SEARCH

SEARCH BY CITATION

Keywords:

  • acute coronary syndrome;
  • clopidogrel;
  • high-density lipoprotein;
  • paraoxonase-1;
  • platelets

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Patients and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosure of Conflict of Interest
  9. References
  10. Supporting Information

Summary. Background: The paraoxonase activity of the enzyme paraoxonase-1 (PON-1) associated with high-density lipoprotein (HDL) may significantly influence clopidogrel’s antiplatelet and clinical efficacy as a result of its involvement in the clopidogrel biotransformation to the pharmacologically active thiol metabolite. We evaluated the possible relationships of HDL levels as well as PON-1 activities and the Q192R genotype with clopidogrel’s antiplatelet efficacy in acute coronary syndrome (ACS) patients. Methods and results: The platelet aggregation, P-selectin expression and platelet/leukocyte conjugates as well as the clopidogrel response variability (evaluated by the VASP phosphorylation test and expressed as platelet reactivity index, PRI) were assessed in 74 ACS patients undergoing percutaneous coronary intervention (PCI) in relation to the PON-1 Q192R genotype and to serum HDL-cholesterol levels, and PON-1 (paraoxonase and arylesterase) activities. Patients were loaded with 600 mg of clopidogrel followed by 75 mg per day. HDL-cholesterol levels and PON-1 activities at baseline (before clopidogrel loading) were not altered at 5- and 30-day post-clopidogrel loading, whereas baseline platelet activation parameters were significantly attenuated. At 5 days, 17 patients were clopidogrel non-responders (PRI: 64.2 ± 11.1%). HDL-cholesterol was inversely associated with platelet activation parameters independently on platelet response variability to clopidogrel whereas a negative association between platelet activation parameters and paraoxonase activity was observed in patients adequately responding to clopidogrel but not in clopidogrel non-responders. Similarly, the platelet activation markers were significantly higher in PON-1 Q192Q genotype carriers compared with those having one or two R alleles only in patients adequately responding to clopidogrel. Conclusions: PON-1 is an important determinant of clopidogrel antiplatelet efficacy only in patients adequately responding to clopidogrel. These findings may be clinically important in ACS patients receiving clopidogrel therapy, especially the first days after the episode.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Patients and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosure of Conflict of Interest
  9. References
  10. Supporting Information

Αntiplatelet drugs represent a cornerstone intervention in the prevention and management of acute coronary syndromes (ACS) [1]. Clopidogrel is a widely used antiplatelet agent that irreversibly binds to the platelet purinergic P2Y12 receptor and inhibits platelet activation by adenosine diphosphate (ADP) [2]. Clopidogrel is a prodrug that requires enzymatic conversion into its active thiol metabolite. The platelet response to clopidogrel treatment is highly variable. Clinical, cellular and genetic factors have been associated with response variability to clopidogrel [3], however, the majority of this variability can be attributed to the variability in plasma concentrations of the active metabolite [4]. Low platelet responsiveness to clopidogrel, irrespectively of the underlying mechanisms, results in a high incidence of atherothrombotic events [5].

High-density lipoprotein (HDL) is a major antiatherogenic factor in plasma that also inhibits platelet activation induced by various agonists under in vitro and ex vivo conditions [6,7]. Platelets of patients with low HDL levels are hyperresponsive to low doses of aggregating agents [8] and high HDL-cholesterol levels in hyperlipidemic and normolipidemic patients are associated with reduced platelet-dependent thrombus formation ex vivo [9]. One of the biologically important components of HDL is paraoxonase-1 (PON-1) a calcium-dependent A-esterase synthesized primarily in the liver [10]. PON-1 hydrolyzes several substrates including organophosphates, carboxylic acid esters, lactones and oxidized phospholipids. The PON-1 activities that have been mostly studied are those towards paraoxon (paraoxonase activity) and phenylacetate (arylesterase activity) [11]. PON-1 exhibits a common genetic variant, glutamine (Q)/arginine (R) at position 192 (Q192R), which mostly accounts for the wide inter-individual variation in serum paraoxonase activity whereas it does not influence arylesterase activity [11,12]. PON-1 exerts several anti-atherogenic activities, in vitro and in vivo, thereby significantly contributing to the HDL cardioprotective effects. However, in humans, the relationship among PON-1 genetic variants, PON-1 activities and cardiovascular risk is less clear as epidemiological studies have reported conflicting results [13–16]. It has recently been demonstrated that the PON-1 Q192R genetic variant is associated with the recurrence of ischemic events in patients receiving clopidogrel therapy suggesting that the paraoxonase activity of PON-1 is crucial for clopidogrel bioactivation and the formation of the active thiol metabolite. Thus, PON-1 could be a key enzyme for clopidogrel antiplatelet and clinical efficacy [17]. However, a more recent study suggested that the PON-1 Q192R genotype does not influence the platelet response to clopidogrel or the risk of stent thrombosis in clopidogrel-treated patients [18]. The aim of the present study was to evaluate the possible relationships of HDL levels as well as the PON-1 Q192R genotype and activities with clopidogrel’s antiplatelet efficacy in ACS patients undergoing percutaneous coronary intervention (PCI).

