Surveillance of vibriophages reveals their role as biomonitoring agents in Kolkata

Authors


  • Editor: Riks Laanbroek

Correspondence: B.L. Sarkar, Vibrio Phage Reference Laboratory, Division of Bacteriology, National Institute of Cholera and Enteric Diseases, P-33, CIT Road, Scheme XM, Kolkata 700 010, India. Tel.: +91 33 2370 1176; fax: +91 33 2370 5066; e-mail: bl_sarkar@hotmail.com

Abstract

Cholera is a public health threat in all developing countries. Kolkata, a city in eastern India, is an endemic zone for cholera. During the course of a comprehensive investigation on the distribution of phages of Vibrio cholerae O1 and O139 in freshwater bodies in Kolkata, we were able to isolate the phages of V. cholerae O1 and O139. Vibrio cholerae O1 phages were found at all the sites and exhibited a distinct seasonal cycle, with a primary peak (13.6–17.2 PFU mL−1) during monsoon (June to August) in both 2006 and 2007. Vibrio cholerae O139 phages were present in the environment and were predominant during monsoon in the year 2006, except for late winter and early summer from February to April. In contrast, in the year 2007, the O139 phages could be isolated only during July to December, with the highest counts of 12.0 PFU mL−1 determined in August. The multiplex PCR results showed that 90 samples were positive for wbe of V. cholerae O1, 32 samples for O139 (wbf) and 18 samples for both. This study shows that surveillance of vibriophages indicates the presence of V. cholerae O1 and O139 in water bodies in and around Kolkata and could therefore serve as a powerful biomonitoring agent.

Introduction

Cholera is a devastating disease caused by toxigenic Vibrio cholerae belonging to serogroup O1 and O139, and can occur in the form of epidemic and pandemics. Cholera is still a public health threat in all developing countries where clean drinking water is not available to the local populations, particularly in remote areas. In India, most of the cholera outbreaks have been geographically localized. Kolkata, a city in eastern India, is an endemic zone for cholera. A number of studies on cholera have been performed at the National Institute of Cholera and Enteric Diseases (NICED), Kolkata. As a WHO collaborating center for research and training on diarrheal diseases, NICED is a national reference laboratory and receives strains of V. cholerae from different parts of India and abroad for biotyping, serotyping and phage typing.

Vibrio cholerae are autochthonous microbial communities in aquatic environments and are natural inhabitants in the freshwater bodies in Kolkata (Nair et al., 1988). It has been found to survive under unfavorable environmental conditions in a dormant state for extended periods in fresh water, estuarine and brackish waters (Huq et al., 1984, 1990; Nair et al., 1988; Islam et al., 1996). The strains of V. cholerae O1 are rarely isolated from surface waters by culture methods during interepidemic periods. Although O1 was isolated as the predominant serogroup among all the enteropathogens from the hospitalized patients in Kolkata, along with O1, the other prevalent non-O1 non-O139 serogroups were O12, O37, O43 and O144 (Sharma et al., 1998). In response to extreme environmental conditions, the bacteria may enter a dormant state (Huq et al., 1984; Gauthier, 2000), which has been designated as a viable but nonculturable (VBNC) state. It has been reported that V. cholerae O1 and O139 survive in the environment in the VBNC state during interepidemic periods. Earlier studies have shown that V. cholerae O1 becomes coccoid and enters into a nonculturable state in the environment when the conditions are unfavorable for growth. The viability (Kogure et al., 1979) and infective potential (Colwell et al., 1985) of nonculturable cells of many species and genera of bacteria have been documented (Rahman et al., 1996). How and when such nonculturable cells in aquatic environments are capable of returning to an actively growing state to cause cholera epidemics is still an unanswered question.

