SEARCH

SEARCH BY CITATION

Keywords:

  • Methanogen;
  • Flora;
  • 16S rDNA

Abstract

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

The methanogen flora of soil samples taken from nine paddy fields in Japan was analyzed. Archaeobacterial 16S-ribosomal DNA (positions 1112 to 1379 in the Escherichia coli numbering system) was amplified from DNA extracted directly from soil samples using PCR. The amplified DNA was cloned into the bluescript SK+ phagemid vector, and approximately 100 clones (10–30 clones for each soil sample) were sequenced. The composition of methanogen flora was deduced from ratios of the clones which were identified to genus level based on their sequences. Methanosarcina-like clones (which made up 55% of the total number of methanogen clones) were predominant in most of the soil samples. Methanogenium-like and Methanosaeta-like clones predominated in some soil samples, making up 25% and 17% of the total number of methanogen clones respectively. Individual clones were compared and identified in detail by calculating sequence similarities. All the Methanosarcina-like clones demonstrated sequences which were mostly identical to Methanosarcina mazei, and all of the Methanosaeta-like clones demonstrated sequences similar to Methanosaeta concilii. Less similarity was observed between the sequences of Methanogenium-like clones and those of Methanogenium and Methanoculleus, indicating that novel Methanogenium-like organisms exist in these soils as major methanogens.


1Introduction

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

Methane is one of the major greenhouse gases and it is widely known that its concentration in the atmosphere has been increasing [1–9]. The paddy field environment is considered to be a major source of atmospheric methane, and it is estimated that approximately 5–30% of methane released into the atmosphere originates from paddy fields [6, 10]. This methane is produced by the activity of methanogens. Although the mechanism of methanogenesis in paddy soils has been studied in the past [7, 8, 11–20], a comprehensive analysis of methanogenic flora in this environment has never been reported. In recent studies, methanogens were isolated from paddy fields, however only two strains of them were identified to species level [21, 22] and there was no information on whether or not they are the predominant methanogen type in this environment. The cultivation of methanogens is difficult and time consuming which greatly hinders the analysis of methanogenic flora, however the use of 16S ribosomal DNA (16S rDNA) or riobosomal RNA (rRNA) overcomes this difficulty as it can be carried out without the need for cultivation. These methods have proved to be a powerful tool for the analysis of methanogenic flora. The method of 16S rDNA sequencing was used by Oyaizu to analyze the methanogenic flora of sludge from a methane-fermenting plant [23]. This paper reports the use of this method for the methanogen flora analyses of paddy soils in Japan.

2Materials and methods

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

2.1Archaeal and bacterial strains

The microbial strains used were Methanobacterium wolfei DSM 2970T, Methanobacterium thermoformicicum strain FORI, Methanobrevibacter smithii DSM 861T, Methanobrevibacter arboriphilicus DSM 1125T and SA (=DSM 7056), Methanosaeta thermoacetophila DSM 4774T, Methanosarcina mazei strain TMA, Escherichia coli K12, Aeromonas hydrophila IAM 12337, Bacillus licheniformis IAM 13417, Citrobacter freundii IAM 12471, and Clostridium butyricum IAM 19240. M. arboriphilicus SA and M. mazei strain TMA were isolated from paddy soil in Kumamoto, Japan by Asakawa et al. [21, 22]. Cells of M. wolfei DSM 2970, M. thermoformicicum FORI, and M. thermoacetophila DSM 4774 were supplied by Drs. Y. Kamagata and K. Nakamura, National Institute of Bioscience and Human-Technology, Tsukuba, Japan, M. smithii DSM 861 and M. arboriphilicus DSM 1125 from Dr. G. Endo, Tohoku Gakuin University, Tagajyoshi, Miyagi, Japan, and M. arboriphilicus SA and M. mazei TMA from Dr. S. Asakawa, Kyushu National Agricultural Experiment Station, Nishigoshi, Kumato, Japan.

2.2DNA extraction from methanogens and bacteria

The DNA of methanogens and other bacteria was extracted with benzylchloride as described by Zhu et al. [24]. This was cleaned using phenol extraction followed by RNase treatment. DNA yields were measured using a spectrophotometer.

