SEARCH

SEARCH BY CITATION

Keywords:

  • methanogen;
  • anaerobic methanotroph;
  • methanogenesis;
  • anaerobic oxidation of methane;
  • mcrA;
  • quantitative fluorescent PCR

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

A quantitative fluorogenic PCR method for detecting methanogenic and methanotrophic orders was established using a refined primer set for the methyl coenzyme M reductase subunit A gene (mcrA). The method developed was applied to several microbial communities in which diversity and abundance of methanogens or anaerobic methanotrophs (ANMEs) was identified by 16S rRNA gene clone analysis, and strong correlations between the copy numbers of mcrA with those of archaeal 16S rRNA genes in the communities were observed. The assay can be applied to detecting and assessing the abundance of methanogens and/or ANMEs in anoxic environments that could not be detected by 16S rRNA gene sequence analyses.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Methyl coenzyme M reductase (MCR) is the terminal enzyme complex of the methanogenic pathway that catalyzes the reduction of methyl coenzyme M to methane (Thauer, 1998). The ubiquitous distribution of MCR among methanogens and the presence of conserved DNA sequences in mcrA (the gene for MCR subunit α) means that the gene is well suited as a tool in taxonomic studies (Springer et al., 1995; Nölling et al., 1996). Furthermore, assays for the gene can be applied to monitor methanogens in anoxic environments such as peat bogs, termite guts, paddy soils, landfill, deep subseafloor sediments, hydrothermal sediments, in situ samplers retrieved from hydrothermal vents, eutrophic lake sediments, brackish lake sediments, freshwater marshes, tidal flats, acetate-fed chemostats and human teeth (Ohkuma et al., 1995; Hales et al., 1996; Bidle et al., 1999; Lueders et al., 2001; Luton et al., 2002; Earl et al., 2003; Castro et al., 2004; Shigematsu et al., 2004; Banning et al., 2005; Dhillon et al., 2005; Nercessian et al., 2005; Vianna et al., 2006; Wilms et al., 2007).

Anaerobic oxidation of methane (AOM) mediated by anaerobic methanotrophs (ANMEs) that are phylogenetically closely related to methanogens, and sulfate- or nitrate-reducing bacteria with the following reactions have also been reported: CH4+SO42−[RIGHTWARDS ARROW]HCO3+HS+H2O, or 5CH4+8NO3+8H+[RIGHTWARDS ARROW]5CO2+4N2+14H2O and 3CH4+8NO2+8H+[RIGHTWARDS ARROW]3CO2+4N2+10H2O (Boetius et al., 2000; Orphan et al., 2001; Raghoebarsing et al., 2006). Metagenomic analyses of these previously uncultured ANME archaea indicate that they contain genes for MCR (Krüger et al., 2003; Hallam et al., 2003, 2004) and other components of the methanogenesis pathway, and a nickel protein closely related to MCR from the ANME I community was discovered by Krüger et al. (2003). These observations strongly suggest that an MCR-like protein catalyzes methane oxidation in ANME archaea (Krüger et al., 2003; Shima & Thauer, 2005). Gene fragments of mcrA from ANME archaea can also be amplified using the same primer set as that used for the methanogen described by Hales et al. (1996) and applied to surveys of anoxic methane seep sediments for the detection of ANME archaea (Hallam et al., 2003; Inagaki et al., 2004; Kelley et al., 2005; Lloyd et al., 2006; Nunoura et al., 2006; Lösekann et al., 2007).