Phage typing continues to be a useful tool for epidemiological surveillance of V. cholerae. Earlier, a detailed phage typing study on V. cholerae O139 in Kolkata was reported (Chakrabarty et al., 2000). However, the role of phages specific for V. cholerae O139 in the aquatic environment in Kolkata is still unclear. Also, despite its significance as a causal agent of cholera, the seasonal distribution of V. cholerae O139 in aquatic environments has not been studied in India. The newly emerged V. cholerae O139 appeared in the coastal city of southern India in 1992. Thereafter, recurrent cholera caused by V. cholerae O139 indicates their continued presence in this region (Huq et al., 1984; Alam et al., 2006). However, the isolation of O139 declined in 2001 and no cases of cholera caused by O139 have been reported from any part of India in 2007. During the course of a comprehensive investigation on the distribution of phages of V. cholerae O1 and O139 in freshwater bodies in Kolkata, we were able to isolate the phages of V. cholerae O139. Vibriophages specific for non-O1 non-O139 serogroups prevalent in clinical cases were also found in aquatic environments. This prompted us to examine, on a seasonal basis, the distribution of V. cholerae O1, O139 and particularly φO139. The present study was undertaken to determine whether V. cholerae O139 bacteria construed O139 phage in the natural aquatic environment between epidemic periods as a surrogate marker, leading to the conclusion that O139 phages may play a significant role in the annual cycle of V. cholerae O139 in the environment and notably in annual epidemics of cholera in Kolkata.

Materials and methods

Sampling sites

Samples were collected from five sites (Fig. 1) located in various parts of Eastern Metropolitan Bypass at Kolkata (latitude 22°33′N and longitude 88°20′E). These sampling sites represented different aquatic bodies and were sampled at 30-day periodic intervals from January 2006 through December 2007. All the five sites were freshwater bodies, with no confluence with marine and brackish waters. Of these, four stations were canals that received sewage from the city and the fifth site was an artificial freshwater reservoir. Samples were collected from selected points where the sewage water connects with the main canal, which receives both domestic and industrial effluents. On the basis of hydrographical events that are mainly influenced by the monsoons, the different seasons were defined as follows: winter, December to February; summer, March to June; monsoon, July to September; and post-monsoon, October to November.

Figure 1.

 Map of Kolkata showing the sampling sites.

Collection of environmental samples

Water samples were collected in sterilized glass bottles. Samples were collected from surface water, c. 1 m just below the water surface. Five hundred-milliliter water samples from each station were collected and immediately transported to the laboratory.

Physical and chemical parameters

The physicochemical parameter (water temperature) was measured in situ at all sites at the time of sampling using a field thermometer. Immediately upon return to the laboratory, the pH was measured using a pH meter (Orion 4 star, Thermo). Also, atmosphere temperature, relative humidity and rainfall data were obtained from the meteorological department, Kolkata.

Bacteriological methods

In the laboratory, 200 mL of each water sample was filtered (Whatman Grade No. 1 filter paper) to remove the suspended particulate matters. Subsequently, the total volume of this filtrate of each water sample (200 mL) was filtered through a 0.22-μm pore size membrane filter (Milipore). Twenty milliliters of this filtrate from each sample was processed for the isolation, detection and quantification of V. cholerae O1 and O139 phages. The filter membrane (0.22 μm) of each sample was introduced into 3 mL of alkaline peptone water (APW) and incubated at 37 °C for 6–8 h. After enrichment, appropriate decimal dilutions were prepared from 100 mL of the sample and spread on thiosulfate–citrate–bile salts–sucrose agar (TCBS; Eiken, Tokyo, Japan) and incubated for 24 h at 37 °C. Typical colonies (flat sucrose-positive colonies with elevated centers) were selected and presumptive V. cholerae colonies were confirmed by biochemical tests and serum agglutination (WHO, 1993). A portion of the sample (2 mL), after enrichment from APW, was used for multiplex PCR.

