (20 ± 8%). In addition, incubation of endothelial cells with Wortmannin blocked gas6-mediated nuclear exclusion of FOXO1a (Fig. 2B) demonstrating that this process is mediated by Akt.

image

Figure 2.  Gas6 promotes nuclear exclusion of FOXO1a in apoptotic human umbilical vein endothelial cells (HUVECs). Apoptotic endothelial cells were treated with phosphate-buffered saline (PBS) or 100 ng mL−1 gas6 for 10 min and stained with an anti-FOXO1a primary antibody. (A) Immunofluorescence micrographs of FOXO1a intracellular localization. FOXO1a was visualized with a FITC-labeled secondary antibody (green, upper panels). Counter stain was performed with DAPI (blue, central panels). FOXO1a localizes in the nucleus (left panels) of serum-starved HUVECs and migrates to the cytoplasm upon treatment with gas6 (right panels). The lower panels display the merged FOXO1a and DAPI fields. (B) Intracellular localization of FOXO1a after half hour incubation with wortmannin was analyzed by fluorescence microscopy, as described above. Results show that FOXO1a phosphorylation and translocation are inhibited by wortmannin, confirming these processes are PI3K/Akt dependent (magnification = 1000×).

Download figure to PowerPoint

Phosphorylation of FOXO1a is required for nuclear exclusion

In order to assess whether gas6-mediated phosphorylation of FOXO1a is required for its nuclear exclusion, we transduced HUVEC with an empty adenovirus (Adv) or with adenovirus overexpressing wild-type FOXO1a (Ad-WT-FOXO1a) or a phosphorylation-resistant form of FOXO1a (Ad-TM-FOXO1a). In the absence of gas6, FOXO1a was localized primarily in the nuclei for all three adenoviral transductions (not shown). Gas6 treatment of endothelial cells expressing WT-FOXO1a, but not TM-FOXO1a demonstrated nuclear exclusion of the transcription factor (Fig. 3). Quantitative analyses in the presence or absence of gas6 are shown in Fig. 3B.

image

Figure 3.  FOXO1a phosphorylation is required for its gas6-mediated nuclear exclusion. Human umbilical vein endothelial cells (HUVECs) were transduced with Ad-WT-FOXO1a, Ad-TM-FOXO1a, or Adv and then serum-starved for 6 h. (A) Immunofluorescence micrographs of HUVECs treated with 100 ng mL−1 gas6 for 10 min. Proper phosphorylation of FOXO1a is necessary for its nuclear exclusion (upper panels, green). Co-nuclear staining was performed with DAPI (blue, central panels). The lower panels display the merged FOXO1a and DAPI fields (magnification = 1000×). (B) Quantification of nuclear vs. nuclear excluded localization of FOXO1a. Data are expressed as means ± SEM. *= 0.005.

Download figure to PowerPoint

Gas6-mediated survival of primary endothelial cells requires nuclear exclusion of FOXO1a

Based on the above observations, we asked whether gas6-mediated phosphorylation-dependent nuclear exclusion of FOXO1a is important for endothelial cell survival. To that end, HUVECs transduced with Ad-WT-FOXO1a or Ad-TM-FOXO1a, or Adv, were serum starved for 48 h and then visualized by phase contrast microscopy or stained with Propidium Iodide and assayed for apoptosis by sub-G1 analysis by flow cytometry. As shown in Fig. 4A, gas6 inhibited serum starvation-induced apoptosis of HUVECs over-expressing WT-FOXO1a, but not TM-FOXO1a. Quantitation with FACS revealed a 21 ± 3% reduction of apoptosis in WT-FOXO1a-transduced HUVECs compared with a 5 ± 3% reduction in TM-FOXO1a-transduced cells (Fig. 4B).

image

Figure 4.  FOXO1a phosphorylation is required for gas6-mediated rescue of serum-starved endothelial cells from apoptosis. Human umbilical vein endothelial cells (HUVECs) transduced with Ad-WT-FOXO1a, Ad-TM-FOXO1a or Adv were serum-starved for 48 h in the presence or absence of gas6. (A) Contrast phase micrographs of HUVECs treated, as indicated, in the presence (lower panels) or absence (upper panels) of gas6. (B) Sub G1 analysis was performed by flow cytometry of cells treated as indicated above. Percentages of apoptotic cells are expressed as means ± SEM (n = 4).*= 0.05. The above results indicate that proper FOXO1a phosphorylation is required for gas6-dependent rescue of HUVECs from apoptosis.