Patients and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Patients and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosure of Conflict of Interest
  9. References
  10. Supporting Information

Study population

We studied 74 patients (52 men), aged 63.3 ± 8.6 years, with an ACS presenting within 24 h from the onset of symptoms [19]. At the time of admission, some patients were receiving therapy with thiazide diuretics, beta-blockers, calcium antagonists, ACE inhibitors and angiotensin II receptor blockers (Table 1). These drugs were continued during the length of the study. On admission, patients received an aspirin-loading dose of 325 mg, before clopidogrel loading, followed by 100 mg per day. Low-molecular-weight heparin (enoxaparin) was given subcutaneously (s.c.) at a dose of 1 mg kg−1 every 12 h until hospital discharge. No other platelet antagonists, including glycoprotein IIb/IIIa antagonists, were used. Atorvastatin (40 mg per day) was initiated at hospital admission, before clopidogrel loading, and continued after hospital discharge. All patients were loaded with 600 mg of clopidogrel, followed by 75 mg per day. An angiography was performed in all patients within 72 h of hospital admission. All patients underwent a PCI performed within the first 4 days from clopidogrel loading. Exclusion criteria were chronic inflammatory disease, diabetes mellitus or neoplasia as well as statin or clopidogrel therapy before admission. All patients signed an informed consent form and the study was approved by the Ethics Committee of the University Hospital of Ioannina.

Table 1.   Correlation among platelet activation parameters and serum HDL-cholesterol levels or paraoxonase activity of PON-1
ParameterHDL-cholesterolPON-1 (paraoxonase activity)
Baseline5 days30 daysBaseline5 days30 days
rPrPrPrPrPRP
  1. PRI, platelet reactivity index; HDL, high-density lipoprotein.

PRI, %0.063NS0.081NS−0.5350.01−0.6080.005
Platelet maximum aggregation, %
 ADP, 5 μmol L−1−0.2920.04−0.3120.04−0.2440.040.069NS−0.5420.001−0.6900.0001
 ADP, 10 μmol L−1−0.2510.04−0.2810.04−0.2380.050.094NS−0.5210.001−0.6420.0001
 TRAP, 10 μmol L−1−0.2440.05−0.2040.05−0.2880.050.087NS−0.4100.02−0.4940.01
 P-selectin expression (MFI)−0.3040.04−0.3240.03−0.3350.030.104NS−0.5310.001−0.5830.0005
 Platelet/monocyte conjugates (% positive particles)−0.2320.04−0.2140.04−0.2550.040.044NS−0.4920.02−0.5760.01
Platelet/neutrophil conjugates (% positive particles)−0.2700.05−0.2210.05−0.3040.040.055NS−0.4210.03−0.5220.01

Blood sampling

Citrated blood samples for platelet analysis were obtained from an antecubital vein using a 21-gauge butterfly needle. Samples were obtained from all patients before clopidogrel loading (baseline) as well as at 5 and 30 days afterwards.

Platelet aggregation studies

Light transmittance aggregometry (LTA) in platelet-rich plasma (PRP), containing 2.5 × 108 platelets mL−1, was performed as previously described [20]. Platelet aggregation to 5 and 10 μmol L−1 ADP (Chronolog, Havertown, PA, USA) or to 10 μmol L−1 thrombin receptor activating peptide-14 (TRAP) (Sigma-Aldrich, Munich, Germany) was measured in aliquots of 0.5 mL PRP, at 37 °C, under continuous stirring (1200 rpm), in a Chronolog Lumi-Aggregometer (Chronolog, Model 700-4DR, Havertown, PA, USA) with the AggroLink software package. Aggregation was expressed as the maximum percent change in light transmittance from baseline achieved within 3 min after the addition of the agonist using platelet-poor plasma as the reference. All LTA assays were conducted within 3 h after venepuncture.

VASP phosphorylation analysis

The VASP (vasodilator stimulated phosphoprotein) phosphorylation analysis was performed on a FACS Calibur flow cytometer (Becton Dickinson, San Jose, CA, USA) within 3 h of blood collection using a platelet VASP/P2Y12 kit (BioCytex, Marseille, France) according to the manufacturer’s instructions as previously described [21]. The mean fluorescence intensity (MFI) corresponding to each experimental condition for example in the presence of prostaglandin E1 (PGE1) or ADP + PGE1 was determined to establish a ratio directly correlated with the VASP phosphorylation state. The platelet reactivity index (PRI) was calculated using the equation: ([MFIPGE1– MFIADP+PGE1]/MFIPGE1) × 100. The intra-assay coefficient of variation was < 5%, and the interassay coefficient of variation was < 8% [21].

Flow cytometry measurements

Flow cytometry experiments were performed using fluorescently labeled monoclonal antibodies from Becton Dickinson. The formation of platelet-monocytes and platelet-neutrophil conjugates was assessed in whole blood by dual labeling with anti-CD61-PerCP and anti-CD14-FITC (a specific marker for monocytes), or anti-CD41a-FITC (recognizes αΙΙb subunit of the platelet αΙΙbβ3 integrin-receptor) and anti-CD45-PE (a general marker for leukocytes), respectively. Αctivation was performed with 100 μmol L−1 of ADP for 10 min in static conditions at 37 °C. Then erythrocyte lysis buffer was added and incubated for 20 min at 4 °C. List mode files were collected for 10 000 cells for each blood sample. Flow cytometry results were evaluated using Cell Quest Software (Becton-Dickinson) [19,22]. Platelet-leukocyte conjugates were assessed as the CD61 and CD14 positive particles (for monocytes) or the CD41a and CD45 positive particles (for neutrophils) having the typical FSC and SSC profile of monocytes or neutrophils [19]. Results were expressed as the percentage of positive particles of the ADP-activated sample minus the percentage of positive particles of unactivated sample. The membrane expression of P-selectin was also evaluated in whole blood under the above activation conditions using the monoclonal antibody anti-CD62P-PE [19]. P-selectin was expressed as the MFI of the activated sample minus the mean fluorescence intensity of the unactivated sample as we previously described [23].