Isolation, detection and quantification of bacteriophages

Twenty milliliters of the water sample (0.22-μm pore size membrane filtered) from each station was equally divided into two parts. Ten milliliters of the sample was used for the isolation, detection and quantification of O1 phages and the remaining 10 mL for O139 phages. Two milliliters of 5 M NaCl was added to each sample and set aside for 1 h at 4 °C. The bacterial cells were removed by centrifugation at 12 000 g for 10 min. PEG 8000 (Sigma) was added (1/10th volume) to the supernatant and incubated overnight at 4 °C. In the morning, phage particles were precipitated by centrifugation at 13 000 g for 20 min. Phage pellets were resuspended in 1.5 mL of Tris-MgCl2 buffer. Vibrio cholerae O1 strain MAK 757 [American Type Culture Collection (ATCC) 51352] and O139 strain NPR-4 were used as the standard propagating strains to estimate the environmental phage concentration by the plaque assay method (Chakrabarti et al., 1997). Additionally, phages specific for serogroups O12, O37, O43 and O144 were also determined during the course of the study. Briefly, logarithmic-phase cells (100 μL) of each host bacterial strain and suspended phage particles from each water sample (1 mL), which were maintained in TM buffer, were mixed with 3.5 mL of soft agar (nutrient broth containing 0.8% Bactoagar, Difco), and the mixtures were overlaid on nutrient agar plates. The plates were incubated for 18 h at 37 °C. Positive samples for vibriophages were identified by the appearance of plaque. A plaque count was performed to determine the concentration (titer) of phages in each sample.

Multiplex PCR assay

The genes responsible for O-antigen biosynthesis and for the generation of serotype-specific determinants are located in the wb region on the V. cholerae chromosome. The wb genes specific for V. cholerae O1 (wbe) and O139 (wbf), and the ctxA gene, encoding subunit A of cholera toxin, were amplified using Multiplex PCR (Table 1). Water samples enriched in APW at 37 °C were boiled for 10 min. After centrifugation at 13 000 g for 10 min at 4 °C, the supernatant was used as a DNA template for PCR. The primers used in this study and the expected amplification sizes are listed in Table 1. PCR was performed with a PTC 200, Peltier thermal cycler (M.J. Research). The following reagents were added to each sample for PCR mixture in a 200-μL PCR tube containing a reaction mixture volume of 25 μL. Each reaction contained 2.5 μL of 10 × PCR buffer [500 mM KCl, 100 mM Tris-HCl (pH 8.0), 15 mM MgCl2 and 0.01% gelatin] (Takara, Japan), 2.5 μL of 25 mM dNTP mix, 0.5 μL each of the forward and the reverse primer of ctxA (10 pmol μL−1), 1.5 μL each of the O1 wbe primer pairs (10 pmol μL−1) and 0.8 μL each of the O139 wbf primer pairs (10 pmol μL−1), 0.2 μL of amplitaq DNA polymerase (Takara) and 2.5 μL of DNA template and Mili-Q water to a final volume of 25 μL. The PTC-200 instrument was programmed as follows: initial denaturation at 94 °C for 5 min, followed by 35 cycles consisting of 94 °C for 1.5 min, 55 °C for 1.5 min and 72 °C for 1.5 min, and a final extension step at 72 °C for 10 min at the end of 35 cycles, followed by maintenance at 4 °C. Vibrio cholerae O1 strain MAK 757 (ATCC 51352) and O139 strain NPR-4 were used as a positive control for ctxA, O1 wbe and O139 wbf (Chakrabarti et al., 1997). Amplified products were separated on a 1.5% agarose gel in 1 × TAE, stained with ethidium bromide (1.0 μg mL−1) and visualized with a gel documentation system (Bio-Rad) (Fig. 2).

Table 1.   Sequences of primers used for detection and identification of Vibrio cholerae O1 and O139
Primer
name
Primer sequence (5′-3′)Amplicon
size (bp)
Gene accession
number
Primer siteReferences
ctxA FCTCAGACGGGATTTGTTAGGCACG302X00171588–609Keasler & Hall (1993)
ctxA RTCTATCTCTGTAGCCCCTATTACG X001711129–1151 
wbe-FGTTTCACTGAACAGATGGG192X5955413 195–13 213Hoshino et al. (1998)
wbe-RGGTCATCTGTAAGTACAAC X5955413 368–13 386 
wbf-FAGCCTCTTTATTACGGGTGG449Y0778612 288–12 307Hoshino et al. (1998)
wbf-RGTCAAACCCGATCGTAAAGG Y0778612 717–12 736 
Figure 2.