Download figure to PowerPoint

Pro-apoptotic gene expression is regulated by FOXO1a

Nuclear exclusion of phosphorylated forkhead proteins by gas6 may result in reduced transcriptional activity and consequent downregulation of forkhead target genes. To test this hypothesis, we co-transfected HUVECs with an expression vector encoding WT-FOXO1a or TM-FOXO1a and a forkhead-responsive promoter-reporter gene construct encoding luciferase (pFHRE-Luc). Gas6 treatment of serum-starved cells resulted in reduced WT-FOXO1a-mediated transactivation of pFHRE-Luc, but had no effect on TM-FOXO1a-stimulated luciferase activity (Fig. 5A). Thus, gas6-mediated phosphorylation and nuclear exclusion of FOXO1a is associated with a reduction in its transcriptional potential.

image

Figure 5.  Gas6 reduces FOXO1a transcriptional activity. (A) Human umbilical vein endothelial cells (HUVECs) were co-transfected with a plasmid containing a forkhead-responsive firefly luciferase reporter gene, a plasmid for constitutive expression of Renilla luciferase (internal control) and mammalian expression vectors containing either WT-FOXO1a or TM-FOXO1a. HUVECs were serum-starved for 24 h in the presence or absence of 100 ng mL−1 gas6. Gas6-mediated reduction of luciferase expression was only observed in the presence of WT-FOXO1a. (*= 0.04) In the presence of TM-FOXO1a, luciferase expression remained high, both in the presence or absence of gas6. Data are expressed as means ± SEM. (B) Reduction of p27kip1 expression by gas6 is mediated by inactivation of FOXO1a transcriptional activity. Apoptotic HUVECs, previously transduced with Ad-WT-FOXO1a, Ad-TM-FOXO1a or Adv were treated with 100 ng mL−1 gas6, or phosphate-buffered saline (PBS) (control). Expression of p27kip1 was monitored by RT-PCR. RNA levels were expressed as ratios to Actin levels. #= 0.0005; *= 0.01.

Download figure to PowerPoint

Previous studies have implicated a role for forkhead transcription factors in mediating the expression of pro-apoptotic genes such as Fas ligand, the cyclin-dependent kinase-2 (cdk-2) inhibitor p27kip1 and the Bcl-2 family member Bim [30]. To determine whether the reduced transcriptional activity of FOXO1a in gas6-treated endothelial cells was associated with downregulation of a pro-apoptotic gene, HUVECs were transduced with a Adv, Ad-WT-FOXO1a or Ad-TM-FOXO1a, cultured in serum-starved medium, treated with gas6 and then assayed for p27kip1 mRNA expression by RT-PCR. As shown in Fig. 5B, treatment with gas6 resulted in significantly reduced p27kip1 expression in Adv- and WT-FOXO1a-transduced cells, but not in cells expressing TM-FOXO1a. These results suggest that modulation of FOXO1a-dependent p27kip1 expression by gas6 may contribute to endothelial cell survival in concert with other factors.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. Disclosure of Conflict of Interests
  9. References

The present results demonstrate for the first time that the rescue of HUVECs from apoptosis by gas6 is mediated through FOXO1a inactivation. Briefly, gas6 promotes PI3K-dependent phosphorylation and nuclear exclusion of FOXO1a, with consequent downregulation of FOXO1a-responsive target genes, including p27kip1. A similar role for forkhead has been implicated in mediating the pro-survival effects of VEGF [34].

Recent studies suggest that forkhead proteins play a broad role in endothelial cell biology. In addition to regulating apoptosis, these factors mediate cell adhesion to extracellular matrix, regulate the expression of pro-inflammatory and prothrombotic genes, and participate in cell repair and proliferation and angiogenesis [36–38]. For example, expression of a phosphorylation-deficient FOXO3a in endothelial cells resulted in apoptosis and cell dehiscence through a mechanism that involved upregulation of matrix metalloproteinase-3 mRNA expression [36]. Moreover, FOXD has been shown to promote PAI-1 gene expression, an effect that modulates inflammation, thrombosis and expression of extracellular matrix [37]. In some cases, forkhead proteins play a cell protective role in the endothelium. For example, disruption of the FOXM1 gene resulted in impaired endothelial cell repair and proliferation [38].