Determination of PON-1 activities and Q192R genotype

Serum PON-1 activities were measured before clopidogrel loading (baseline), as well as at 5 and 30 days afterwards using paraoxon (Sigma-Aldrich) (paraoxonase activity), as well as phenylacetate (Sigma, Munich, Germany) (arylesterase ativity) as substrates. PON-1 activities were determined in the presence of 2 mmol L−1 Ca2+ in 100 mmol L−1 Tris-HCl buffer (pH 8.0) for paraoxon or in the presence of 20 mmol L−1 Tris-HCl buffer (pH 8.0) for phenylacetate was as we previously described [24,25]. Paraoxonase activity was expressed in U per liter serum with 1 U L−1 defined as 1 μmol of p-nitrophenol formed per min, whereas arylesterase activity was expressed in U per mL with 1 U mL−1 defined as 1 μmol of phenylacetate hydrolyzed per min [24,25]. The determination of the PON-1 Q192R genotype was performed as we have previously described using the primers 5′TATTGTTGCTGTGGGACCTGAG3′ and 5′CACGCTAAACCCAAATACATCTC3′ [25].

Routine laboratory measurements

Fasting peripheral blood samples were collected from all patients before clopidogrel loading (baseline), as well as at 5 and 30 days afterwards in order to perform hematological and biochemical analysis, including serum lipids. All analyzes were performed using standard, commercially available techniques, as we previously described [26].

Statistical analysis

Parameters were expressed as mean ± standard deviation (SD), or number (percentage). The Shapiro–Wilks test was used to evaluate whether each parameter followed a Gaussian distribution. Comparisons between continuous variables within groups were performed by paired two-tailed Student’s t-test for normally distributed variables and Wilcoxon’s test for non-normally distributed variables. Hardy–Weinberg’s equilibrium for the PON-1 Q192R genotype frequencies was tested using the chi-square test. Correlations between various parameters determined in the present study were estimated using linear regression analysis and Spearman’s rank correlation coefficients (for non-gaussian-distributed variables), whereas Yates’ corrected chi-square test was used for differences in proportions. The SPSS software (Version 17.0; SPSS Inc., Chicago, Illinois) was used for all analyzes. A P-value of < 0.05 was considered to be significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Patients and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosure of Conflict of Interest
  9. References
  10. Supporting Information

Patient characteristics and clopidogrel responsiveness

In all, 74 consecutive patients with an ACS admitted within 24 h from the onset of symptoms to the hospital were included in the study. Baseline characteristics of the ACS patients are shown in Table S1. Baseline levels of serum HDL-cholesterol and PON-1 activities were not significantly changed either at 5- or 30-days of follow-up (data not shown). Of the total population included in the study, 37 (50%) patients were homozygous PON-1 Q192Q genotype carriers, 30 (40.5%) were heterozygous allele (PON-1 Q192R) carriers, whereas seven (9.5%) exhibited the PON-1 R192R genotype (Table S1). No significant deviation from Hardy–Weinberg’s equilibrium was observed for the Q192R genotypes distribution. As a result of the small number of R192R genotype carriers, patients were subgrouped into homozygotes for the Q allele and those having one or two R alleles (Q192R+R192R). As expected, the Q192R genotype significantly influenced the serum PON-1 paraoxonase activity, the Q192Q patients having lower activity compared with the Q192R+R192R patients (61 ± 18 U L−1 vs. 89 ± 25 U L−1, P < 0.03), an observation that accords with previously published results by our group and others [25,27].

From the VASP phosphorylation analysis performed at day 5, a wide variability in the PRI values among participants ranging from 8.4% to 75.3% was obtained (mean ± SD: 44 ± 29%). At 30-days of follow-up, the PRI values were significantly reduced to 34 ± 14% (range 7.9–58.3%) (P < 0.01 compared with PRI values at 5 days). A significant negative correlation between PRI values and paraoxonase activity was observed at 5 days, which became stronger at 30-days postclopidogrel loading (Table 1). Furthermore, the PRI values at 5 days were higher in Q192Q compared with Q192R+R192R patients, this difference being statistically significant at 30 days (Fig. 1). PRI values either at 5- or at 30-days postclopidogrel loading were not correlated with HDL-cholesterol levels (Table 1) or arylesterase activity of PON-1 (data not shown).

image

Figure 1.  Platelet reactivity index (PRI) values in relation to PON-1 Q192R genotypes. PRI values were determined by VASP phosphorylation analysis performed at 5- and 30-days postclopidogrel loading in acute coronary syndrome (ACS) patients. Values are expressed as mean ± standard deviation (SD). *P < 0.01 compared with Q192Q genotype at day 30.

