• Coccomyxa;
  • haplotype analysis;
  • lichenization;
  • rbcL;
  • symbiosis


  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References
  10. Supporting Information

The fungus Schizoxylon albescens occurs both as lichen and as saprobe. Lichenized colonies grow on the bark of Populus tremula; saprotrophic morphs grow on dead Populus branches. We wanted to (1) test whether lichenized and saprotrophic S. albescens are genetically distinct, (2) investigate photobiont association and diversity, (3) investigate the interactions between fungi and algae that occur during co-cultivation and (4) test whether Schizoxylon shows algal selectivity during lichenization. Fungal and algal genetic diversity were investigated for three markers. Algae from lichenized thalli were isolated in axenic cultures, and isolate sequence diversity was compared with algae amplified directly from thallus fragments. Co-culture experiments of fungi and algae were performed to study the morphological interaction patterns. Two distinct phylogenetic units are revealed in S. albescens, which are interpreted as phenotypically cryptic species. The algae are related to Coccomyxa and Pseudococcomyxa, and form two distinct sister clades separating samples isolated in cultures from those amplified directly from thallus fragments, indicating that more easily cultured strains of algae are not necessarily major components of the lichens. Schizoxylon albescens interacts with isolated algal strains, similar to fungal–Coccomyxa symbioses in nature. As the system is maintained without difficulty in culture, it can potentially be an easily controlled lichen symbiosis study system under laboratory conditions.


  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References
  10. Supporting Information

The lichen life style is one of the most well-known examples of symbiosis. Lichens represent the phenotype of nutritionally specialized fungi, the mycobionts, which derive carbon nutrition from the photobionts (green algae or cyanobacteria) located extracellularly within a matrix of fungal hyphae (Honegger, 1991; Hawksworth & Honegger, 1994). These mutualistic associations can be adapted to extreme environmental conditions, and are often able to colonize habitats where free-living fungi or algae would not survive. The lichen thallus, in which algae are protected by a fungal plectenchyma (Grube & Hawksworth, 2007), is a highly elaborated, exposed and long-living structure, and the morphological appearance is, to a high degree, genetically determined.

In some lichenized fungi, however, the fungal–algal associations are very loose, and only poorly distinguished thalli, if any at all, are formed. Such associations have been called ‘primitive lichens’ or ‘borderline lichens’ (Aptroot, 1991; Honegger, 1991; Hawksworth & Honegger, 1994; Kohlmeyer et al., 2004; Grube, 2005). Here, the fungal partners often thrive in a loosely defined microbial consortium, which may include other fungi, various algae and bacteria. During a mainly taxonomic and phylogenetic study on the family Stictidaceae (Wedin et al., 2005a, 2006), several species were found to represent borderline lichens. Moreover, they can live either as saprotrophs or as lichens depending on the substrate they grow on, a phenomenon named ‘optional lichenization’ by Wedin et al. (2004). The species showing optional lichenization are indeed very loosely lichenized. In these cases, the fungal life style depends on the substrate (bark or wood primarily of Populus tremula), rather than being inconsistent lichenization events on one substrate, as in other reported ‘borderline lichens’. Wedin et al. (2004) interpreted this phenomenon as a way to increase the fungal ecological amplitude as a strategy in fungi adapted to the successional habitat, Populus stands in the boreal coniferous forests that regenerate after a major disturbance. In the Stictidaceae showing optional lichenization, the lichenized morphs look superficially distinctly different from their conspecific saprotrophic counterparts. When lichenized, the colonies grow on bark, forming whitish areas, with patches of lichenized algae around their ascomata. Alternatively, the saprotrophic forms grow on wood without any associated algae (Wedin et al., 2006).

The recently described Schizoxylon albescens, a common, but much-overlooked species in Northern Sweden, was predicted to be an additional example of optional lichenization (Wedin et al., 2006). Lichenized colonies typically grow in and around cracks in the rough bark of older Populus trunks (Fig. 1a–c), and saprotrophic morphs [initially interpreted as a distinct species by Wedin et al. (2005a)] grow on dead, decorticated Populus- and Salix-branches. Schizoxylon belongs to the Stictidaceae in the Ostropales (Sherwood, 1977a, b; Lumbsch et al., 2004, 2007; Wedin et al., 2005b; Lumbsch & Papong, 2009), a family with a considerable variation of fungal life styles – saprotrophic, parasitic and lichenized species are all represented (Gilenstam, 1969; Wedin et al., 2004; Baloch et al., 2009).