 Six representative gel documentation pictures of multiplex PCR for the detection of O1/O139 genes. Lane M, O1-positive control strain MAK 757; lanes 2–6, samples collected from sites 1, 2, 3, 4 and 5, respectively; lane 7, O139-positive control strain NPR-4.

Simplex PCR assay

From the Multiplex PCR assay, the PCR products of the positive samples for V. cholerae O1 wbe, O139 wbf and ctxA genes were subjected to PCR amplification using a single primer pair and also used as a DNA template. The primers and their expected amplification sizes have been reported previously. PCR was performed with a PTC 200, Peltier thermal cycler (M.J. Research), with a 200-μL PCR tube containing a reaction mixture volume of 25 μL. Each reaction contained 2.5 μL of 10 × PCR buffer [500 mM KCl, 100 mM Tris-HCl (pH 8.0), 15 mM MgCl2 and 0.01% gelatin] (Takara), 2.5 μL of 25 mM dNTP, 1 μL each of the forward and the reverse primer (10 pmol μL−1) of a single primer pair (Table 1), 0.2 μL of amplitaq DNA polymerase (Takara) and 3 μL of DNA template (Multiplex PCR product) and Mili-Q water to a final volume of 25 μL. The amplification conditions were 5 min at 94 °C for initial denaturation, followed by 30 cycles consisting of 1 min at 94 °C, 1 min at 55 °C and 1 min at 72 °C, with a final round of extension for 7 min at 72 °C in the end, followed by maintenance at 4 °C. After amplification, 5 μL of each reaction mixture was separated on a 1.5% agarose gel in 1 × TAE, stained with ethidium bromide (1.0 μg mL−1) and visualized with a gel documentation system (Bio-Rad).

Nucleotide sequencing

Nucleotide sequencing of V. cholerae O1 wbe, O139 wbf and ctxA genes was performed. PCR products were purified using a QIAquick PCR purification kit (Qiagen). These purified products (50 ng) were sequenced on both strands using the BigDye Terminator v.3.1 Cycle sequencing kit on an ABI 3100 Genetic Analyzer sequencer (Applied Biosystems) according to the manufacturer's instructions. Sequencing reads were aligned and analyzed by bioedit Sequence Alignment Editor v.7.0.0 (Ibis Therapeutics, Carlsbad, CA). The accession numbers of the reference sequences of the previously mentioned genes are given in Table 1.

Statistical analysis

The phage concentrations of O1 and O139 vibriophages obtained from each sampling site of monthly sampling in the years 2006 and 2007 were subjected to statistical analysis. The mean and SDs were calculated based on the mean values of phage concentrations of monthly sampling. Two analyses were performed; one with respect to the mean phage concentrations of O1 vibriophages of 2 consecutive years, and the other with respect to the mean phage concentrations of O139 vibriophages of the same year. Statistical tests such as the F-test, the Student t-test, the Wilcoxon–Mann–Whitney rank test and the Kolmogorov–Smirnov test were performed to asses the differential trends of both the phages in the years 2006 and 2007. All statistical tests were performed using the downloaded version (r version 2.2.1) of the freely available r software (http://www.r-project.org).

Results

Physicochemical parameter

The variations in the environmental parameters monitored at the five sampling sites are presented in Table 2. The surface water temperatures at all stations varied between 20 and 36 °C, with higher temperatures recorded during the summer months. Alkaline pH was recorded, and ranged from 7.0 to 8.6, with a seasonal fluctuation at the highest level observed during the monsoon period. Two important parameters, viz., environmental temperature and relative humidity, were monitored during the course of the study. Environmental temperature ranged from 15.7 to 36.5 °C, and relative humidity ranged from 37% to 100%.

Table 2.   Range of variations in physical and chemical parameters during the period of investigation
Year and
month
Water temperature (°C)Water pHEnvironmental
temperature(°C)
Relative
humidity (%)
Rainfall
(mm)
1*2*3*4*5*1*2*3*4*5*MaximumMinimumMaximumMinimum
  • *

    Sampling sites.