2.3Design of primers

The primers were designed to amplify the region of DNA between positions 1100 and 1400 of the 16S rRNA of archaea, based on sequences of methanogen 16S rRNA from the DNA data base. The sequences used in primer design were those of genus Methanobacterium (X68717, X71838, M59124, M36508, and Z37156), Methanococcoides (X65537), Methanococcus (M59125, M59126, M59128, M36507, and M59290), Methanocorpusculum (M59147), Methanoculleus (M59129 and M59134) Methanogenium (M59130 and M59131), Methanohalophilus mahii (M59133), Methanolobus (M59135), Methanopyrus (M59932), Methanosaeta (M59146), Methanosarcina (M59137, M59138, M59140, and M59144), Methanosphaera (M59139), Methanospirillum (M60880), and Methanothermus (M59145). From these data it is revealed that the 16S rRNA of methanogens does not contain EcoRI and SalI restriction enzyme sites. A SalI restriction enzyme site was added to the 5′ end of the annealing region of the 1100F primer, and an EcoRI site was added to the same region of the 1400R primer. The following two primers were designed: 1100F, 5′AACCGTCGACAGTCAGGYAACGAGCGAG3′; and 1400R, 5′CGGCGAATTCGTGCAAGGAGCAGGGAC3′. The annealing region of each primer contained more than 3 nucleotide missmatches to the 16S rDNA of bacteria and eucarya.

2.4Soils

The soils used for methanogen analysis were collected from the following paddy fields: Yamaguchi University (Gray Lowland soil), Kagoshima University (Gray Lowland soil), Saitama Agricultural Research Station (Gray Lowland soil), Yamagata-city (Gray Lowland soil), and the University of Tokyo Yayoi plot (Ando soil). In Yamaguchi University the soil samples were collected from three fields designated numbers 1, 2 and 3. Yamaguchi field No. 2 was not fertilized. The Yamaguchi fields 1 and 3 were fertilized with chemical fertilizer at the rate of 10.9 kg of N, 13.7 kg of P2O5, and 13.9 kg of K2O per 10 a every year. An additional 50 kg/a of rice straw compost was applied to field No. 1. The field of Kagoshima University was not fertilized. At the Saitama Agricultural Experiment Station soils were collected from three fields designated Nos. 1, 2 and 3. The Saitama field No. 1 was not fertilized. The Saitama field Nos. 2 and 3 were fertilized with chemical fertilizer at the rate of 5 kg of N, 8 kg of P2O5, and 3 kg of K2O per 10 a every year and 100 kg/a of wheat compost was applied to field No. 3. In Yamagata-city a soil sample was collected from a field which was managed by a local farmer, but the composition of the fertilizer applied to this field is unknown. The plot from which soil samples were taken at the University of Tokyo Yayoi (Ando soil) was not fertilized.

2.5DNA extraction from soil

DNA was extracted from 3 g of wet soil pellet by the method described by Zhu et al [24]. The crude DNA was purified with QIAGEN-tip 20 (QIAGEN Inc. Germany). The purified DNA was electrophoresed on a 1% agarose gel, and the DNA fragments larger than 10 kbp were extracted from the gel.

2.6PCR conditions

16S rDNAs were amplified using the polymerase chain reaction (PCR) and the primers discussed above. The PCR reaction mixture contained 1 unit of Taq polymerase, 50 mM Tris HCl (pH 9.0), 50 mM NaCl, 10 mM MgCl2, 200 μM each of dATP, dGTP, dCTP, and dTTP, 20 pmol of each primer and 50 to 100 ng of template DNA in a total volume of 50 μl. Each reaction mixture was heated at 94°C for 90 s followed by 35 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 90 s. This was followed by 72°C for 180 s.

2.7Flora analysis of methanogens in paddy field

Flora analysis was carried out using the method described by Oyaizu [23]. Amplified 16S rDNA was digested with EcoRI and SalI. The 16S rDNA fragments of approximately 300 base pairs were purified by agarose gel electrophoresis and subcloned into the Bluescript SK+ phagemid vector.