Download figure to PowerPoint

Platelet response to clopidogrel in relation to PON-1 activities and the Q192R genotype in the total population

LTA assays, as well as P-selectin and platelet-leukocyte conjugate determinations, were performed at baseline as well as at 5- and 30-days postclopidogrel loading. Platelet aggregation values, P-selectin expression and platelet-leukocyte conjugates at baseline as well as at 5- and 30-days postclopidogrel loading were negatively correlated with HDL-cholesterol levels (Table 1). No correlation between the above platelet activation parameters at baseline and paraoxonase activity was observed (Table 1). Importantly, at 5 days, significant negative correlations between all the above platelet activation markers and paraoxonase activity were observed, these correlations becoming even more significant at 30 days of follow-up (Table 1). In contrast to paraoxonase activity, no correlation was observed between PON-1 arylesterase activity and platelet activation values, either at baseline or at 5 and 30 days of follow-up (data not shown). No difference in the baseline platelet aggregation values was observed between patients exhibiting the Q192Q or the Q192R+R192R genotype (Table S2). At 5-days postclopidogrel loading, platelet aggregation values were higher in Q192Q compared with Q192R+R192R patients, this difference being statistically significant at 30 days (Table S2). Similar results were observed for the P-selectin expression and platelet–leukocyte conjugates (Table S2).

At the time of admission, a proportion of patients was receiving therapy with drugs that could influence platelet function for example thiazide diuretics, beta-blockers, calcium antagonists, ACI inhibitors and angiotensin II receptor blockers (Table S1). When patients receiving each one of the above drugs were excluded from statistical analysis, no significant changes in the above-described results were observed (data not shown).

Platelet activation parameters, PON-1 activities and the Q192R genotype in relation to clopidogrel response variability

Using a PRI threshold of 50%, patients were classified as clopidogrel responders/non-responders. A PRI ≥ 50% is retrospectively strongly correlated with an adverse clinical outcome [21] and it has been recently proposed as one of the criteria for the definition of high on-treatment platelet reactivity to ADP, in the setting of PCI [3]. At 5-days postclopidogrel loading, 17 patients (23% of total) were clopidogrel non-responders (PRI: 64.2 ± 11.1%, range 52.4–75.3%) and 57 patients were clopidogrel responders (PRI: 32.9 ± 15.1%, range 8.4–48.2%). At 30 days of follow-up, the PRI values of non-responders patients were reduced to 41.2 ± 16.1% (range 24.8–58.3%), (P < 0.01 compared with PRI values at 5 days).

No difference in the HDL-cholesterol levels or PON-1 paraoxonase and arylesterase activities was observed between clopidogrel responders and non-responders, either at baseline or at 5- and 30-days postclopidogrel loading (Table 2). No difference in the Q192R genotype frequencies was also observed between clopidogrel responders and non-responders (Fig. 2).

Table 2.    Platelet activation parameters, HDL-cholesterol levels and PON-1 activities in ACS patients, at baseline as well as at 5- and 30-days postclopidogrel loading
ParameterClopidogrel responders (n = 57)Clopidogrel non-responders (n = 17)
Baseline5 days30 daysBaseline5 days30 days
  1. HDL, high-density lipoprotein; PON-1, paraoxonase-1; ACS, acute coronary syndrome. Data are expressed as mean ± standard deviation (SD). *P < 0.001, P < 0.01 and P < 0.05 compared with corresponding baseline values. §P < 0.01 compared with corresponding aggregation values at 5 days, P < 0.02 compared with corresponding aggregation values at baseline. P < 0.01 compared with corresponding baseline values.

HDL-cholesterol, mg per dL44.5 ± 13.145.0 ± 10.545.9 ± 11.442.3 ± 10.443.1 ± 9.044.2 ± 12.2
PON-1 paraoxonase activity, U per L78 ± 3385 ± 3981 ± 4081 ± 2579 ± 2982 ± 35
PON-1 arylesterase activity, U per mL50 ± 1646 ± 1048 ± 1352 ± 1249 ± 1550 ± 10
Platelet maximum aggregation, %
ADP, 5 μmol L−163 ± 1542 ± 17*36 ± 13*67 ± 1059 ± 1240 ± 14*
ADP, 10 μmol L−180 ± 1958 ± 17*52 ± 11*77 ± 1869 ± 1655 ± 10*
TRAP, 10 μmol L−183 ± 1465 ± 1961 ± 1578 ± 1172 ± 1360 ± 9
P-selectin expression (MFI)42 ± 1930 ± 1226 ± 10*41 ± 1338 ± 923 ± 8*
Platelet/monocyte conjugates (% positive particles)74 ± 1159 ± 1440 ± 10*72 ± 1567 ± 1644 ± 12*
Platelet/ Neutrophil conjugates (% positive particles)45 ± 1431 ± 1322 ± 9*41 ± 1238 ± 1527 ± 10*
image

Figure 2.  PON-1 Q192R genotype frequencies in clopidogrel responders and non-responders. P = NS calculated with the chi-square test.