A number of forkhead proteins, including FOXO3a, FOXO4, FOXC1 and FOXC2 have been show to play a critical role in the proper organization of the vascular system, in regulating the growth of the endothelium [39], in early sprouting and formation of lymphatic vessels and in the induction of endothelial cell marker expression in arteries [40].

Previous studies have demonstrated the importance of FOXO1a signaling and downregulation of p27kip1 in mediating endothelial cell proliferation and angiogenesis [41]. In addition, Axl-knockdown studies recently revealed that Axl signaling mediates angiogenesis through endothelial cell migration, proliferation and tube formation [42]. Our results suggest that Axl-mediated stimulation of angiogenesis may be related to FOXO1a phosphorylation, nuclear export and consequent diminution of endothelial cell apoptosis.

It has been shown in endothelial cells that FOXO1a is required to enhance VEGF-induced upregulation of a second class of genes regulated by transcription factors NF-κB or NF-AT. These genes are involved in cell signaling, metabolism and cell adhesion in endothelial cells [35]. We have shown that gas6 promotes activation of NF-κB [22] and consequently upregulates its transcriptional activity (unpublished observations). The fact that gas6 activates this pathway may help explain the importance of this agonist in signaling processes involving FOXO1a. Other studies have shown that the expression of pro-apoptotic or growth-arrest genes such as Bim, p27kip1 or GADD45 are suppressed by FOXO1a nuclear exclusion in endothelial cells [35]. In particular, we show for the first time, that expression of p27kip1 is downregulated by gas6 as a result of FOXO1a translocation to the cytoplasm. As a consequence of p27kip1 downregulation, cell-cycle arrest is inhibited upon gas6 stimulation consistent with its survival properties in endothelium [22].

Gas6 attenuates VEGF-A-dependent activation of angiogenesis by inhibiting endothelial cell morphogenesis and chemotaxis [43]. As these results are in contradiction with our observations, the fact that they correspond to different cellular processes indicates the versatility of gas6 as an inhibitor of angiogenesis, and as a promoter of endothelial cell survival.

Particular attention has been directed towards the role of gas6 in thrombotic events as gas6- as well as Axl-deficient mice are protected from lethal venous thromboembolism [26,27]. This phenotype is as a result of a gas6 outside-in signaling effect on platelets that results in enhanced thrombus stability and by gas6-induced endothelial cell activation, resulting in the enhancement of interactions between endothelial cells, platelets and leukocytes during inflammation and thrombosis [44]. This is in agreement with our observations that suggest that gas6 may have a pro-thrombotic effect by activation/survival of the endothelium. In particular, activation of NF-κB and forkhead proteins by gas6 in endothelial cells may result in endothelial cell activation and exacerbation of thrombosis. Contrary to the presumed prothrombotic properties of gas6, it can be argued that an endothelial survival factor should be antithrombotic given that endothelial cell apoptosis can provoke thrombosis through endothelial denudation, increased phosphatidylserine expression and/or tissue factor-mediated thrombin generation on the surface of apoptotic cells [45–47].

In conclusion, the above results provide the first experimental evidence that gas6 signaling is mediated by forkhead protein activity, namely FOXO1a. The elucidation of this pathway is important to better understand the physiology of this novel protein that appears to have many properties in a diverse array of tissues.

Acknowledgement

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. Disclosure of Conflict of Interests
  9. References

This work was in part supported by the National Institutes of Health grant HL077348 and an American Heart Association grant SDG0453284N (Md. R. Abid and W.C. Aird) and from a Grant in Aid from the Heart and Stroke Foundation of Canada (M.D. Blostein).

