Phylogeny of sulfate-reducing bacteria1

Authors


  • 1

    Florida Agricultural Experiment Station Journal Series No. R06662.

*Corresponding author. 2169 McCarty Hall, University of Florida, Gainesville, FL 32611-0290, USA. Tel.:+1 (352) 392-5790; Fax: +1 (352) 392-3902 avo@gnv.ifas.ufl.edu

Abstract

Sulfate-reducing bacteria (SRB) are a diverse group of prokaryotes that may be divided into four groups based on rRNA sequence analysis: Gram-negative mesophilic SRB; Gram-positive spore forming SRB; thermophilic bacterial SRB; and thermophilic archaeal SRB. In this review, we have assembled representative 16S rRNA sequences reported to date for SRB and have constructed phylogenetic trees from these sequences. Physiological characteristics particular to each of these groups are discussed, as is the availability of tested group-specific phylogenetic probes and PCR primers directed toward individual groups.

1Introduction

Sulfate-reducing bacteria (SRB) constitute a diverse group of prokaryotes that contribute to a variety of essential functions in many anaerobic environments. In addition to their obvious importance to the sulfur cycle, SRB are important regulators of a variety of processes in wetland soils, including organic matter turnover, biodegradation of chlorinated aromatic pollutants in anaerobic soils and sediments, and mercury methylation [1,2]. Because of their importance to critical processes in ecosystem functioning and environmental remediation, interest in SRB has been increasing over the last 10 years. With the development of rRNA phylogenetic analysis, notable advances have been made in the taxonomy and phylogeny of this very diverse group [3].

Phylogenetic classification of SRB by rRNA sequence analysis has a variety of advantages, including providing insights into the evolutionary origins of sulfate reduction in distantly related species, and in facilitation of development of group-specific phylogenetic probes and PCR primers for use in ecological studies. A comprehensive review of SRB phylogeny is important at this time to assemble recent work from a variety of laboratories and clearly define the SRB genera belonging to each group. This MiniReview will review and compile recent advances in defining phylogenetic relationships between the various branches of this diverse functional group of microorganisms.

SRB are a complex physiological bacterial group, and various properties have been used in traditional classification schemes (Table 1). The most important of these properties were cell shape, motility, GC content of DNA, presence of desulfovirin and cytochromes, optimal temperature, and complete versus incomplete oxidation of acetate. For classification within a particular genus, different electron donors are tested. Analysis of rRNA sequences has allowed organization of the various SRB species into four distinct groups: Gram-negative mesophilic SRB; Gram-positive spore forming SRB; thermophilic bacterial SRB; and thermophilic archaeal SRB. All of these groups are characterized by their use of sulfate as a terminal electron acceptor during anaerobic respiration. Assignation of individual species into appropriate groups based on rRNA analysis is in general agreement with those obtained by traditional taxonomy, although some exceptions exist and will be discussed below.

Table 1.  Important characters in the classification of representative sulfate-reducing bacteria
  1. aI, incomplete.

  2. bC, complete.

  3. cn.r., not reported.

ShapeMotilityGC content of DNA (%)DesulfovirinCytochromesOxidation of acetateGrowth temp. (°C) 
Gram-negative mesophilic SRB
Desulfobulbuslemon to rod−/+59–60b, c, c3Ia25–40
Desulfomicrobiumovoid to rod+/−52–67b, cI25–40
Desulfomonasrod66+cI30–40
Desulfovibriospiral to vibrioid+49–66+/−c3, b, cI25–40
Desulfobacteroval to rod+/−44–46Cb20–33 
Desulfobacteriumoval to rod+/−41–52b, cC20–35
Desulfococcusspherical or lemon−/+46–57+/−b, cC28–35
Desulfomonilerod49+c3C37
Desulfonemafilamentsgliding35–42+/−b, cC28–32
Desulfosarcinaoval rods or coccoid, packages+/−51b, cC33
Gram-positive spore-forming SRB
Desulfotomaculumstraight to curved rods+48–52b, cI/Cmost 25–40, some 40–65
Bacterial thermophilic SRB
Thermodesulfobacteriumvibrioid to rod−/+30–38c3, cI65–70
Archaeal thermophilic SRB
Archaeoglobuscoccoid+/−41–46n.r.cI64–92

All sequences used in our analyses were obtained from the latest version of GenBank (http://www.ncbi.nlm.nih.gov) and initially aligned by the Pileup function of GCG [4]. Final alignments were constructed by visual inspection in PAUP* 4.0b2a [5]. Trees were built by a maximum parsimony method using PAUP* 4.0b2a [5], and bootstrap support was obtained by heuristic searches of the re-weighted trees with 1000 replicates.