For each soil sample approximately 50 colonies were picked up and 10–30 clones were selected for sequence determination between the 1112 and 1379 positions according to the Escherichia coli numbering system. Sequencing reactions were carried out using a Thermo Sequenase fluorescent labelled primer cycle sequencing kit (Amersham International plc, England), and a Perkin Elmer model 310 DNA sequencer. The sequences obtained were compared with each other and sequences from the DNA data base. Identification of the clones was carried out based on sequence similarity and signature sequences for each genus.

2.8Enrichment of methanogenium-like organisms

A modified version of DSM medium 141, which did not contain NaCl, was used for the enrichment of methanogens. The gas phase was H2-CO2 (4:1) pressurized to 203 Pa. Yamaguchi soil samples of 1 g were added to 120 ml serum bottles containing 40 ml of medium and incubated at 37°C for 60 days. The enrichment culture was maintained by transferring 0.5 ml of culture to 10 ml of fresh medium every week. After 5 transfers the enrichment culture was inoculated into medium containing 100 μg/ml of vancomycin.

3Results and discussion

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

3.1DNA extraction from methanogens and bacteria

Yields of DNA extracted from methanogens and other bacteria are shown in Table 1. The DNA yields varied between strains, however the yields from methanogens were not smaller than those from other bacteria. DNA yields from the pseudomulein-containing species M. wolfei, M. thermoformicicum, and M. arboriphilicus were no smaller than those from species which do not contain pseudomulein such as M. thermoacetophila and M. mazei. The DNA extraction method described by Zhu et al. [24] was considered to be satisfactory for methanogen flora analysis.

Table 1.  DNA yields from representative methanogens and bacteria
Species and strain designationYields (mgDNA/g dry cell)
Methanogens
Methanobacterium wolfei DSM 2970T3.7
Methanobacterium thermoformicicum strain FORI1.8
Methanobrevibacter smithii DSM 861T3.4
Methanobrevibacter arboriphilicus DSM 1125T4.4
Methanobrevibacter arboriphilicus SA(=DSM 7056)3.2
Methanosaeta thermoacetophila DSM 4774T6.2
Methanosarcina mazei TMA2.6
Bacteria
Escherichia coli K12 JM1091.5
Aeromonas hydrophila IAM 123371.9
Citrobacter freundii IAM 124713.0
Bacillus licheniformis IAM 134175.2
Clostridium butyricum IAM 192405.2

Yields of DNA extracted from soils are shown in Table 2. The final yields of purified DNAs were smaller than the crude extracts as DNA was lost during the intervening steps such as agarose gel electrophoresis. The DNA yields from soils to which an organic manure had been applied were larger than those from soils which had been exposed to chemical fertilizer or no fertilizer.

Table 2.  DNA yields from soils
Paddy soils collected from:Yields (μgDNA/g wet soil)
Yamaguchi University field No. 10.79
   (chemical fertilizer and compost applied field) 
Yamaguchi University field No. 20.49
   (fertilizer not applied field) 
Yamaguchi University field No. 30.30
   (chemical fertilizer applied field) 
Kagoshima University field0.38
   (fertilizer not applied field) 
Saitama Agricultural Station field No. 10.67
   (fertilizer not applied field) 
Saitama Agricultural Station field No. 20.95
   (chemical fertilizer applied field) 
Saitama Agricultural Station field No. 31.02
   (chemical fertilizer and compost applied field) 
Yamagata-city field0.51
Yayoi field of University of Tokyo0.41
   (fertilizer not applied field) 