Disclosure of Conflict of Interests

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. Disclosure of Conflict of Interests
  9. References

The authors state that they have no conflict of interest.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. Disclosure of Conflict of Interests
  9. References
  • 1
    Aird WC. Spatial and temporal dynamics of the endothelium. J Thromb Haemost 2005; 3: 1392406.
  • 2
    Hall AV, Jevnikar AM. Significance of endothelial cell survival programs for renal transplantation. Am J Kidney Dis 2003; 41: 114054.
  • 3
    Byrne AM, Bouchier-Hayes DJ, Harmey JH. Angiogenic and cell survival functions of vascular endothelial growth factor (VEGF). J Cell Mol Med 2005; 9: 77794.
  • 4
    Liu W, Ahmad SA, Reinmuth N, Shaheen RM, Jung YD, Fan F, Ellis LM. Endothelial cell survival and apoptosis in the tumor vasculature. Apoptosis 2000; 5: 3238.
  • 5
    Manfioletti G, Brancolini C, Avanzi G, Schneider C. The protein encoded by a growth arrest-specific gene (gas6) is a new member of the vitamin K-dependent proteins related to protein S, a negative coregulator in the blood coagulation cascade. Mol Cell Biol 1993; 13: 497685.
  • 6
    Stafford DW. The vitamin K cycle. J Thromb Haemost 2005; 3: 18738.
  • 7
    Nagata K, Ohashi K, Nakano T, Arita H, Zong C, Hanafusa H, Mizuno K. Identification of the product of growth arrest-specific gene 6 as a common ligand for Axl, Sky, and Mer receptor tyrosine kinases. J Biol Chem 1996; 271: 300227.
  • 8
    Evenas P, Garcia de Frutos P, Nicolaes GA, Dahlback B. The second laminin G-type domain of protein S is indispensable for expression of full cofactor activity in activated protein C-catalysed inactivation of factor Va and factor VIIIa. Thromb Haemost 2000; 84: 2717.
  • 9
    Goruppi S, Ruaro E, Schneider C. Gas6, the ligand of Axl tyrosine kinase receptor, has mitogenic and survival activities for serum starved NIH3T3 fibroblasts. Oncogene 1996; 12: 47180.
  • 10
    Prieto AL, Weber JL, Lai C. Expression of the receptor protein-tyrosine kinases Tyro-3, Axl, and mer in the developing rat central nervous system. J Comp Neurol 2000; 425: 295314.
  • 11
    Dirks W, Rome D, Ringel F, Jager K, MacLeod RA, Drexler HG. Expression of the growth arrest-specific gene 6 (GAS6) in leukemia and lymphoma cell lines. Leuk Res 1999; 23: 64351.
  • 12
    Vajkoczy P, Knyazev P, Kunkel A, Capelle HH, Behrndt S, Von Tengg-Kobligk H, Kiessling F, Eichelsbacher U, Essig M, Read TA, Erber R, Ullrich A. Dominant-negative inhibition of the Axl receptor tyrosine kinase suppresses brain tumor cell growth and invasion and prolongs survival. Proc Natl Acad Sci U S A 2006; 103: 5799804.
  • 13
    Van Ginkel PR, Gee RL, Shearer RL, Subramanian L, Walker TM, Albert DM, Meisner LF, Varnum BC, Polans AS. Expression of the receptor tyrosine kinase Axl promotes ocular melanoma cell survival. Cancer Res 2004; 64: 12834.
  • 14
    Avanzi GC, Gallicchio M, Cavalloni G, Gammaitoni L, Leone F, Rosina A, Boldorini R, Monga G, Pegoraro L, Varnum B, Aglietta M. GAS6, the ligand of Axl and Rse receptors, is expressed in hematopoietic tissue but lacks mitogenic activity. Exp Hematol 1997; 25: 121926.
  • 15
    Avanzi GC, Gallicchio M, Bottarel F, Gammaitoni L, Cavalloni G, Buonfiglio D, Bragardo M, Bellomo G, Albano E, Fantozzi R, Garbarino G, Varnum B, Aglietta M, Saglio G, Dianzani U, Dianzani C. GAS6 inhibits granulocyte adhesion to endothelial cells. Blood 1998; 91: 233440.
  • 16
    Yanagita M, Arai H, Ishii K, Nakano T, Ohashi K, Mizuno K, Varnum B, Fukatsu A, Doi T, Kita T. Gas6 regulates mesangial cell proliferation through Axl in experimental glomerulonephritis. Am J Pathol 2001; 158: 142332.