In order to evaluate the abundance of methanogens and/or ANMEs, several attempts to quantify the mcrA gene have been reported using either competitive or fluorescent PCR (Inagaki et al., 2004; Shigematsu et al., 2004; Nunoura et al., 2006; Vianna et al., 2006; Wilms et al., 2007). The abundance of mcrA in different environments has been revealed using the primer sets of Hales et al. (1996) or Luton et al. (2002) except for the assessment for abundance of particular mcrA sequences (Shigematsu et al., 2004; Nunoura et al., 2006). Subsequent to these reports, the presence of mcrA in ANMEs was demonstrated (Hallam et al., 2003; Krüger et al., 2003) and submitted to the DDBJ/EMBL/GenBank database. In the present study, based on the improved alignment of mcrA DNA sequences including the newly identified mcrA from both methanogen and ANMEs, we designed a new primer set for detecting the mcrA of known methanogens and ANMEs, and constructed a quantitative fluorescent PCR system. Using this system, the abundance of mcrA was quantified in DNA assemblages from naturally occurring microbial communities that are dominated either by methanogens or by methanotrophs.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Sample description, strains and environmental phylotypes

Environmental samples used for the quantification of mcrA and archaeal 16S rRNA genes are listed in Table 1. The methanogen strains and environmental phylotypes from anoxic marine sediments that were subjected to fluorescent PCR are described below. Methanothermococcus okinawensis IH1T and Methanotorris formicicus Mc-S-70T were stored at our laboratory, JAMSTEC. Methanobacterium formicicum DSM 1535T, Methanococcoides alaskaense DSM 17273T, Methanococcoides burtonii DSM 6242T, Methanoculleus chikugoensis JCM 10825T, Methanohalobium evestigatum DSM 3721T, Methanococcus vannielii JCM 13029T, Methanogenium organophilum DSM 3596T, Methanohalophilus mahii DSM 5219T, Methanohalophilus portucalensis DSM 7471T, Methanosalsum zhilinae DSM 4017T, Methanolobus vulcani DSM 3029T, Methanomethylovorans thermophila DSM 17232T, Methanosaeta concilii DSM 3671T, Methanosaeta harundinacea DSM 17206T, Methanosaeta thermophila DSM 6194T, Methanosarcina barkeri DSM 800T, Methanosarcina thermophila DSM 1825T, Methanothermus sociabilis JCM 10723T, Methanocaldococcus jannashii JCM 10045T, Methanothermococcus thermolithotrophicus JCM 10549T, Methanotorris igneus JCM 11834T and Methanopyrus kandleri JCM 9639T were obtained from DSMZ or JCM. Environmental mcrA clones from anaerobic marine sediments in the Nankai Trough, namely KM-m1.09 (AB233458) (ANME group cd), KM-m-4.10 (AB233466) (ANME group e) and KM-m-5.06 (AB233468) (ANME group a) (Nunoura et al., 2006), were also stored at our laboratory, JAMSTEC.

Table 1.   Description of samples used in this study
Sample nameOriginTemperature (°C)RemarksLocationReference
TDS-JThermophilic digested sludge55Municipal solid wasteNiigata, JapanYoneyama & Takeno (2002)
MDSMesophilic digested sludge35Municipal sewage wasteToyama, JapanThis study
GarbMesophilic digested sludge37Municipal solid wasteNiigata, JapanThis study
ChemThermophilic digested sludge52Wastewater from food processing factoryShizuoka, JapanThis study
#744C1-0 cm below sea floorMethane seep sediments<5AOM communityThe Nankai TroughNunoura et al. (2006)

Nucleic acid extraction

The DNA assemblages from mesophilic and thermophilic digested sludges were extracted with ISOIL for Beads Beating (Nippon Gene Co. Ltd, Tokyo, Japan). The genomic DNA of isolates was extracted using an Ultra Clean Microbial DNA Kit (MO BIO Laboratories, Solana Beach, CA), and the DNA samples from cold seep sediments (744C0) was prepared as described previously (Nunoura et al., 2006).

Refinement of a primer and quantitative PCR system for mcrA

DNA sequences of mcrA from isolates and environmental phylotypes were aligned using arb version 20030822 (Ludwig et al., 2004). Conserved sequences were searched for using the ARB system, and a novel primer, ‘ME3MF’ (ATGTCNGGTGGHGTMGGSTTYAC), was designed.