3.2Identification of methanogens based on signature sequences

Asakawa et al. isolated Methanobrevibacter arboriphilicus strain SA [22] and Methanosarcina mazei strain TMA [21] from paddy soil. We sequenced the region of 16S rRNA between positions 1112 and 1379 (according to the Escherichia coli numbering system) from these two strains. Four clones from each strain were sequenced and consensus sequences determined. The average difference between the consensus sequences from the four clones was 0.25 bases for M. mazei strain TMA and 0 bases for M. arboriphilicus strain SA. The sequences from M. mazei, M. arboriphilicus and 27 methanogen sequences available from the DNA data base were aligned according to the secondary structure of E. coli 16S rRNA. Signature sequences specific to each genus were determined based on their alignment as shown in Table 3. The data for the genera Methanococcoides, Methanocorpusculum, Methanohalophilus, Methanolobus, Methanopyrus, Methanosaeta, Methanothermus, and Methanospirillum were limited (one sequence for each genus) which resulted in a reduction of the accuracy of identifications based on their signature sequences. Because of this, the identification of these species was also carried out by calculating sequence homologies between the clones and sequences from the DNA data base.

Table 3.  Signature sequences to distinguish methanogen genera found in 16S rDNA positions from 1112 to 1379
GeneraPositions (in E. coli numbering)
 120512191232125712981310132713421355–1356
MethanobacteriumTTGTTATGGT
MethanobrevibacterTTGTTATGGT
MethanococcoidesTCGTTATCGT
MethanococcusCTGYTWWCGC or AG
MethanocorpusculumCCGATCGCGT
MethanogeniumCCGAWTACGT
MethanohalophilusTCGTTATCGT
MethanolobusTAGCTATCGT
MethanopyrusTCGTTCGCGT
MethanosaetaTCAATATCGT
MethanosarcinaTCGCTATCGT
MethanosphaeraTTGTTATCAT
MethanospirillumCCGTACGCGT
MethanothermusTCGATATGGG

3.3Methanogen-like clones isolated from paddy soils in Japan

A total of 100 clones were sequenced, many of which were shown to contain archaeal 16S rDNA. None of the clones contained 16S rDNA from eucaryotes or other bacteria. Identification of the clones is shown in Table 4. Among the archaeal clones, eleven did not appear to be methanogens because the sequence similarities between these clones and methanogen sequences were very low (lower than 84%). Some of these clones were related to the sequences of Crenarchaeota, which are known as extreme thermophiles or sulfur-dependent archaea [25]. Others were related to marine planktonic archaea [26]. Details of the phylogenetic position of the eleven clones will be reported in another paper. Of the 100 clones, 89 were identified as methanogens. Of the methanogens, 54% (48 clones) had Methanosarcina-like sequences, 26% (23 clones) Methanogenium-like sequences, and 17% (15 clones) Methanosaeta-like sequences.

Table 4.  Archaeobacterial clones isolated from pady soils
SoilsNumber of clones identified as:
 MethanosarcinaMethanogeniumMethanosaetaMethanobacteriumOther methanogensUnknown Archaeobacteria
Yamaguchi No. 1092000
Yamaguchi No. 2055000
Yamaguchi No. 31021004
Kagoshima235020
Saitama No. 1810001
Saitama No. 21010001
Saitama No. 31110001
Yamagata112104
Tokyo600000
Total4823151211

The 16S rDNA sequences were available for four species of the genus Methanosarcina (M. adcidovorans, M59137; M. barkeri, M59144; M. mazei, M59138, M. thermophila, M59140). Sequence differences between Methanosarcina-like clones and the four Methanosarcina species are shown in Table 5. Sixteen types of Methanosarcina-like sequences were found among the Methanosarcina-like sequences. These sequence varieties were very close to each other, having very small differences of less than 6 nucleotides. Sixteen of the clone sequences were closely related to M. mazei and the four species of Methanosarcina.