  • 17
    Sainaghi PP, Castello L, Bergamasco L, Galletti M, Bellosta P, Avanzi GC. Gas6 induces proliferation in prostate carcinoma cell lines expressing the Axl receptor. J Cell Physiol 2005; 204: 3644.
  • 18
    Wu Y, Singh S, Georgescu MM, Birge RB. A role for Mer tyrosine kinase in alphavbeta5 integrin-mediated phagocytosis of apoptotic cells. J Cell Sci 2005; 118: 53953.
  • 19
    Hall MO, Obin MS, Heeb MJ, Burgess BL, Abrams TA. Both protein S and Gas6 stimulate outer segment phagocytosis by cultured rat retinal pigment epithelial cells. Exp Eye Res 2005; 81: 58191.
  • 20
    Goruppi S, Ruaro E, Varnum B, Schneider C. Gas6-mediated survival in NIH3T3 cells activates stress signalling cascade and is independent of Ras. Oncogene 1999; 18: 422436.
  • 21
    O’Donnell K, Harkes IC, Dougherty L, Wicks IP. Expression of receptor tyrosine kinase Axl and its ligand Gas6 in rheumatoid arthritis: evidence for a novel endothelial cell survival pathway. Am J Pathol 1999; 154: 117180.
  • 22
    Hasanbasic I, Cuerquis J, Varnum B, Blostein MD. Intracellular signaling pathways involved in Gas6-Axl-mediated survival of endothelial cells. Am J Physiol Heart Circ Physiol 2004; 287: H120713.
  • 23
    Korshunov VA, Mohan AM, Georger MA, Berk BC. Axl, a receptor tyrosine kinase, mediates flow-induced vascular remodeling. Circ Res 2006; 98: 144652.
  • 24
    Katagiri M, Hakeda Y, Chikazu D, Ogasawara T, Takato T, Kumegawa M, Nakamura K, Kawaguchi H. Mechanism of stimulation of osteoclastic bone resorption through Gas6/Tyro 3, a receptor tyrosine kinase signaling, in mouse osteoclasts. J Biol Chem 2001; 276: 737682.
  • 25
    Nagai K, Matsubara T, Mima A, Sumi E, Kanamori H, Iehara N, Fukatsu A, Yanagita M, Nakano T, Ishimoto Y, Kita T, Doi T, Arai H. Gas6 induces Akt/mTOR-mediated mesangial hypertrophy in diabetic nephropathy. Kidney Int 2005; 68: 55261.
  • 26
    Angelillo-Scherrer A, Burnier L, Flores N, Savi P, DeMol M, Schaeffer P, Herbert JM, Lemke G, Goff SP, Matsushima GK, Earp HS, Vesin C, Hoylaerts MF, Plaisance S, Collen D, Conway EM, Wehrle-Haller B, Carmeliet P. Role of Gas6 receptors in platelet signaling during thrombus stabilization and implications for antithrombotic therapy. J Clin Invest 2005; 115: 23746.
  • 27
    Angelillo-Scherrer A, De Frutos P, Aparicio C, Melis E, Savi P, Lupu F, Arnout J, Dewerchin M, Hoylaerts M, Herbert J, Collen D, Dahlback B, Carmeliet P. Deficiency or inhibition of Gas6 causes platelet dysfunction and protects mice against thrombosis. Nat Med 2001; 7: 21521.
  • 28
    Hasanbasic I, Rajotte I, Blostein M. The role of gamma-carboxylation in the anti-apoptotic function of gas6. J Thromb Haemost. 2005; 3: 27907.
  • 29
    Tang TT, Dowbenko D, Jackson A, Toney L, Lewin DA, Dent AL, Lasky LA. The forkhead transcription factor AFX activates apoptosis by induction of the BCL-6 transcriptional repressor. J Biol Chem 2002; 277: 1425565.
  • 30
    Stahl M, Dijkers PF, Kops GJ, Lens SM, Coffer PJ, Burgering BM, Medema RH. The forkhead transcription factor FoxO regulates transcription of p27Kip1 and Bim in response to IL-2. J Immunol 2002; 168: 502431.
  • 31
    Dijkers PF, Medema RH, Lammers JW, Koenderman L, Coffer PJ. Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription factor FKHR-L1. Curr Biol 2000; 10: 12014.
  • 32
    Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC, Blenis J, Greenberg ME. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 1999; 96: 85768.
  • 33