In order to optimize fluorescent quantitative PCR conditions with the ME3MF and ME2r′ (TCATBGCRTAGTTDGGRTAGT) (Hales et al., 1996) primers, we used mcrA gene fragments cloned into pCR2.1 vector (Invitrogen, Carlsbad, CA) from two strains of Methanobacteriales: Methanobacterium formicicum and Methanobacterium sociabillis; six strains of Methanococcales: Methanococcus vannielii, Methanococcus jannaschii, Methanothermococcus thermolithotrophicus, Methanothermococcus okinawensis, Methanotorris formicicus and Methanotorris igneus; two strains of Methanomicrobiales: Methanogenium organophilum and Methanoculleus chikugoensis; 11 strains of Methanosarcinales: Methanohalophilus mahii, Methanolobus vulcani, Methanosaeta harundinacea, Methanosaeta thermophila, Methanosarcina barkeri, Methanosarcina thermophila, Methanohalobium evestigatum, Methanohalophilus portucalensis, Methanococcoides alaskaense, Methanococcoides burtonii, Methanosalsum zhilinae; one strain of Methanopyrales: Methanopyrus kandleri; and three environmental mcrA phylotypes probably from ANME archaea; KM-m1.09 (group c–d), KM-m-4.10 (group e) and KM-m-5.06 (group a–b) (Nunoura et al., 2006) as templates. The mcrA gene fragments from Methanococcus vannielii, Methanococcus jannaschii, Methanothermococcus thermolithotrophicus, Methanothermococcus okinawensis and Methanotorris formicicus were obtained using the ME1f′ (TCATBGCRTAGTTDGGRTAGT) (Hales et al., 1996) and ME2r′ primer set, those from Methanobacterium formicicum, Methanogenium organophilum, Methanosarcina barkeri, Methanosaeta harundinacea and Methanosaeta thermophila were amplified by using a primer set of ME3 (GGTGGHGTMGGWTTCACACA) (Hales et al., 1996) and ME2r′, and that from Methanopyrus kandleri was obtained based on genomic sequence (Slesarev et al., 2002).

Fluorescent PCR conditions using SYBR Premix Ex Taq (Takara Bio, Otsu, Japan) were optimized for a range of annealing temperatures (51–54 °C), annealing times (20–50 s) and additional MgCl2 concentrations (0 or 2.5 mM). The concentration of each primer and ROX reference dye II was 0.2 pmol μL−1 and 0.02 μL μL−1, respectively. For these runs, fluorescent PCR was performed using a 7500 Real Time PCR System (Applied Biosystems, Foster City, CA) with preheat, denaturing and extension conditions of 94 °C for 2 min, 94 °C for 40 s and 72 °C for 1 min, respectively. Fifty cycles of amplification and fluorescence detection were executed.

Once fluorescent PCR conditions had been optimized, we tested the detection limit of the assay system using cloned mcrA gene fragments from 11 representative methanogens: Methanobacterium formicicum, Methanococcoides alaskaense, Methanococcus vannielii, Methanogenium organophilum, Methanosaeta harundinacea, Methanosaeta thermophila, Methanosarcina barkeri, Methanobacterium sociabillis, Methanococcus jannaschii, Methanoculleus chikugoensis and Methanopyrus kandleri; and three environmental mcrA phylotypes of KM-m1.09, KM-m-4.10 and KM-m-5.06 as templates. When applying the optimized fluorescent quantitative PCR system to the environmental microbial community, a mixture of cloned mcrA gene fragment clones: Methanobacterium formicicum, Methanococcoides alaskaense, Methanococcus vannielii, Methanogenium organophilum, Methanosaeta harundinacea, Methanosaeta thermophila, Methanosarcina barkeri, Methanobacterium sociabillis, Methanococcus jannaschii and Methanoculleus chikugoensis with KM-m1.09 and KM-m-4.10 was used to obtain standard curves for each instance.