Figure 1.  Habitus of Schizoxylon albescens on Populus bark. Algal colonies are distributed around the fruit bodies (arrows in a–c; ‘a’ in d–f): (a) MW8235, (b) MW8249, (c) MW8251 in light microscopy; (d, e) MW8236, (f) MW8238 in SEM. (e) Bacterial (arrows) and algal (a) cells are entangled in the filamentous matrix (fm). (d, f) The filamentous matrix (fm) and the fungal hyphae (h) develop intermixed with the algae clumps (a). Scale bars=1 mm (a–c), 5 μm (f), 10 μm (e), 20 μm (d).

Download figure to PowerPoint

In this study, we estimate the taxonomic and genetic diversity of fungal and algal components in the S. albescens system, and identify the photobionts included in the lichenized populations. We further test whether lichenized and saprotrophic S. albescens correspond to two distinct phylogenetic species or whether they are indeed optional lichens, as several related taxa are. We establish cultures of fungal and algal partners from this symbiotic system, to conduct initial co-cultivation experiments, and verify that interactions take place between the partners, and to study whether the cultures developed differently if wood or bark were added. Finally, co-cultivation experiments were also set up with additional potential photobionts to investigate the range of algal specificity in Schizoxylon.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References
  10. Supporting Information


The analysis included both freshly collected (spring and summer 2008) and herbarium material utilized in earlier studies (Wedin et al., 2006). The material is mainly from Northern and Central Sweden; one specimen is from Northern Norway. The localities were grouped into four geographic areas: Lycksele lappmark (lpm), Lule-Pite lpm, Jämtland-Hälsingland and Västerbotten-Ångermanland (Table 1). Sixty-six lichenized samples of S. albescens were collected on trunks of Populus, and 11 nonlichenized samples on decaying wood. The samples (Table 1) are housed in the herbaria of The Swedish Museum of Natural History in Stockholm and The Museum of Evolution, Uppsala University, Uppsala.

Table 1.   Herbarium, DNA extraction and NCBI accession numbers and geographic origin of the analysed samples of lichenized (bold) and saprotrophic thalli of Schizoxylon albescens
Herbarium number FungusAlgaeOrigin 
  • Herbarium acronyms are reported in parentheses.

  • *

    Label samples for which ITS sequences were also obtained (not reported).