Table 5.  16S rDNA sequences (from positions 1112 to 1379) between soil Methanosarcina-like clones and Methanosarcina species
Clones or speciesNumber of different nucleotides to:
 1234567891011121314151617181920
1. GU314                    
2. GU3161                   
3. GU31332                  
4. GU323324                 
5. GU352133                
6. GU3821332               
7. GU319322433              
8. SW381244334             
9. SC221132213            
10. SC11322433241           
11. SC43224332412          
12. SC1543354435233         
13. SC6322433241223        
14. S062133223321343       
15. S0432243324122323      
16. S018213322332124323     
17. M. mazei2113221301121212    
18. M. barkeri9881099810788789898   
19. M. acetivorans766877685665676764  
20. M. thermophila7668776856656767664 

Sequence differences between Methanosaeta-like clones and Methanosaeta concilii are shown in Table 6. Five sequence varieties were found among the Methanosaeta-like clones and the sequence differences between these varieties ranged from 1 to 6 nucleotides. The variation between these five sequences and that of M. concilii was found to be larger (4 to 7 nucleotides).

Table 6.  16S rDNA sequence differences (from positions 1112 to 1379) between soil Methanosaeta-like clones and Methanosaeta species
Clones or speciesNumber of different nucleotides to:
 K13GU18GU22GU112GU3p5M. concilii
K13      
GU183     
GU2252    
GU12413   
GU3p56334  
M. concilii74655 

16S rDNA sequences were available for two species of the genus Methanogenium (M. cariaci, M59130; and M. organophilum, M59131) and for two species of the genus Methanoculleus (M. marisnigri, M 59134; and M. thermophilicus, M59129). Sequence differences between the Methanogenium-like clones and the four species of the genera Methanogenium and Methanoculleus are shown in Table 7. The genus Methanoculleus was separated from the genus Methanogenium on the basis of physiological differences [27] and DNA–DNA hybridization studies [28]. Based on 16S rDNA homologies, the genus Methanoculleus was considered to be most closely related to the genus Methanogenium. Eight sequence varieties were found among the Methanogenium-like clones, the differences between them ranging between 1 and 9 nucleotides. The sequences of these eight varieties differed greatly from those of the four species of the genera Methanogenium and Methanoculleus with differences occuring in the range of 20 to 25 nucleotides. The eight Methanogenium-like clones had more sequence similarity to Methanogenium (or Methanoculleus) than they did to other methanogen genera (which had differences of more than 35 nucleotides) in addition to containing the signature sequence of Methanogenium and Methanoculleus. This would indicate that the organisms from which these eight clones were derived must form a sister group to Methanogenium and Methanoculleus and thus represent a new genus.

Table 7.  16S rDNA sequence differences (from positions 1112 to 1379) between soil Methanogenium-like clones and species of the genera Methanogenium and Methanoculleus
Clones or speciesNumber of different nucleotides to:
 GU14GU19GU3p3GU15GU13GU17GU24SC10Mg. cariaciMg. organophilusMc. marisnigriMc. thermophilum
  1. Abbreviations are Mg, Methanogenium; and Mc, Methanoculleus.

GU14            
GU196           
GU13p326          
GU15828         
GU134648        
GU1717395       
GU24153732      
SC102426231     
Mg. cariaci2123232523222223    
Mg. organophilum22232425242323241   
Mc. marisnigri21232125232222211414  
Mc. thermophilum202220242221212017179 

3.4Differences in clones isolated from soil samples

Of the nine soils sampled, a clone composition of predominantly Methanosarcina was the most common. Examples of this are the Yamaguchi soil No. 3, Saitama soils Nos. 1, 2, and 3, and Tokyo yayoi soil. Another composition pattern was dominated by Methanogenium and Methanosaeta clones and the Yamaguchi soils No. 1 and 2 belonged to this group. The Kagoshima and Yamagata soils contained many kinds of methanogen clones.

Differences in the methanogen clone compositions are not necessarily due to the differences in soil characteristics. Yamaguchi soils No. 1, No. 2 and No. 3 were collected in the same field of Yamaguchi University. Yamaguchi soil No. 3, which is a Methanosarcina predominating type, differed from Yamaguchi soils No. 1 and No. 2 in its methanogen clone composition. The field from which soil sample No. 3 was collected was harvested according to a double cropping system in which rice was planted in summer and the field was used for pasture in the other seasons, whereas the two fields from which soils Nos. 1 and 2 were collected were not used during off-cropping seasons. It is conceivable that the cropping system used in a field may affect the methanogen composition of the soil.