2Gram-negative mesophilic SRB

This group of SRB is located within the delta subdivision of the Proteobacteria (Figs. 1 and 2). At some point in their evolutionary history, the delta subdivision diverged from other Proteobacteria from a common ancestral phototroph, and members of the delta subdivision lost their photosynthetic ability and converted to heterotrophy [6].

Figure 1.

Phylogenetic tree for the Gram-negative mesophilic SRB, with emphasis on the family Desulfovibrionaceae. Numbers before branch points represent percentages of bootstrap resampling based on 1000 trees. Bootstrap values below 50% are not presented.

Figure 2.

Phylogenetic tree for the Gram-negative mesophilic SRB, with emphasis on the family Desulfobacteriaceae. Numbers before branch points represent percentages of bootstrap resampling based on 1000 trees. Bootstrap values below 50% are not presented.

The delta subdivision includes such non-SRB as sulfur-reducing bacteria (Desulfurella, Desulfuromusa, and Desulfuromonas), Myxobacteria and Bdellovibrio, and Pelobacter and Geobacter[7]. Phylogenetic relationships between SRB and other members of the delta subdivision remains unresolved [8], although it has been suggested that Myxobacteria and bdellovibrios may represent aerobic adaptations of an ancestral anaerobic sulfur-metabolizing phenotype [8,9]. Devereux et al. [10], however, reported that placement of the exact root of Myxobacteria (inside or outside the Gram-negative mesophilic SRB) is affected by the outgroup sequences used to construct the tree, suggesting that Myxobacteria may not have originated from within this group of SRB.

Pelobacter and Geobacter reduce Fe(III) to Fe(II), a metabolic characteristic partially shared with some SRB belonging to this group. However, to date no known Gram-negative SRB that reduce Fe(III) to Fe(II) are capable of growth with Fe(III) as a sole electron acceptor [11].

Two families of SRB have been proposed within the δ-Proteobacteria: the Desulfovibrionaceae (presented in detail in Fig. 1) and the Desulfobacteriaceae (presented in detail in Fig. 2) [10,12]. The Desulfovibrionaceae family includes the genera Desulfovibrio and Desulfomicrobium. It should be noted that a reclassification has been proposed for Desulfomonas pigra to Desulfovibrio piger based on 16S rRNA sequence analysis [13], although D. piger is different from other desulfovibrios in its motility (nonmotile) and shape (rod versus vibrioid). Two recently described genera, Desulfohalobium (represented by D. retbaense; GenBank accession number U48244) and Desulfonatronum (represented by D. lacustre; GenBank accession number Y14594), have not yet been officially placed within the family Desulfovibrionaceae, although they fall firmly within this family by our analyses.

The original Desulfobacteriaceae family (Fig. 2) included all SRB within the δ-Proteobacteria that were not part of the Desulfovibrionaceae [10,12]. This rather broad definition included species of the genera Desulfobulbus, Desulfobacter, Desulfobacterium, Desulfococcus, Desulfosarcina, Desulfomonile, Desulfonema, Desulfobotulus, and Desulfoarculus. Our analyses suggest that several newly proposed genera may fall within the Desulfobacteriaceae on the basis of rRNA sequence analysis. These newly added genera include Desulfobacula, Desulfospira, Desulfocella, Desulfobacca, Desulfacinum, Thermodesulforhabdus, Desulforhabdus, Desulfocapsa, Desulforhopalus, and Desulfofustis. Reclassification of the genera Desulfobotulus and Desulfoarculus to Desulfovibrio sapovorans as Desulfobotulus sapovorans, and Desulfovibrio baarsii as Desulfoarculus baarsii has recently been proposed [3,13], although no official reclassifications have been published to date concerning these proposals. Phylogenetic analyses suggest that these two species do not belong to the Desulfovibrionaceae family, a finding consistent with metabolic features (specifically electron donors) of these two species compared with the desulfovibrios [8]. The majority of members of this family are mesophilic; however, Desulfacinum infernum (GenBank accession number L27426) and Thermodesulforhabdus norvegicus[14] are thermophilic.