2006
 January24232422257.27.17.07.07.226.118.286370
 February22222321247.17.27.17.57.624.216.190410
 March33323330337.27.37.07.57.734.423.994390
 April34333431347.37.27.07.57.436.526.3100750
 May32313231327.67.67.07.67.534.622.488370
 June34333432347.57.57.17.77.536.42898740
 July30313130327.67.97.97.98.333.5271008956.5
 August33313231328.48.08.18.38.034.627.71009080
 September26252624277.88.38.18.08.127.624.498896.9
 October32313231337.37.37.57.57.534.122.790540
 November29272827297.37.27.37.37.330.318.786380
 December25242524257.07.17.07.37.128.816.296410
2007
 January24232425247.07.27.07.37.027.119.994500
 February25242023257.17.37.17.37.124.515.794450.2
 March35333433357.27.57.37.47.13622.9100410
 April35333432347.47.77.37.67.336.226.292610
 May34323332347.58.07.58.07.533.724.890631
 June34343534357.58.07.58.07.036.228.192522.1
 July34343635348.18.28.18.18.633.827.592660
 August35343534358.18.28.08.48.334.827.6987277.1
 September35343635348.18.28.08.28.328.125.7892586.0
 October32303231327.57.47.17.47.032.322.690540
 November33323432337.27.07.17.27.035.126.790540
 December26242524267.17.27.47.57.327.616.895430

Vibriophage as a biomonitoring agent

The counts of V. cholerae O1 and O139 phages were recorded during the entire period of the investigation (Table 3). As reflected from this study, V. cholerae O1 phages were found at all the sites and exhibited a distinct seasonal cycle, with a primary peak (13.2 to 17.2 PFU mL−1) during monsoon, i.e. June to August in both the years (Fig. 3a). During the winter months, the counts of O1 phages declined in the water samples at all sites (5.6–8.0 PFU mL−1). Statistically, the difference between the trends of O1 phages of 2 consecutive years was found to be insignificant (P=0.538), indicating a similar trend in both years. The presence of non-O1 non-O139 phages, specific for serogroups O12, O37, O43 and O144, was also detected by the plaque assay method. Vibrio cholerae O139 phages were present in the environment for the maximum time span in the year 2006, except for late winter and early summer from February to April, and were also predominant during the monsoon period, like O1 vibriophages with a highest count with 14 PFU mL−1 in the year of 2006 (Fig. 3b). However in 2007, the prevalence of O139 phages was much more restricted during the monsoon and the post-monsoon period. The difference between the prevalence of O139 phages in 2 years at all the five stations was also found to be statistically significant (P<0.05). The phages could be isolated only during July to December, with the highest counts of 12.0 PFU mL−1 found in August. The O139 phages were completely absent during the winter and summer months (Table 3). Using the cross-reactive assay, we found that V. cholerae O1, O139 and non-O1 non-139 phages (specific for serogroups O12, O37, O43 and O144) in aquatic environments were host specific.

Table 3.   Seasonal incidence of Vibrio cholerae O1 and O139 and counts of respective vibriophages within a span of 2 years (2006–2007) at the five sampling stations
Year and
month
Detection and quantification of phages (PFU mL−1)Samples presence or absence*Mean phage concentration
(PFU mL−1)
O1 VibriophageO139 VibriophageV. cholerae O1V. cholerae O139
12345123451234512345O1 VibriophageO139 Vibriophage
  • *

    Samples +/− as per the results of Multiplex PCR assay.

  • Sample collection sites.

2006
 January7786711010+++70.6
 February8978700000++7.80
 March98910800000+8.80
 April12109111200000+++++10.80
 May141312121112121++++++12.41.4
 June171416151353241+++++++153
 July161817151768776+++++++16.66.8
 August17161918161412161513++++++++++17.214
 September1214121315101191012++++++++13.210.4
 October9108111299786++++++107.8
 November7866732441++++6.82.8
 December6778511121++++6.61.3
2007
 January76654000005.60
 February8798800000+++80
 March1099111000000++9.80
 April111210131100000+++++11.60
 May131411161200000+++++13.20
 June121514131400000+++++13.60
 July171513161943454+++++++164
 August17151316171116121011+++++++15.612.0
 September111212141034353++++++++++11.83.6
 October7968613230++++++7.21.8
 November8797812201+++++7.81.2
 December7877600120++++70.6
Figure 3.