Amplification of mcrA and archaeal 16S rRNA genes from environmental DNA

For the environmental clone analysis of mcrA using the refined ME3MF and ME2r′ primer set, mcrA gene fragments were amplified using SYBR Premix Ex Taq (Takara Bio) under the optimized condition for the fluorescent PCR described below with 30–40 cycles of amplification. Archaeal 16S rRNA gene fragments were amplified from extracted environmental DNA by La Taq polymerase with GC buffer (Takara Bio). The oligonucleotide primers for the PCR amplification of the archaeal 16S rRNA gene were Arch21F and Arch958R (Lane, 1985; DeLong, 1992). Amplification conditions for the 16S rRNA gene have been described previously (Nunoura et al., 2006).

Gene fragments of the amplified mcrA and 16S rRNA gene were then cloned into the pCR2.1 vector. The inserts were directly sequenced by the dideoxynucleotide chain termination method using BigDye ver.3.1 (Applied Biosystems) in accordance with the manufacturer's recommendations.

For the environmental clone analysis, the similarity of 16S rRNA gene and mcrA sequences was analyzed using fastgroupII (http://biome.sdsu.edu/fastgroup/) (Yu et al., 2006) and the fasta algorithm of the dnasis software (Hitachi Software, Tokyo, Japan), and sequences with >97% and >96% identity, respectively, were assigned to the same clone type (phylotype).

Phylogenetic analysis

Representative sequences for the mcrA clone analysis were subjected to a similarity search against the DDBJ/EMBL/GenBank database using the blast algorithm (http://blast.ddbj.nig.ac.jp/top-j.html). Representative 16S rRNA gene sequences were analyzed using arb version 20030822 (Ludwig et al., 2004) and categorized according to taxonomic hierarchy.

Quantification of the 16S rRNA gene

Quantification of the archaeal 16S rRNA gene from environmental microbial DNA was performed using a quantitative fluorescent PCR method with a 7500 Real Time PCR System, as described previously (Takai & Horikoshi, 2000) but with minor modifications. We used a prepared mixture of qPCR Quick GoldStar Mastermix Plus (Eurogentec, Seraing, Belgium) and concentrations for primers and probe were prepared following the manufacturer's instructions.

Nucleotide sequence accession numbers

The mcrA gene sequence obtained from the characterized methanogens, as well as mcrA and 16S rRNA gene sequences from the environmental DNA in this study were submitted to the DDBJ/EMBL/GenBank nucleotide sequence databases under accession numbers AB353207AB353262.

Results and discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Amplification of mcrA from isolated methanogens and primer refinement

We tried to amplify the mcrA gene using the two primer sets, a set of ME1f′ and ME2r′, and a set of ME3 and ME2r′, from the genomic DNA of 24 methanogen strains. Using the ME3f and ME2r′ primer set, mcrA gene fragments were obtained from all of the DNA samples assayed other than that from Methanopyrus kandleri. The ME1f′ and ME2r′ primer set did not amplify mcrA gene fragments from the templates of Methanobacterium formicicum, Methanogenium organophilum, Methanosarcina barkeri and all the Methanosaeta species (data not shown). The mcrA nucleotide sequences deposited in DDBJ/EMBL/GenBank database as well as those obtained in this study were aligned. The alignment revealed three highly conserved regions corresponding to the regions for three reported primers (ME1, ME2 and ME3) (Hales et al., 1996). In addition, Luton et al. (2002) also designed two other primers in two regions closely related to ME2 and ME3. However, several sequences in the database lacked any sequence data around the ME1 primer region because they were obtained using a set of ME2 and ME3, a set described by Luton et al. (2002), or other primer sets. The ineffective coverage of a primer set using the ME1 primer in this study and the reduced sequence data around the ME1 primer region indicated that the region might not be suitable to detect mcrA from potentially all the methanogens and ANMEs using quantitative PCR. Instead, we found that the ME2 and ME3 regions were well conserved among all the sequences in the alignment. Most of the mcrA gene sequences previously identified were obtained using the ME2 primer and significant mismatches were not observed. However, a number of mismatches were found in the ME3 primer region of the mcrA sequences deposited after Hales et al. (1996) and Luton et al. (2002). Thus, we reconstructed a primer sequence in the ME3 region and named it ME3MF (ATGTCNGGTGGHGTMGGSTTYAC). As the group e mcrA from the methanotrophic archaeal community had two specific nucleotide mismatches with ME3MF, the modified ME3MF primer (ATGAGCGGTGGTGTCGGTTTCAC) (ME3MF-e) was also constructed. The mixture of the ME3MF-e and ME3MF was applied to quantify the mcrA in the DNA assemblage from anaerobic marine sediments in which a diversity of anaerobic methanotrophs were predicted to occur.