Download figure to PowerPoint

In clopidogrel responders, a maximum inhibition in platelet aggregation induced by ADP or TRAP was observed at 5 days of follow-up. In contrast, in clopidogrel non-responders, TRAP-induced platelet aggregation was not significantly altered at 5 days of follow-up whereas only a marginally significant reduction in ADP-induced platelet aggregation was observed (Table 2). Platelet aggregation values reached those of clopidogrel responders at 30 days of follow-up (Table 2). P-selectin expression as well as platelet-monocyte and platelet-neutrophil conjugates were progressively and significantly attenuated at 5- and 30-days postclopidogrel loading in clopidogrel responders, whereas in clopidogrel non-responders the above platelet activation markers were significantly reduced only at 30 days of follow-up (Table 2). Importantly, platelet aggregation, P-selectin expression as well as platelet–leukocyte conjugates in clopidogrel responders were negatively correlated with paraoxonase activity at 5 and 30 days of follow-up whereas in non-responders, significant correlations among the above parameters were observed only at day 30. Figure 3A,B illustrates correlations of PON-1 paraoxonase activity with platelet aggregation to 5 μmol L−1 ADP and P-selectin expression at 5 and 30 days of follow-up in non-responders, whereas Fig. 3C,D illustrates correlations of paraoxonase activity with platelet aggregation to 5 μmol L−1 ADP and P-selectin expression at 5 days of follow-up in clopidogrel responders.

image

Figure 3.  Correlations of PON-1 paraoxonase activity with platelet aggregation to 5 μmolL−1 ADP (A) and P-selectin expression (B), at 5 and 30 days of follow-up in clopidogrel non-responders as well as with platelet aggregation to 5 μmol L−1 ADP (C) and P-selectin expression (D) at 5 days of follow-up in clopidogrel responders.

Download figure to PowerPoint

No differences in the percentages of patients receiving therapy with drugs that could influence platelet function (shown in Table S1) were observed between responders and non-responders (data not shown).

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Patients and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosure of Conflict of Interest
  9. References
  10. Supporting Information

The present study shows that HDL-cholesterol levels in ACS patients undergoing PCI are negatively correlated with several platelet activation markers, independently of clopidogrel treatment. The negative association between HDL-cholesterol levels and platelet activation parameters is in line with previously published results showing that HDL inhibits platelet activation [6,7]. Accordingly, previous reports demonstrated that plasma HDL levels are inversely associated with recurrent venous thromboembolism, whereas HDL-cholesterol has been identified as an independent predictor of acute platelet thrombus formation [9,28]. Importantly, the reverse association between HDL-cholesterol with platelet activation markers is not altered during clopidogrel treatment; neither are HDL-cholesterol levels correlated with PRI values. This suggests that HDL does not influence clopidogrel’s antiplatelet efficacy.

PON-1 is one of the most bioactive HDL constituents that significantly contribute to the HDL anti-atherogenic and cardioprotective potency [11]. The present results failed to show any association between paraoxonase or arylesterase activity of PON-1 with platelet activation markers before clopidogrel administration. Neither the PON-1 Q192R genotype, which affects the PON-1 paraoxonase activity [25,27], has any influence on the baseline values platelet activation parameters. This suggests that PON-1 is not involved in the HDL antiplatelet effects, which is in accordance with previous results showing that HDL inhibits platelet activation in vitro and in animal models in vivo primarily via interaction with scavenger receptor BI (SR-BI) [29,30].

Importantly, in the present study, an inverse association between the paraoxonase activity and platelet activation markers was observed after clopidogrel administration, only in patients adequately responding to clopidogrel. Furthermore, platelet activation values were higher in Q192Q genotype carriers compared with those having one or two R alleles at 30-day postclopidogrel loading, for example at the time interval in which platelet activation values in non-responders have reached those of clopidogrel responders. In this regard we should mention that in clopidogrel non-responders, a significant improvement in the clopidogrel antiplatelet efficacy was observed at 30-day postclopidogrel loading. These findings are in line with results published by our group [19,31] and other investigators [32–34] suggesting that the platelet hyporesponsiveness to clopidogrel in ACS patients undergoing PCI and treated with 75 mg per day clopidogrel may be overcome within 1 month of treatment.

The above results show that paraoxonase activity may influence the clopidogrel-induced platelet inhibition. This suggestion is in line with recent findings showing that PON-1 is the crucial enzyme for clopidogrel biotransformation to the pharmacologically active thiol metabolite through hydrolytic cleavage of the γ-thiobutyrolactone ring of 2-oxo-clopidogrel [17]. However, our results further showed that in clopidogrel non-responders, platelet activation parameters are inversely associated with paraoxonase activity at 30 days but not at 5 days of follow-up. Considering that (i) the paraoxonase activity was not changed during the follow-up, (ii) the enzyme activity was similar between non-responders and responders at any time interval and (iii) the Q192R genotype frequencies were similar between responders and non-responders, we may suggest that other factors rather than PON-1 may primarily account for the reduced platelet responsiveness to clopidogrel observed in non-responders at day 6. In this regard, genetic variants in ABCB1 (that encodes for the drug-efflux transporter, P-glycoprotein, involved in intestinal clopidogrel absorption) as well as in the cytochrome P-450 (CYP) genes, especially that of CYP2C19, have been associated with reduced concentrations of active drug metabolite, diminished platelet inhibition and higher rates of major adverse cardiovascular events [35–37]. Thus, defective clopidogrel intestinal absorption or/and oxidation catalyzed by CYP isoenzymes in the liver, may lead to reduced formation and availability of 2-oxo-clopidogrel, the PON-1 substrate for the formation of the active thiol metabolite. Consequently, the bioavailability of the 2-oxo-clopidogrel could be an important determinant of the relationship between paraoxonase activity and platelet responsiveness to clopidogrel. This suggestion may explain the recent debate concerning the association between PON-1 Q192R genotypes and clopidogrel antiplatelet and clinical efficacy [17,18]. Indeed despite the fact that Q192Q genotype carriers exhibit low serum paraoxonase activity, this activity may be adequate to efficiently metabolize 2-oxo-clopidogrel to the active thiol metabolite. Thus, the bioavailability of 2-oxo-clopidogrel and the factors that influence its formation may be more important determinants of clopidogrel antiplatelet efficacy than PON-1 genotypes, a suggestion that needs further investigation.