A precise definition of the family Desulfobacteriaceae is not possible by our analyses, nor is the accurate inclusion of certain genera in this family. This ambiguity is due to the lack of support provided by bootstrap resampling at critical branches within the proposed Desulfobacteriaceae (Fig. 2). The Desulfobulbus and Desulfocapsa/Desulfofustis clusters may represent a deeply branching group that may constitute a separate family, or they may be placed within the Desulfobacteriaceae. More physiological characterization and sequence data of related species are required to confirm or reject their placement within the Desulfobacteriaceae.

Interesting morphological aspects of the Desulfobacteriaceae family include formation of clumps, as is seen in Desulfosarcina, and the gliding motion of filamentous Desulfonema. Clump formation can provide protection against unfavorable changes in environmental redox potential, and the gliding motility of Desulfonema allows these bacteria to move against chemical gradients to reach areas of favorable nutrient concentration. Moreover, the formation of filaments by this SRB may provide resistance against phagocytosis by ciliates and amebas [15].

3Gram-positive spore forming SRB

This general group is dominated by the genus Desulfotomaculum, and is placed within low GC Gram-positive bacteria (Fig. 3) such as Bacillus and Clostridium. These include the only SRB known to form heat-resistant endospores, a trait shared with many Bacillus and Clostridium species. In contrast with the mesophilic SRB, some species of Desulfotomaculum are thermophilic, although their optimal growth temperatures are lower than those of thermophilic Gram-negative and archaeal sulfate reducers (Table 1).

Figure 3.

Phylogenetic tree for the genus Desulfotomaculum within the cluster of low G+C content Gram-positive bacteria. Numbers before branch points represent percentages of bootstrap resampling based on 1000 trees. Bootstrap values below 50% are not presented.

To date, a single family of SRB has been proposed within the Gram-positive SRB. Changes within this family are currently being proposed, however, and these changes are supported by our analyses. These proposed changes include reclassification of Desulfotomaculum guttoideum to another genus, perhaps Clostridium[16]. The 16S rDNA analysis suggests that D. guttoideum is closely related to a cluster of Clostridium, and appears on a separate branch from the rest of the Desulfotomaculum species. A recently reclassified genus within this group is Desulfotomaculum orientis, now Desulfosporosinus orientis[16], adding a second genus to this family.

Different species within the genus Desulfotomaculum exhibit a great versatility in the type of electron donors they are capable of using for growth, and include acetate, aniline, succinate, catechol, indole, ethanol, nicotinate, phenol, acetone, stearate, and others. Depending on the species, organic substrates are oxidized incompletely to acetate or completely to CO2 (Table 1) [1]. In contrast to δ-Proteobacteria SRB, the ability to use Fe(III) as sole terminal electron acceptor for growth has been described for some Gram-positive SRB, such as Desulfotomaculum reducens[17].

Although most spore forming SRB are found in similar environments to δ-Proteobacteria SRB, spore formation allows this group to survive for long periods of desiccation and oxic conditions. For example, Desulfotomaculum is the prevalent genus of SRB in rice paddies due to alternating oxic and anoxic conditions as a result of seasonal flooding [18].

4Bacterial thermophilic SRB

The two most well characterized species in this group of SRB are Thermodesulfobacterium commune[19] and Thermodesulfovibrio yellowstonii (Fig. 4) [20]. The sequences available for analysis of both these species contain significant amounts of ambiguity (12% for T. commune and 20% for T. yellowstonii) that may effect accurate phylogenetic placement, although over 1 kb of readable sequence are available for each species. Both bacteria were isolated from hydrothermal vent waters in Yellowstone National Park, and their optimal growth temperatures are higher than those described for Gram-positive spore forming thermophilic SRB, but lower than those of the Archaeal SRB (Table 1). Although these two genera have similar physiological and phenotypic characteristics, they differ in shape (vibrio versus rod) and GC content (30% versus 34%) for T. yellowstonii and T. commune, respectively. Sequence analysis of 16S rRNA also suggests that they are phylogenetically distant (Fig. 4), confirming their placement in separate genera [20]. Henry et al. [20] suggested that categorization of thermophilic SRB (similar physiology but different phylogeny) is similar to the situation with the Desulfovibrio family: a group that shares physiological similarities but is phylogenetically diverse and is grouped within a family. Moreover, both thermophilic SRB and Desulfovibrio spp. exhibit incomplete oxidation of acetate and utilize a limited number of electrons donors; for these reasons, Henry et al. [20] proposed that thermophilic SRB and desulfovibrios play similar functional roles in their respective environments.