Establishment of quantitative PCR analysis for mcrA

To minimize the differences between threshold cycles among known mcrA sequences, we prepared a PCR mixture with 2.0 × 104 and 2.0 × 105 mcrA copies μL−1 for each of the 28 mcrA clones described above, and optimized annealing temperatures and times, as well as MgCl2 concentrations. As a result, differences in threshold cycles were minimized by annealing at 52 °C for 30 s and the addition of 2.5 pmol μL−1 MgCl2 to the standard PCR mixture containing SYBR Premix Ex Taq. Using a primer set of ME3MF and ME2r′, threshold cycle numbers of the only ANME group e were always significantly larger than those for other mcrA genes. When the quantitative PCR was conducted using the primer set ME3MF-e and ME2r′, or the mixture of ME3MF and ME3MF-e (250 : 1) and ME2r′, threshold cycle numbers were improved (reduced by one and by half a cycle, respectively). Furthermore, no significant effects on threshold cycle numbers in other mcrA genes were observed using the mixture of ME3MF-e and ME3MF primers.

The 15 representative mcrA clones described above were then used to test the detection limit of this quantification PCR system. As shown in Fig. 1, the amplified patterns were associated with a high correlation coefficient (>0.98–0.99). Template concentrations of the PCR reaction mixture as low as 2 copies μL−1 were successfully quantified in most of the mcrA sequences with no significant differences in the threshold cycles for each dilution rate except for those of Methanococcus vannielii, Methanoculleus chikugoensis, Methanopyrus kandleri and KM-m-4.10 (ANME group e). In addition, the slopes of threshold cycle numbers vs. dilution rate were very similar to each other except for KM-m-5.06 (ANME group a) (Fig. 1). Therefore, we used the primer mix consisting of ME3MF-e and ME3MF at 250 : 1 when applying this quantification system for potentially ANME archaea-dominating communities.

image

Figure 1.  Fluorogenic amplification patterns of heterogeneous mcrA template obtained using the newly developed primer set (ME3MF and ME2r′). A mixture of ME3MF and ME3MF-e primer (250 : 1) was used in assays for KM-m-4.10. All assays were conducted a minimum of three times. The copy number shown on the y-axis is the concentration of mcrA in the PCR reaction mixture.

Download figure to PowerPoint

Quantitative analysis of mcrA in methanogenic and methanotrophic microbial communities

The quantification system for mcrA developed was applied to naturally occurring microbial communities (four communities dominated by methanogenic and one by methanotrophic activity) (Table 1). The archaeal community structures in these samples were initially inferred from clone analyses of archaeal 16S rRNA genes and mcrA (Tables 2 and 3). It was found that the archaeal community in each sample was dominated by various methanogens or methanotrophs, and the renewed mcrA primer set was able to recover phylogenetically diverse phylotypes from environmental DNA assemblages.