A limitation of the present study is the relatively small sample size. Furthermore, we have not determined the plasma levels of clopidogrel and its metabolites, which could more strongly support our suggestion concerning the relationship among clopidogrel metabolites, platelet activation and PON-1 paraoxonase activity. However, at the time intervals we have obtained the blood samples (5- and 30-day postclopidogrel loading), patients were receiving a maintenance dose of 75 mg per day clopidogrel, which is very low to permit us to perform pharmacokinetic analysis, as the appropriate dose to perform clopidogrel pharmacokinetics is that of 300 mg or higher [17,38]. All patients were receiving atorvastatin and aspirin, which inhibit platelet activation, thus these drugs might have influenced the results of the present study [39,40]. However, both drugs were continuously administered during the length of the study; consequently it is unlikely that they could have influenced the present results. Furthermore, some patients were treated with drugs that could influence platelet function (Table S1). However, these drugs were administered during the length of the study. Additionally, when patients receiving each one of these drugs were excluded from statistical analysis, no significant changes of the described results were observed. Thus, any influence of these drugs on the results of the present study should be excluded.

In conclusion, the present results suggest that HDL is inversely associated with platelet activation in ACS patients undergoing PCI, independently of clopidogrel response variability. In contrast, an inverse association between paraoxonase activity of the HDL-associated PON-1 and platelet activation is observed after clopidogrel administration in patients adequately responding to clopidogrel but not in non-responders, especially the first days after drug loading, suggesting that PON-1 is an important determinant of clopidogrel antiplatelet efficacy in these patients. Considering that the platelet hyporesponsiveness to 75 mg per day clopidogrel may be overcome within 1 month of treatment, our findings may be clinically important in ACS patients undergoing PCI and receiving clopidogrel therapy, especially the first days after the episode.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Patients and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosure of Conflict of Interest
  9. References
  10. Supporting Information