Figure 4.

Phylogenetic relationships of Gram-negative bacterial thermophilic SRB with other Bacterial and Archaeal groups. Numbers before branch points represent percentages of bootstrap resampling based on 1000 trees. Bootstrap values below 50% are not presented.

Phylogenies for thermophilic Gram-negative bacteria branch deeply in the Bacteria domain, in accordance with the theory of thermophilic origins of the Bacteria [21]. Both genera utilize H2 as an electron acceptor if acetate is present, which in these extreme environments can be derived from thermophilic fermentations or geothermal reactions [22]. Although these genera have optimal growth temperatures between 65 and 70°C, they can survive at lower temperatures [23].

5Archaeal thermophilic SRB

This group (Fig. 5) exhibits optimal growth temperatures above 80°C. Only two species have been described to date, both of which were isolated from marine hydrothermal systems: Archaeoglobus fulgidus[24] and A. profundus[25]. Major differences between the two species are that A. fulgidus possess flagella, are facultative chemolithoautotrophs, and produce small amounts of methane, while A. profundus do not possess flagella, are obligate chemolithoheterotrophs, and do not produce methane. No rRNA sequence is available at this time for A. profundus, and so it was not included in Fig. 5.

Figure 5.

Phylogenetic position of Archaeal thermophilic SRB. Numbers before branch points represent percentages of bootstrap resampling based on 1000 trees. Bootstrap values below 50% are not presented.

Using 16S and 23S rRNA sequence analysis, Woese et al. [26] indicated that A. fulgidus falls within the Methanomicrobiales and extreme halophiles cluster (kingdom Euryarchaeota), as is shown in Fig. 5. Woese et al. [26] proposed that sulfate-reducing activity did not arise as early as was proposed by Achenbach-Ritcher et al. [27], and today A. fulgidus is thought to have evolved from methanogenic ancestors. Microorganisms belonging to the Methanomicrobial branch (Fig. 5) of the Archaea are characterized by metabolic characteristics other than methanogenesis, as this group also includes extreme halophiles (Halobacterium halobium) and thermo-acidophiles (Thermoplasma acidophilum) [26]. The question of how sulfate reduction in Archaeoglobus was acquired remains unresolved, although Wagner et al. [28] proposed that either a common ancestor of the Archaea and Bacteria domains possessed the enzyme, or the gene was laterally transferred into Archaeoglobus from a member of the Bacteria soon after divergence of the domains.

6Group-specific probes and PCR primers

Due to the importance of SRB in microbial ecology, several oligonucleotide probes have been developed over the past 8 years. Most probes tested target Gram-negative mesophilic SRB, however, and probes for other phylogenetic groups have yet to be tested (Table 2). Rooney-Varga et al. [29] developed probes for uncultivated clones of SRB, but these clones were very similar to species of the Desulfococcus and Desulfosarcina (Gram-negative mesophilic SRB). Probes specifically targeting all groups would greatly facilitate our understanding of the role of each of these groups in the environment.

Table 2.  16S rRNA oligonucleotides probes for sulfate-reducing bacteria
  1. aOPD nomenclature convention.

  2. bEscherichia coli numbering.

  3. cSequences not shown in original paper; obtained from OPD [33].