Differences in the type of fertilizer applied to the fields did not appear to have an affect upon the methanogen clone composition found in the soil. Saitama soils were collected from three adjacent plots which had been treated with different fertilizers for at least 20 years, however these soils did not appear to be different in terms of methanogen clone composition. Similarly, the Yamaguchi soils No. 1 and No. 2 had been treated with different fertilizers for 28 years, but no serious differences were observed in clone composition.

3.5Dominant sequence varieties of the genera Methanosarcina, Methanogenium, and Methanosaeta in Japanese paddy fields

The distribution of isolated sequence varieties is shown in Table 8. In Methanosarcina-like clones the SC2 type of sequence, which is identical with the sequence of M. mazei, was most predominant. These clones also predominantly contained the GU316 sequence type. These two sequences were isolated from many soil samples collected throughout Japan. The sequence differences between the clones SC2 and GU316 were shown to be one nucleotide. These clones are phylogenetically very close, and it is not clear whether they are derived from different species or from the same chromosome. As for the other 14 sequence varieties of Methanosarcina-like clones, only one clone was found for each sequence variety. The 14 sequence varieties were very close to SC2 and GU316 and it is possible that the observed sequence variation was a result of misreading by Taq polymerase. Sogin [29] reported that the amplified 16S rDNA clones were different at one to five positions per 1000 base pairs. We confirmed that partial 16S rDNA clones (of approximately 280 base pairs) from Methanosarcina mazei and Methanobrevibacter arboriphilicus demonstrate average differences of 0.25 and 0 bases, respectively. The differences found between the clones isolated from soils were larger than the differences found between clones derived from a single strain. Therefore, it is more likely that the sequence varieties isolated from soils were derived from different methanogen species.

Table 8.  Distribution of methanogen clones among soil samples
Sequence varietiesSoil samples collected from:
YamaguchiKagoshimaSaitamaYamagataTokyo
  1. Numbers refer to numbers of isolated clones.

Methanosarcina clones
SC2  1413
GU316427 3
GU3141    
GU3131    
GU3231    
GU351    
GU381    
GU3191    
SW38  1  
SC4  1  
SC5  1  
SC6  1  
SC11  1  
S04  1  
S06  1  
S018  1  
Methanogenium clones
GU144221 
GU194    
GU1531   
GU3p31    
GU1241    
GU171    
GU132    
SC10  1  
Methanosaeta clones
GU1824 2 
GU224    
GU121    
GU3p51    
K13 1   

In Methanogenium-like clones three types of sequences, GU14, GU19, and GU15 were predominant (Table 8). The GU14 type of sequence was isolated from four soil samples, and this type of Methanogenium is considered to be the most predominant species in Japanese paddy fields.

In Methanosaeta-like clones the GU18 and GU22 sequences were predominant (Table 8). The GU18 type of sequence was isolated from three soil samples, and this type of Methanosaeta is considered to be predominant in Japanese paddy fields.

3.6What is the real methanogen flora of a paddy field?

16S rDNA clone analysis is one method used to analyze the bacterial flora of an environment. Because the cultivation of methanogens is difficult, a method of analysis which does not require cultivation has clear advantages. It is not clear, however, how well the 16S rDNA clone analysis method reflects the true methanogen composition of an environment.

Oyaizu [23] reported that the number of 16S rDNA clones were proportionate to the dry weight of cells in a model system of mixed bacteria. Therefore, if DNA is extracted effectively from each bacterium, it would be possible for the number of clones to correlate with the cell weights.

Members of the genus Methanogenium are considered to live in marine environments [9], however our study has revealed that Methanogenium species make up a major component of the methanogen population of the paddy soil environment. In order to confirm the presence of Methanogenium species in paddy soil, we enriched for methanogens using Yamaguchi soil No. 1, in which Methanogenium-like clones were most dominant. Although we did not get a pure culture of this methanogen, the enriched methanogens were coccoid like Methanogenium species, and Methanogenium-like sequences of 16S rDNA were present in the enriched culture. The presence of Methanogenium-like organisms in paddy soils is also pointed out by the analysis of soil lipids (personal communication from Dr. Y. Koga, University of Occupational and Environmental Health, Kitakyushu, Japan).