Partially supported by the Regional Operational Programme (ROP) of Thessaly-Mainland Greece-Epirus within the frame of National Strategic Reference Framework for the programme period 2007-2013 (ESPA 2007-13).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Patients and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosure of Conflict of Interest
  9. References
  10. Supporting Information
  • 1
    Bhatt DL. Role of antiplatelet therapy across the spectrum of patients with coronary artery disease. Am J Cardiol 2009; 103(Suppl.): 11A9A.
  • 2
    Gachet C. P2 receptors, platelet function and pharmacological implications. Thromb Haemost 2008; 99: 46672.
  • 3
    Bonello L, Tantry US, Marcucci R, Blindt R, Angiolillo DJ, Becker R, Bhatt DL, Cattaneo M, Collet JP, Cuisset T, Gachet C, Montalescot G, Jennings LK, Kereiakes D, Sibbing D, Trenk D, van Werkum JW, Paganelli F, Price MJ, Waksman R et al. Working group on high on-treatment platelet reactivity. Consensus and future directions on the definition of high on-treatment platelet reactivity to adenosine diphosphate. J Am Coll Cardiol 2010; 56: 91933.
  • 4
    Bouman HJ, Parlak E, van Werkum JW, Breet NJ, ten Cate H, Hackeng CM, ten Berg JM, Taubert D. Which platelet function test is suitable to monitor clopidogrel responsiveness? A pharmacokinetic analysis on the active metabolite of clopidogrel J Thromb Haemost 2010; 8: 4828.
  • 5
    Sofi F, Marcucci R, Gori AM, Giusti B, Abbate R, Gensini GF. Clopidogrel non-responsiveness and risk of cardiovascular morbidity. An updated meta-analysis. Thromb Haemost 2010; 103: 8418.
  • 6
    Korporaal SJA, Akkerman JW. Platelet activation by low density lipoproteins and high density lipoproteins. Pathophysiol Haemost Thromb 2006; 35: 27080.
  • 7
    Nofer JR, Walter M, Kehrel B, Wierwille S, Tepel M, Seedorf U, Assmann G. HDL3-mediated inhibition of thrombin-induced platelet aggregation and fibrinogen binding occurs via decreased production of phosphoinositide– derived second messengers 1,2-diacylglycerol and inositol 1,4,5-tris-phosphate. Arterioscler Thromb Vasc Biol 1998; 18: 8619.
  • 8
    Vergani CG, Plancher AC, Zuin M, Cattaneo M, Tramaloni C, Maccari S, Roma P, Catapano AL. Bile lipid composition and haemostatic variables in a case of high density lipoprotein deficiency (Tangier disease). Eur J Clin Invest 1984; 14: 4954.
  • 9
    Naqvi TZ, Shah PK, Ivey PA, Molloy MD, Thomas AM, Panicker S, Ahmed A, Cercek B, Kaul S. Evidence that high-density lipoprotein cholesterol is an independent predictor of acute platelet-dependent thrombus formation. Am J Cardiol 1999; 84: 10117.
  • 10
    Harel M, Aharoni A, Gaidukov L, Brumshtein B, Khersonsky O, Meged R, Dvir H, Ravelli RB, McCarthy A, Toker L, Silman I, Sussman JL, Tawfik DS. Structure and evolution of the serum paraoxonase family of detoxifying and anti-atherosclerotic enzymes. Nat Struct Mol Biol 2004; 11: 4129.
  • 11
    Petraki MP, Mantani PT, Tselepis AD. Recent Advances on the Antiatherogenic Effects of HDL-Derived Proteins and Mimetic Peptides. Curr Pharm Design 2009; 15: 314666.
  • 12
    Costa LG, Cole TB, Jarvik GP, Furlong CE. Functional genomic of the paraoxonase (PON1) polymorphisms: effects on pesticide sensitivity, cardiovascular disease, and drug metabolism. Annu Rev Med 2003; 54: 37192.
  • 13
    Wheeler JG, Keavney BD, Watkins H, Collins R, Danesh J. Four paraoxonase gene polymorphisms in 11212 cases of coronary heart disease and 12786 controls: meta-analysis of 43 studies. Lancet 2004; 363: 68995.
  • 14
    Bhattacharyya T, Nicholls SJ, Topol EJ, Zhang R, Yang X, Schmitt D, Fu X, Shao M, Brennan DM, Ellis SG, Brennan ML, Allayee H, Lusis AJ, Hazen SL. Relationship of paraoxonase 1 (PON1) gene polymorphisms and functional activity with systemic oxidative stress and cardiovascular risk. JAMA 2008; 299: 126576.
  • 15
    Mackness B, Mackness B, Durrington P, McElduff P, Yarnell J, Azam N, Watt M, Mackness M. Low paraoxonase activity predicts coronary events in the caerphilly prospective study. Circulation 2003; 107: 27759.
  • 16
    Herrmann SM, Blanc H, Poirier O, Arveiler D, Luc G, Evans A, Marques-Vidal P, Bard JM, Cambien F. The Gln/Arg polymorphism of human paraoxonase (PON 192) is not related to myocardial infarction in the ECTIM study. Atherosclerosis 1996; 126: 299303.
  • 17
    Bouman HJ, Schömig E, van Werkum JW, Velder J, Hackeng CM, Hirschhäuser C, Waldmann C, Schmalz H-G, ten Berg JM, Taubert D. Paraoxonase-1 is a major determinant of clopidogrel efficacy. Νature Μed 2011; 1: 1106.
  • 18
    Sibbing D, Koch W, Massberg S, Byrne RA, Mehilli J, Schulz S, Mayer K, Bernlochner I, Schomig A, Kastrati A. No association of paraoxonase-1 Q192R genotypes with platelet response to clopidogrel and risk of stent thrombosis after coronary stenting. Eur Heart J 2011; 32: 160513.
  • 19
    Kalantzi KI, Dimitriou AA, Milionis HJ, Goudevenos IA, Tselepis AD. Clopidogrel differentially affects platelet-mediated thrombosis and inflammatory response in patients with acute coronary syndromes. J Thromb Haemost 2011; 4: 8758.
  • 20
    Mitsios JV, Tambaki AP, Abatzis M, Biris N, Sakarellos-Daitsiotis M, Sakarellos C, Soteriadou K, Goudevenos J, Elisaf M, Tsoukatos D, Tsikaris V, Tselepis AD. Effect of synthetic peptides corresponding to residues 313-332 of the alphaIIb subunit on platelet activation and fibrinogen binding to alphaIIbbeta3. Eur J Biochem 2004; 271: 85562.
  • 21
    Bonello L, Camoin-Jau L, Arques S, Boyer C, Panagides D, Wittenberg O, Simeoni MC, Barragan P, Dignat-George F, Paganelli F. Adjusted clopidogrel loading doses according to vasodilator-stimulated phosphoprotein phosphorylation index decrease rate of major adverse cardiovascular events in patients with clopidogrel resistance: a multicenter randomized prospective study. J Am Coll Cardiol 2008; 51: 140411.
  • 22