 Graphical representation of the mean phage concentration levels of (a) Vibrio cholerae O1 and (b) O139 phages in aquatic environments of Kolkata during the entire surveillance period of 2006 and 2007.

Vibrio cholerae non-O1 and non-O139

Environmental samples, because of the presence of many bacteria in natural water sources, and selective medium, such as TCBS agar, can provide a medium to produce colonies whose appearance is similar to that of V. cholerae colonies (Choopun et al., 2002). Furthermore, a series of biochemical tests (West & Colwell, 1983; Baumann & Scubert, 1984; Farmer et al., 1985) and subsequently serum agglutination (Difco) have been commonly used to identify V. cholerae. A total of 120 samples were collected from all the stations during the entire period of the study. While no isolates of V. cholerae O1 and O139 could be recovered by conventional culture methods, in contrast, many strains of V. cholerae non-O1 non-O139 were isolated. Thus, our experimental results showed that non-O1 non-O139 V. cholerae strains were recovered with high counts from all the sampling sites during the entire period of the study, while V. cholerae O1 and O139 were not recovered.

Vibrio cholerae O1 and O139

The seasonal incidence of V. cholerae in various environmental samples monitored at the five sites during the entire period of investigation is presented in Table 3. Multiplex PCR assays for amplification of the genes ctxA and wb for V. cholerae serovars O1 (wbe) and O139 (wbf) were carried out using a total of 120 environmental samples. PCR is useful for the rapid detection of toxigenic V. cholerae O1 and O139 (Hoshino et al., 1998; Lipp et al., 2003; Rivera et al., 2003; Alam et al., 2006). The direct detection of ctxA and wb for both V. cholerae O1 (wbe) and O139 (wbf) in the environmental water samples using multiplex PCR provided a powerful clue regarding the presence of toxigenic V. cholerae O1 or O139, which yielded evidence of an environmental reservoir (Rivera et al., 2003; Alam et al., 2006). It was observed that the conventional method detects up to 10 CFU mL−1 of bacteria whereas multiplex PCR detects upto 1 CFU mL−1. Although no strains of V. cholerae O1 and O139 were obtained by the conventional method on culture media, in contrast, the multiplex PCR assay revealed the presence of V. cholerae O1 and also O139 (Fig. 2). As shown in Table 3, 90 samples (75%) were determined to be positive for wb for V. cholerae O1 (wbe), 32 samples (26.7%) for O139 (wbf) and 18 samples (15%) for both. In addition, 90 samples were also positive for the ctxA gene. During the entire period of the study, V. cholerae O1 was found to be predominantly positive in all seasons by multiplex PCR. In contrast, the multiplex PCR results show that V. cholerae O139 was dominant during all seasons in the year 2006, except late winter and early summer. Remarkably, in the year 2007, V. cholerae O139 was restricted only in the monsoon, post-monsoon and early winter periods.

Furthermore, amplification of the genes ctxA and wb for both V. cholerae O1 (wbe) and O139 (wbf) was carried out by simplex PCR from the amplified products of Multiplex PCR for confirmation of the nucleotide sequences of those genes. Nucleotide sequence analysis provided a very strong and unquestionable evidence for the presence of V. cholerae O1 and O139. Nucleotide sequencing of the 302-, 192- and 449-bp PCR products (Table 1) exhibited 100% homology with reference sequences of the ctxA, wbe and wbf genes. This finding corroborated the fact that V. cholerae O1, and surprisingly O139, was present in the aquatic environments in Kolkata.

Discussion

Vibrio cholerae is an aquatic microorganism and several reports have shown that there are environmental reservoirs of this pathogen in different geographical areas of the world (Chakraborty et al., 2000; Jesudason et al., 2000; Lipp et al., 2003; Louis et al., 2003). In India, cholera predominantly occurred in many cities including Kolkata with epidemic potential (Sur et al., 2006). Although no comprehensive studies have been carried out to look for V. cholerae O1- and O139-specific phages in freshwater environments in Kolkata, to our knowledge, this is the first study to prove that the surveillance of vibriophages reveals the presence of V. cholerae O1 and O139, in particular, in the water bodies in and around Kolkata even if there is no clinical cholera cases caused by V. cholerae O139. It should be mentioned here that several earlier works have been reported on the relationship between environmental cholera phages and seasonal epidemics of cholera (Madico et al., 1996; Faruque et al., 2005a, b; Jensen et al., 2006).