Table 2.   Phylogenetic affiliations of 16S rRNA gene phylotypes isolated from methanogenic and methanotrophic microbial communities
SamplePhylotypesNo. of clonesClosest sequence (accession number)Similarity (%)Phylogenetic affiliation
TDS-JTDS-J-r-A018SCA1175 (U62819)96.0Soil Crenarchaeotic Group (SCG)
TDS-J-r-A0315Methanosarcina acetivorans (AE010299)98.4Methanosarcinales
TDS-J-r-C015ASC41 (AB161340)99.8Soil Crenarchaeotic Group (SCG)
TDS-J-r-H031SCA1173 (U62818)87.8Soil Crenarchaeotic Group (SCG)
MDSMDS-r-A0141Methanosaeta thermophila100.0Methanosarcinales
MDS-r-E062pJP4191.0Miscellaneous Crenarchaeotic Group (MCG)
GarbGarb-r-A0324MAA04 (AB114301)95.9Methanomicrobiales
Garb-r-B012Clone 72 (AJ831071)99.7Methanosarcinales
Garb-r-C021Methanoculleus bourgensis (AB065298)98.1Methanomicrobiales
Garb-r-D051TA03 (AF229776)93.3Methanomicrobiales
Garb-r-F031Methanosarcina acetivorans (AE010299)91.7Methanosarcinales
Garb-r-F041Methanosaeta concilii (X51423)99.4Methanosarcinales
ChemChem-r-A0137Methanomethylovorans hollandica (AY260433)98.0Methanosarcinales
Chem-r-G031HDBW-WA16 (AB237749)97.9Thermoplasmata
744C1KM-r-0.0235fos0629b699.4ANME II-c
0 cm bsf(Nunoura et al., 2006)KM-r-0.102fos0642g699.7ANME II-a
KM-r-1.201HydBeg4099.2ANME II-c
KM-r-0.254Eel-36a2A498.2ANME II-b
KM-r-0.281Hyd24-Arch07b99.6Deep-sea Archaeal Group (DSAG)
Table 3.   Phylogenetic affiliations of mcrA phylotypes isolated from methanogenic and methanotrophic microbial communities
SamplePhylotypesNo. of clonesClosest sequence (accession number)DNA similarity (%)Phylogenetic affiliation
TDS-JTDS-J-m-A038Mthanosarcina thermophila (U22250)98Methanosarcinales
TDS-J-m-A0623Methanothermobacter thermoautotrophicus (X07794)84Methanobacteriales
TDS-J-m-D051Methanothermobacter wolfeii (AB300780)99Methanobacteriales
TDS-J-m-F011RS-ME45 (AF313878)87Methanobacteriales
MDSpMDS-m-A015Methanothermobacter thermoflexus (AY303950)98Methanobacteriales
pMDS-m-E017Methanosaeta thermophila (CP000477)99Methanosarcinales
pMDS-m-F062Methanothermobacter thermoautotrophicus (U09990)97Methanobacteriales
pMDS-m-H0317Methanothermobacter marburgensis (X07794)83Methanobacteriales
GarbGarb-m-033MCR-HID-R03 (DQ662546)91Methanobacteriales
Garb-m-0410PMmcr13 (AJ607419)94Methanosarcinales
Garb-m-051OS111 (AF414033)90Methanobacteriales
Garb-m-063OS37 (AF414016)85Methanobacteriales
Garb-m-123Methanoculleus bourgensis (AB300787)98Methanomicrobiales
Garb-m-136OS37 (AF414016)85Methanobacteriales
Garb-m-161Methanosaeta concilii (AF313802)91Methanosarcinales
Garb-m-174Methanobacterium formicicum (EF465103)89Methanobacteriales
Garb-m-213OS55 (AF414019)82Unknown
Garb-m-291Methanosaeta concilii (AF313802)87Methanosarcinales
Garb-m-411Methanobacterium formicicum (EF465108)99Methanobacteriales
ChemChem-m-D023MCR-HID-R97-30 (DQ662549)91Unknown
Chem-m-D051Methanobacterium beijigense (EF465106)98Methanobacteriales
Chem-m-E012Methanosaeta concilii (AF313803)89Methanosarcinales
Chem-m-E051OS37 (AF414016)85Methanobacteriales
Chem-m-H0327Methanomethylovorans hollandica (AY260442)92Methanosarcinales
744C1pKM-ms-A011KM-m-2.28 (AB233462)98ANME group e
0 cm bsfpKM-ms-A0211AN07BC1_15_2998ANME group cd
pKM-ms-B0213OT_mcrA1.1683ANME group e
pKM-ms-F013KM-m-4.10 (AB233466)98ANME group e
pKM-ms-F041KM-m-0.07 (AB233457)97ANME group cd
pKM-ms-F051KM-m-4.10 (AB233466)92ANME group e
pKM-ms-G061KM-m-1.13 (AB233459)99ANME group ab
pKM-ms-H031KM-m-4.10 (AB233466)89ANME group e