    Xiao Z, Theroux P. Clopidogrel inhibits platelet-leukocyte interactions and thrombin receptor agonist peptide-induced platelet activation in patients with an acute coronary syndrome. J Am Coll Cardiol 2004; 43: 19828.
  • 23
    Mitsios JV, Papathanasiou AI, Rodis FI, Elisaf M, Goudevenos JA, Tselepis AD. Atorvastatin does not affect the antiplatelet potency of clopidogrel when it is administered concomitantly for 5 weeks in patients with acute coronary syndromes. Circulation 2004; 109: 13358.
  • 24
    Tsimihodimos V, Karabina SA, Tambaki AP, Bairaktari E, Goudevenos JA, Chapman MJ, Elisaf M, Tselepis AD. Atorvastatin preferentially reduces LDL-associated platelet-activating factor acetylhydrolase activity in dyslipidemias of type IIA and type IIB. Arterioscler Thromb Vasc Biol 2002; 22: 30611.
  • 25
    Kakafika AI, Xenofontos S, Tsimihodimos V, Tambaki AP, Lourida ES, Kalaitzidis R, Cariolou MA, Elisaf M, Tselepis AD. The PON1 M55L gene polymorphism is associated with reduced HDL-associated PAF-AH activity. J Lipid Res 2003; 44: 191926.
  • 26
    Tsimihodimos V, Karabina S-A, Tambaki AP, Bairaktari E, Miltiadous G, Goudevenos JA, Cariolou MA, Chapman MJ, Tselepis AD, Elisaf M. Altered distribution of platelet activating factor-acetylhydrolase activity between LDL and HDL as a function of the severity of hypercholesterolemia. J Lipid Res 2002; 43: 25663.
  • 27
    Ferre N, Tous M, Paul A, Zamora A, Vendrell J, Bardaji A, Camps J, Richart C, Joven J. Paraoxonase Gln-Arg (192) and Leu-Met (55) gene polymorphisms and enzyme activity in a population with a low rate of coronary heart disease. Clin Biochem 2002; 35: 197203.
  • 28
    Ageno W, Becattini C, Brighton T, Selby R, Kamphuisen PW. Cardiovascular risk factors and venous thromboembolism: a meta-analysis. Circulation 2008; 117: 93102.
  • 29
    Brodde MF, Korporaal SJA, Herminghaus G, Fobker M, Van Berkel TJC, Tietge UJF, Robeneck H, van Eck M, Kehrel BE, Nofer JR. Native high-density lipoproteins inhibit platelet activation via scavenger receptor BI. Role of negatively charged phospholipids. Atherosclerosis 2011; 215: 37482.
  • 30
    Korporaal SJA, Illiana M, Hauer AD, Hildebrand RB, Hoekstra M, ten Cate H, Praticò D, Akkerman J-WN, van Berkel TJC, Kuiper J, van Eck M. Deletion of the high-density lipoprotein receptor scavenger receptor BI in mice modulates thrombosis susceptibility and indirectly affects platelet function by elevation of plasma free cholesterol. Arterioscler Thromb Vasc Biol 2011; 31: 3442.
  • 31
    Kalantzi KI, Dimitriou AA, Goudevenos JA, Tselepis AD. The platelet hyporesponsiveness to clopidogrel in acute coronary syndrome patients treated with 75 mg/day clopidogrel may be overcome within one month of treatment. Platelets 2011; doi:10.3109/09537104.2011.597527.
  • 32
    Palmerini T, Barozzi C, Tomasi L, Sangiorgi D, Marzocchi A, De Servi S, Ortolani P, Bacchi Reggiani L, Alessi L, Lauria G, Bassi M, Branzi A. A randomised study comparing the antiplatelet and antinflammatory effect of clopidogrel 150 mg/day versus 75 mg/day in patients with ST-segment elevation acute myocardial infarction and poor responsiveness to clopidogrel: results from the DOUBLE study. Thromb Res 2010; 125: 30914.
  • 33
    Aleil B, Jacquemin L, De Poli F, Zaehringer M, Collet J-P, Montalescot G, Cazenave J-P, Dickele M-C, Monassier J-P, Gachet C. Clopidogrel 150 mg/day to overcome low responsiveness in patients undergoing elective percutaneous coronary intervention: results from the vasp-02 (vasodilator-stimulated phosphoprotein-02) randomized study. JACC Cardiovasc Interv 2008; 1: 6318.
  • 34
    von Beckerath N, Kastrati A, Wieczorek A, Pogatsa-Murray G, Sibbing D, Graf I, Schömig A. A double-blind, randomized study on platelet aggregation in patients treated with a daily dose of 150 or 75 mg of clopidogrel for 30 days. Eur Heart J 2007; 28: 18149.
  • 35
    Mega JL, Close SL, Wiviott SD, Shen L, Walker JR, Simon T, Antman EM, Braunwald E, Sabatine MS. Genetic variants in ABCB1 and CYP2C19 and cardiovascular outcomes after treatment with clopidogrel and prasugrel in the TRITON–TIMI 38 trial: a pharmacogenetic analysis. Lancet 2010; 376: 13129.
  • 36
    Simon T, Verstuyft C, Mary-Krause M, Quteineh L, Drouet E, Méneveau N, Steg PG, Ferrières J, Danchin N, Becquemont L. French Registry of Acute ST-Elevation and Non-ST-Elevation Myocardial Infarction (FAST-MI) Investigators. Genetic determinants of response to clopidogrel and cardiovascular events. N Engl J Med 2009; 360: 36375.
  • 37
    Mega JL, Close SL, Wiviott SD, Shen L, Hockett RD, Brandt JT, Walker JR, Antman EM, Macias W, Braunwald E, Sabatine MS. Cytochrome P-450 Polymorphisms and response to clopidogrel. N Engl J Med 2009; 360: 35462.
  • 38
    von Beckerath N, Taubert D, Pogatsa-Murray G, Schömig E, Kastrati A, Schömig A. Absorption, metabolization, and antiplatelet effects of 300-, 600-, and 900-mg loading doses of clopidogrel: results of the ISAR-CHOICE (Intracoronary stenting and antithrombotic regimen: choose between 3 high oral doses for immediate clopidogrel effect) trial. Circulation 2005; 112: 294650.
  • 39
    Mitsios JV, Papathanasiou AI, Goudevenos JA, Tselepis AD. The antiplatelet and antithrombotic actions of statins. Curr Pharm Des 2010; 16: 380814.
  • 40
    Papathanasiou A, Goudevenos J, Tselepis AD. Aspirin resistance in cardiovascular disease: pathogenesis, diagnosis and clinical impact. Curr Pharm Des 2009; 15: 108594.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Patients and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosure of Conflict of Interest
  9. References
  10. Supporting Information

Table S1. Demographic, clinical and laboratory characteristics of the study population.

Table S2. Platelet activation parameters according to PON-1 Q192R genotypes.

FilenameFormatSizeDescription
JTH_4541_sm_TableS1-S2.pdf46KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.