    Tang ED, Nunez G, Barr FG, Guan KL. Negative regulation of the forkhead transcription factor FKHR by Akt. J Biol Chem 1999; 274: 167416.
  • 34
    Abid MR, Guo S, Minami T, Spokes KC, Ueki K, Skurk C, Walsh K, Aird WC. Vascular endothelial growth factor activates PI3K/Akt/forkhead signaling in endothelial cells. Arterioscler Thromb Vasc Biol 2004; 24: 294300.
  • 35
    Abid MR, Shih SC, Otu HH, Spokes KC, Okada Y, Curiel DT, Minami T, Aird WC. A novel class of vascular endothelial growth factor-responsive genes that require forkhead activity for expression. J Biol Chem 2006; 281: 3554453.
  • 36
    Lee HY, You HJ, Won JY, Youn SW, Cho HJ, Park KW, Park WY, Seo JS, Park YB, Walsh K, Oh BH, Kim HS. Forkhead factor, FOXO3a, induces apoptosis of endothelial cells through activation of matrix metalloproteinases. Arterioscler Thromb Vasc Biol 2008; 28: 3028.
  • 37
    Berg DT, Myers LJ, Richardson MA, Sandusky G, Grinnell BW. Smad6s regulates plasminogen activator inhibitor-1 through a protein kinase C-beta-dependent up-regulation of transforming growth factor-beta. J Biol Chem 2005; 280: 149437.
  • 38
    Zhao YY, Gao XP, Zhao YD, Mirza MK, Frey RS, Kalinichenko VV, Wang IC, Costa RH, Malik AB. Endothelial cell-restricted disruption of FoxM1 impairs endothelial repair following LPS-induced vascular injury. J Clin Invest 2006; 116: 233343.
  • 39
    Furuyama T, Kitayama K, Shimoda Y, Ogawa M, Sone K, Yoshida-Araki K, Hisatsune H, Nishikawa S, Nakayama K, Nakayama K, Ikeda K, Motoyama N, Mori N. Abnormal angiogenesis in Foxo1 (Fkhr)-deficient mice. J Biol Chem 2004; 279: 347419.
  • 40
    Seo S, Fujita H, Nakano A, Kang M, Duarte A, Kume T. The forkhead transcription factors, Foxc1 and Foxc2, are required for arterial specification and lymphatic sprouting during vascular development. Dev Biol 2006; 294: 45870.
  • 41
    Potente M, Urbich C, Sasaki K, Hofmann WK, Heeschen C, Aicher A, Kollipara R, DePinho RA, Zeiher AM, Dimmeler S. Involvement of Foxo transcription factors in angiogenesis and postnatal neovascularization. J Clin Invest 2005; 115: 238292.
  • 42
    Holland SJ, Powell MJ, Franci C, Chan EW, Friera AM, Atchison RE, McLaughlin J, Swift SE, Pali ES, Yam G, Wong S, Lasaga J, Shen MR, Yu S, Xu W, Hitoshi Y, Bogenberger J, Nor JE, Payan DG, Lorens JB. Multiple roles for the receptor tyrosine kinase axl in tumor formation. Cancer Res 2005; 65: 9294303.
  • 43
    Gallicchio M, Mitola S, Valdembri D, Fantozzi R, Varnum B, Avanzi GC, Bussolino F. Inhibition of vascular endothelial growth factor receptor 2-mediated endothelial cell activation by Axl tyrosine kinase receptor. Blood 2005; 105: 19706.
  • 44
    Tjwa M, Bellido-Martin L, Lin Y, Lutgens E, Plaisance S, Bono F, Delesque-Touchard N, Herve C, Moura R, Billiau AD, Aparicio C, Levi M, Daemen M, Dewerchin M, Lupu F, Arnout J, Herbert JM, Waer M, Garcia de Frutos P, Dahlback B, et al. Gas6 promotes inflammation by enhancing interactions between endothelial cells, platelets, and leukocytes. Blood 2008; 111: 4096105.
  • 45
    Wang J, Weiss I, Svoboda K, Kwaan HC. Thrombogenic role of cells undergoing apoptosis. Br J Haematol 2001; 115: 38291.
  • 46
    Durand E, Scoazec A, Lafont A, Boddaert J, Al Hajzen A, Addad F, Mirshahi M, Desnos M, Tedgui A, Mallat Z. In vivo induction of endothelial apoptosis leads to vessel thrombosis and endothelial denudation: a clue to the understanding of the mechanisms of thrombotic plaque erosion. Circulation 2004; 109: 25036.
  • 47
    Tedgui A, Mallat Z. Apoptosis, a major determinant of atherothrombosis. Arch Mal Coeur Vaiss 2003; 96: 6715.