Methanosarcina-like clones are dominant in many Japanese paddy soils. Takai [19] showed that acetate-utilizing methanogens are dominant in Japanese paddy soils using the analyses of carbon flow in paddy fields. The genera Methanosarcina and Methanosaeta are acetate-utilizing methanogens, and the genus Methanogenium is a hydrogen-utilizing one. The percentages of acetate-utilizing methanogens at clone level are in the range of 60 to 100 (average is 87%). Thus, our clone analysis corresponds well with the Takai's results.

Acknowledgements

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

We thank S. Kanazawa, M. Nishiyama and S. Hidaka for providing soils, S. Asakawa for providing M. mazei and M. arboriphilicus strains, Y. Kamagata, K. Nakamura and G. Endo for supplying methanogen cells, and S. Matsumoto and Y. Koga for kind advice.

References

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References
  • 1
    Blake, D.R. and F.S. Rowland (1988) Continuing worldwide increase in troposheric methane, 1978 to 1987. Science, 239, 11291131.
  • 2
    Khalil, M.A.K. and R.A. Rasmussen (1993) Decreasing trend of methane: Unpredictability of future concentrations. Chemosphere, 26, 803814.
  • 3
    Khalil, M.A.K. and R.A. Rasmussen (1994) Global emissions of methane during the last several centuries. Chemosphere, 29, 833842.
  • 4
    Machida, T., T. Nakazawa, M. Tanaka, Y. Fujii, S. Aoki, and O. Watanabe (1994) Atomospheric CH4 and N2O concentrations during the last 250 years deduced from H15 ice core, antarctica. In: Proceedings of the International Symposium on global cycles of atomospheric greenhouse gases eds.), pp. 113–116.
  • 5
    Steel, L.P., P.J. Fraser, R.A. Rasmussen, M.A.K. Khalil, T.J. Conway, R.H. Crawford, R.H. Gammon, K.A. Masarie, and K.W. Thoning (1987) The global distribution of methane in the troposphere. J. Atomos. Chem., 5, 125171.
  • 6
    Tyler, S.C. (1991) The global methane budget. In: Microbial Production and Consumption of Greenhouse Gases: Methane, Nitrogen Oxide, and Halomethanes (Rogers, J.E. and Whiteman, W.B.s eds.), American Society for Microbiology, Washington D.C.
  • 7
    Zander, R., P.H. Demoulin, D.H. Ehhalt, and U. Schmidt (1989) Secular increase of the vertical columun abundance of methane derived from IR solar spectra recorded at the Jungfraujoch station. J. Geophys. Res., 94, 1102911039.
  • 8
    Banik, A., M. Sen, and S.P. Sen (1985) Methane emission from paddy soils fertilized with cowdung and farmyard manure. Chemosphere, 30, 11931208.
  • 9
    Boone, D.R., W.B. Whitman, and P. Rouviere (1993) Diversity and Taxonomy of methanogens. In: Methanogenesis (Ferry, J.G.s eds.), pp. 35–80. Chapman and Hall Co., New York.
  • 10
    IPCC (1995) Greenhouse Gas Inventory, Working Book. IPCC, London.
  • 11
    Conrad, R., F. Bak, H.J. Seitz, B. Thebrath, H.P. Mayer, and H. Schutz (1989) Hydrogen turnover by psychrotrophic homoacetonenic and mesophilic methanogenic bacteria in anoxic paddy soil and lake sediment. FEMS Microbiol. Ecol., 62.285–294.
  • 12
    Hori, K., K. Inubushi, S. Matsumoto, and K. Wada (1990) Competition for acetic acid between methane formation and sulfate reduction in the paddy soil. Jpn. J. Soil Sci. Plant Nutr., 61, 572578.
  • 13