In this study, V. cholerae showed a seasonal pattern, which was correlated with other parameters such as water temperature and pH. The data indicate that the frequency of occurrence of V. cholerae is significantly higher at temperatures above 33 °C. Furthermore, the results show that there is an optimal pH range for V. cholerae detection (8.0–8.6). Alkaline pH values observed during the summer months at all the sites may be another factor aiding the proliferation of V. cholerae and, perhaps, suppressing the growth of other competing microbial communities in the environment (Nair et al., 1988). The seasonality of cholera in regions where cholera is endemic suggests that environmental conditions are linked to cholera epidemics (Russell, 1925; Louis et al., 2003).

As shown in our study, the highest counts of O1 and O139 phages were recorded in the monsoon period. Two important parameters, temperature and pH, are favorable for the population density of both phages and its host in the aquatic reservoir. In this study, within a span of 2 years, 2006–2007, O1 vibriophages were present at all the sites throughout the year, with the highest concentration in monsoon and the lowest in winter. Interestingly, the counts of O139 phages were lower and occurred only between June and December in 2007 as compared with the previous year. This finding was in agreement with our earlier study on V. cholerae, where high counts during the summer months and a noticeable decline during the winter months were observed (Nair et al., 1988).

In our search for the O1 and O139 serovars of V. cholerae, we used the molecular detection procedure (Multiplex PCR), which eventually selects V. cholerae O1 and O139 from a mixed environmental microbial community. Before this study, many cruises had been conducted in different parts of the world to search for culturable forms of V. cholerae in which traditional culture methods were used and only non-O1 and non-O139 strains were recovered. In sharp contrast, non-O1 and non-O139 V. cholerae were found to be abundant in all the 120 samples in our study, but no V. cholerae O1 and O139 isolates were recovered by the conventional culture method.

The multiplex PCR technique used for the detection of V. cholerae O1 and O139 when the concentrations of bacteria were very low (1 CFU mL−1) proved to be a useful tool for the analysis of environmental samples (Binsztein et al., 2004). Vibrio cholerae O1 and O139 detected by the multiplex PCR assay used in this study had genetic information typical for pathogenic V. cholerae O1 and O139 [e.g. wb genes for O1 (wbe) and O139 (wbf)]. This was strongly supported by Simplex PCR, followed by multiplex PCR and complete homology in nucleotide sequences in the mentioned genes.

A striking observation in the present study was that V. cholerae O139 phages could be isolated at all the sampling sites in spite of the absence of bacteria from the clinical cases. Our findings were in agreement with the results of isolation of O139 cases from our hospital surveillance and community-based study (unpublished data). These data showed a sharp decline of V. cholerae O139 in the last couple of years. The presence of non-O1 non-O139 vibriophages (specific for prevalent serogroups O12, O37, O43 and O144 in clinical cases) in aquatic environments and the cross-reactive assay result showed that there was a positive correlation between the detection of V. cholerae O1 and O139 in water samples and detection of O1 and O139 vibriophages in environmental samples. The presence of vibriophages in the water samples at a single site indicated that these water samples were positive for V. cholerae. It reflects that phage as an indicator maintaining the ecological balance in the aquatic system. Additionally, the phage acts as a biomonitoring agent in the environment. Hence, although O139 is clinically absent in hospitalized patients, it is present in the environments in association with the phage.

From the above findings, it can be concluded that V. cholerae O1 and interestingly O139 were present in aquatic environments in Kolkata, and the surveillance of both O1 and O139 phages plays a major role as a biomonitoring agent.

Acknowledgements

We thank Mr Raghunath Chatterjee for statistical analysis of this work and Mr S. Saha for his continuous help and assistance during the course of this work.

Ancillary