When applying the quantitative PCR system for mcrA, a mixture of clones [except Methanopyrus kandleri and KM-m-5.06 (AMO group a) used in the detection limit test] was used to obtain standard curves. Comparisons between the copy number of archaeal 16S rRNA genes and mcrA in all the environmental DNA assemblages revealed that the copy numbers of archaeal 16S rRNA genes were approximately four times higher than that of mcrA (r=0.993) (data not shown). The difference in copy number observed in environmental samples may be attributed to the differences in average copy number between the 16S rRNA and mcrA genes in the genomes of methanogens and ANMEs. In the genomes of mesophilic to moderately thermophilic methanogens such as Methanosarcina acetivorans (Deppenmeier et al., 2002), Methanosarcina mazei (Galagan et al., 2002), Methanococcus maripaludis (Hendrickson et al., 2004), Methanocorpusculum labreanum (NC 008942), Methanosaeta thermophila (NC 008553), Methanococcoides burtonii (NC 007955), Methanospirillum hungatei (NC 007796) and Methanosphaera stadtmanae (Fricke et al., 2006) as well as the rice cluster I methanogen (Erkel et al., 2006), copy numbers of the 16S rRNA genes are consistently two to four times higher than those of the mcrA gene. Moreover, based on metagenomic analyses for both ANME I and ANME II (Girguis et al., 2005), the existence of multiple copies of the 16S rRNA gene has been suggested. A similar phenomenon was also observed when a group-specific mcrA quantification system was applied to methanotrophic archaeal communities (Nunoura et al., 2006), although the entire genome sequence of the ANMEs has not yet been revealed.

The newly developed primer set for mcrA can thus potentially be applied to the detection of all known orders of methanogens and previously uncultivated ANME groups. In addition, the quantification fluorescent PCR using this primer set can be applied to the detection of mcrA from very diluted template solutions. We evaluated the accuracy of this novel mcrA quantification system in environmental samples in which the predominance of methanogens or ANMEs in archaeal communities was shown by 16S rRNA gene clone analysis. However, it is expected that the combination of this highly sensitive quantification system and clone analysis for mcrA will be extensively applied to assessing the distribution, abundance and diversity of methanogens and/or methanotrophs in anoxic environments where the 16S rRNA genes of methanogens and/or methanotrophs are not detected in 16S rRNA gene clone analysis. In particular, we expect that this system will be extensively applied in the subseafloor biosphere, from which occurrences of methanogenesis and methanotrophy have been discussed, but the distribution and abundance of the organisms responsible have not yet been revealed.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

We are grateful to the crew of R/V Yokosuka and the Shinkai 6500 operation team for their assistance during the YK03-03 cruise. We also appreciate the contribution of Dr Juichiro Ashi (ORI, University Tokyo) who was the chief scientist aboard the YK03-03 cruise.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References