    Hori, K., K. Inubushi, S. Matsumoto, and H. Wada (1993) Competition for hydrogen between methane formation and sulfate reduction in the paddy soil. Jpn. J. Soil Sci. Plant Nutr., 64, 363367.
  • 14
    Inubushi, K., Y. Muramatsu, and M. Umebayashi (1992) Influence of percolation on methane emission from flooded paddy soil. Jpn. J. Soil Sci. Plant Nutr., 63, 184189.
  • 15
    Inubushi, K., Y. Muramatsu, and M. Umebayashi (1994) Effect of incorporation-timing of rice straw on methane emissions from paddy soil. Jpn. J. Soil Sci. Plant Nutr., 65, 2226.
  • 16
    Itou, J. and K. Iimura (1989) Decomposition of rice straw and evolution of gas at paddy field of Clayey Gley soil in Hokuriku district in Japan. Jpn. J. Soil Sci. Plant Nutr., 60, 290297.
  • 17
    Kimura, M., H. Murakami, and H. Wada (1991) CO2, H2, CH4 production in rice rhizosphere. Soil Sci. Plant Nutr., 37, 5560.
  • 18
    Schuts, H., W. Seiler, and R. Conrad (1989) Process involved in formation and emission of methane in rice paddies. Biochemistry, 7, 3353.
  • 19
    Takai, Y. (1970) The mechanism of methane fermentation in flooded paddy soil. Soil Sci. Plant Nutr., 16, 238244.
  • 20
    Kumagai, K., K. Yagi, H. Tsuruta, and K. Minami (1993) Emmission, changes in production and oxidation of methane from Japanese rice paddy fields. Jpn. J. Soil Sci. Plant Nutr., 64, 368376.
  • 21
    Asakawa, S., M. Akagawa-Matsushita, H. Morii, Y. Koga, and K. Hayano (1995) Characterization of Methanosarcina mazei TMA isolated from a paddy field soil. Curr. Microbiol., 31, 3438.
  • 22
    Asakawa, S., H. Morii, M. Akagawa-Matsushita, Y. Koga, and K. Hayano (1993) Characterization of Methanobrevibacter arboriphilicus SA isolated from a paddy field soil and DNA–DNA hybridization among M. arboriphilicus strains. Int. J. Syst. Bacteriol., 43, 683686.
  • 23
    Oyaizu, H. (1992) Bacterial identification and flora analysis by 16S rRNA sequencing. In: Biseibutunoseitai (18 eds.), pp. 51–60. Gakkaishuppan Center Co., Tokyo.
  • 24
    Zhu, H., F. Qu, and L.-H. Zhu (1993) Isolation of genomic DNAs from plants, fungi and bacteria using benzyl chloride. Nucleic Acid Res., 21, 52795280.
  • 25
    Woese, C.R., O. Kandler, and M.L. Wheelis (1990) Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc. Natl. Acad. Sci. USA, 87, 45764579.
  • 26
    Fuhrman, J.A., K. McCallum, and A.A. Davis (1992) Novel major archaebacterial group from marine plankton. Nature, 356, 148149.
  • 27
    Maestrojuan, G.M., D.R. Boone, L. Xun, R.A. Mah, and L. Zhang (1990) Transfer of Methanogenium bourgense, Methanogenium marisnigri, Methanogenium olentangyi, and Methanogenium thermophilium to the genus Methanoculleus gen. nov., emendation of Methanoculleus marisnigri and Methanogenium, and description of new strains of Methanoculleus bourgense and Methanoculleus marisnigri. Int. J. Syst. Bacteriol., 40, 117122.
  • 28
    Xun, L., D.R. Boone, and R.A. Mah (1989) Deoxyribonucleic acid study of Methanogenium and Methanocorpusculum species, emendation of the genus Methanocorpusculum, and transfer of Methanogenium aggregans to the genus Methanocorpusculum, as Methnocorpusculum aggregans comb. nov. Int. J. Syst. Bacteriol., 39, 109111.
  • 29
    Sogin, M.L. (1990) Amplification of ribosomal RNA genes for molecular evolution studies. In: PCR protocols (Innis, M.A., et al. eds.), pp. 307–314. Academic Press, Inc., New York.