OligonucleotideaOriginal probe nameSequence 5’ to 3’PositionbSpecificity (Reference)
S-*-Dsb-0804-a-A-18Probe 804CAACGTTTACTGCGTGGA804–821Desulfobacter group [32]
S-*-Dscoc-0814-a-A-18Probe 814ACCTAGTGATCAACGTTT814–831Desulfococcus group [32]
S-*-Dsv-0636-a-A-19ACTATGACGACACGAACTC636–654Phylogenetically coherent cluster of Desulfovibrio; A. Teske, unpublished; [33] 
S-*-Dsv-0683-a-A-22TCTACGGATTTCACTCCTACAC683–705Desulfovibrionaceae/metal reducers [34] 
S-*-Srb-0385-a-A-18SRBCGGCGTCGCTGCGTCAGG385–402SRB of the δ-Proteobacteria [35], and other δ-Proteobacteria species and Gram-positive bacteria [36]
S-*-Srb-0385-a-S-18SRB385-F (PCR primer)CCTGACGCAGCIACGCCG385–402Sulfate reducers, also nontarget sequences, e.g., Chlorobium, Campylobacter, and Clostridium[37]
S-F-Dsv-0687-a-A-16Probe 687TACGGATTTCACTCCT687–702Desulfovibrio[32]
S-G-Dsb-0129-a-A-18Probe 129CAGGCTTGAAGGCAGATT129–146Desulfobacter[32]
S-G-Dsb-0220-a-A-20DesulfobacterT(C/A)CGCA(G/A)ACTCATCCCCAAA220–239Desulfobacter[32]
S-G-Dsbb-0660-a-A-20Probe 660GAATTCCACTTTCCCCTCTG660–679Desulfobulbus[32]
S-G-Dsbm-0221-a-A-20Probe 221TGCGCGGACTCATCTTCAAA221–240Desulfobacterium[32]
S-S-Dsm.sp-0453-a-A-19D. acetoxidans-likeCTGATTAGCACCATGGCGGc453–470Desulfuromonas acetoxidans-like 16S rRNA sequence [37]
S-S-Dsm.sp-0647-a-A-19Population type 1TCTCCCGTATTCAAGTCTG647–665Desulfuromonas acetoxidans 16S rRNA sequence (96% similar) [37]
S-S-DSV.sp-0453-a-A-19D. vulgaris-likeGGTATTAACCGACTATCATc453–470Desulfovibrio vulgaris-like 16S rRNA sequence [37]
S-S-Dsv.sp-0647-a-A-19Population type 2TCTCCCGAACTCAAGTCCA647–655Desulfovibrio vulgaris 16S rRNA (98% similar) [37]
A01-183CCCCTAAGAAAATACGAT183–201Uncultivated clone, 89.1% similar to Desulfococcus multivorans[29] 
4D19-189CCCTTGATCCAACATTCC189–207Uncultivated clone, 96.3% similar to Desulfosarcina variabilis[29] 

7Existence of possible undescribed groups

Even though SRB are currently only divided into four phylogenetic groups, new divisions could be added as more information on the diversity of SRB in extreme environments becomes available. Jorgensen et al. [30] observed sulfate-reducing activity in sediments from Guaymas Basin in different ranges of temperatures than previously described for the four known groups of SRB. They also reported sulfate reduction between 100 and 110°C, temperatures from which no SRB have yet been isolated. These authors postulated that SRB may be present in those extreme thermophilic environments and that there may be some hyperthermophilic SRB still to be discovered.

SRB able to degrade complex high molecular mass aromatic hydrocarbons such as naphthalene and phenanthrene have not been isolated to date; however, Coates et al. [31] reported oxidation of polycyclic aromatic hydrocarbons under sulfate-reducing conditions. Although SRB were not isolated, incubation of [14C]naphthalene- or phenanthrene-spiked harbor sediments under sulfate-reducing conditions resulted in the production of 14CO2. Moreover, addition of molybdate, a specific inhibitor of sulfate reduction, resulted in a complete inhibition of 14CO2 evolution, suggesting that undescribed SRB may be present.

The assumption that greater than 99% of bacteria in soils remain uncultivated is another challenging area where phylogeny of SRB may play an important role. Rooney-Varga et al. [29], using oligonucleotides probes targeting novel uncultivated SRB, found that one of the uncultivated clones played an important role in a salt marsh sediment. Wagner et al. [28], using phylogenetic analyses of dissimilatory sulfite reductases, found different sequences from previously described sequences, also suggesting the possible presence of undescribed SRB.

The question of why sulfate reduction may be relatively restricted to certain phylogenetic groups remains without answer, especially when compared with other metabolic characteristics such as reduction of nitrate that is spread through different bacterial groups.

Ancillary