GG2443a (UPS)AY661690  Northern SwedenLule-Pite lpm
GG2696a (UPS)CO271HQ287405DQ401144  Northern SwedenLycksele lpm
MW7575 (UPS)UM21HQ287354HQ287297  Central SwedenJämtland-Hälsingland
PI1473 (UPS)UM23HQ287298  Northern SwedenNorrbotten
MW7345 (UPS)UM24HQ287299  Northern SwedenVästerbotten-Ångermanland
MW7919 (UPS)UM27HQ287406HQ287355HQ287300  Northern SwedenLycksele lpm
MWsn04 (UPS)UM41HQ287407HQ287356HQ287301  Northern SwedenVästerbotten-Ångermanland
MW7104 (UPS)UM42HQ287357HQ287302  Northern SwedenVästerbotten-Ångermanland
MW7576 (UPS)UM43HQ287303  Central SwedenJämtland-Hälsingland
GG2667 (UPS)UM44HQ287408HQ287358HQ287304  Northern SwedenLycksele lpm
MW7199 (UPS)UM45HQ287409HQ287359HQ287305  North NorwayNorway
GG2646 (UPS)UM46HQ287410HQ287360HQ287306  Northern SwedenLycksele lpm
GG2534a (UPS)UM48HQ287361HQ287307  Northern SwedenLycksele lpm
MW7645 (UPS)UM57HQ287411HQ287362HQ287308  Northern SwedenLule-Pite lpm
MW7922 (UPS)EB99HQ287412HQ287363HQ287309  Northern SwedenLycksele lpm
MW7898 (UPS)EB109HQ287364HQ287310  Northern SwedenLule-Pite lpm
MW7664b (UPS)EB119HQ287413HQ287365HQ287311  Northern SwedenLule-Pite lpm
MW6742 (UPS)EB122HQ287414HQ287366HQ287312  Northern SwedenLycksele lpm
MW6735 (UPS)EB123HQ287313  Northern SwedenLycksele lpm
MW7675 (UPS)EB124HQ287415HQ287367HQ287314  Northern SwedenLule-Pite lpm
MW7666b (UPS)EB125HQ287416  Northern SwedenLule-Pite lpm
GG2448b (UPS)EB127HQ287417  Northern SwedenLule-Pite lpm
GG2361 (UPS)EB128HQ287418  Northern SwedenLule-Pite lpm
MW7067 (UPS)EB129HQ287419HQ287368HQ287315  Northern SwedenLycksele lpm
MW7036 (UPS)EB130HQ287420HQ287369HQ287316  Northern SwedenLycksele lpm
MW7075 (UPS)EB131HQ287421HQ287370HQ287317  Northern SwedenLycksele lpm
MW7077 (UPS)EB132HQ287422HQ287371HQ287318  Northern SwedenLycksele lpm
MW7078 (UPS)EB133HQ287423HQ287372HQ287319  Northern SwedenLycksele lpm
MW7028 (UPS)EB134HQ287424HQ287373HQ287320  Northern SwedenLycksele lpm
MW7034 (UPS)EB135HQ287425HQ287374HQ287321  Northern SwedenLycksele lpm
MW7020 (UPS)EB136HQ287426HQ287375HQ287322  Northern SwedenLycksele lpm
MW7026b (UPS)EB137HQ287427HQ287376HQ287323  Northern SwedenLycksele lpm
MW7030 (UPS)EB138HQ287428HQ287377HQ287324  Northern SwedenLycksele lpm
GG2691 (UPS)EB139HQ287429HQ287378HQ287325  Northern SwedenLycksele lpm
GG2453 (UPS)EB140HQ287430HQ287379HQ287326  Northern SwedenLycksele lpm
GG2434 (UPS)EB141HQ287431HQ287380HQ287327  Northern SwedenLycksele lpm
GG2354 (UPS)EB142HQ287432HQ287381HQ287328  Northern SwedenLycksele lpm
GG2616 (UPS)EB143HQ287433HQ287382HQ287329  Northern SwedenLule-Pite lpm
GG2622 (UPS)EB144HQ287434HQ287383  Northern SwedenLule-Pite lpm
GG2365 (UPS)KK012HQ287435HQ287384AY661689  Northern SwedenLule-Pite lpm
MW8229 (S)L541HQ287461 Central SwedenJämtland-Hälsingland
MW8230 (S)L542HQ287436HQ287330HQ287462 Central SwedenJämtland-Hälsingland
MW8231 (S)L543HQ287437HQ287331 Central SwedenJämtland-Hälsingland
MW8232 (S)L544HQ287332HQ287463 Central SwedenJämtland-Hälsingland
MW8233 (S)L545HQ287438HQ287385HQ287333HQ287464 Central SwedenJämtland-Hälsingland
MW8234 (S)L546HQ287439HQ287334HQ287465 Central SwedenJämtland-Hälsingland
MW8235 (S)L547HQ287440HQ287386HQ287335HQ287466 Central SwedenJämtland-Hälsingland
MW8236 (S)L548HQ287336HQ287467 Central SwedenJämtland-Hälsingland
MW8237 (S)L549HQ287441HQ287387 Central SwedenJämtland-Hälsingland
MW8238 (S)L550HQ287442HQ287337HQ287468 Central SwedenJämtland-Hälsingland
MW8239 (S)L551HQ287388HQ287338HQ287469 Central SwedenJämtland-Hälsingland
MW8240 (S)L552HQ287443HQ287339HQ287470 Central SwedenJämtland-Hälsingland
MW8243 (S)L553HQ287444HQ287389HQ287340HQ287471 Central SwedenJämtland-Hälsingland
MW8245 (S)L554HQ287445HQ287390HQ287341 Central SwedenJämtland-Hälsingland
MW8246 (S)L555HQ287446HQ287391 Central SwedenJämtland-Hälsingland
MW8247 (S)L556HQ287447HQ287392HQ287342 Central SwedenJämtland-Hälsingland
MW8249 (S)L557HQ287393HQ287343 Central SwedenJämtland-Hälsingland
MW8250 (S)L558HQ287448HQ287394HQ287472 Central SwedenJämtland-Hälsingland
MW8251 (S)L559HQ287449HQ287395HQ287344HQ287473 Central SwedenJämtland-Hälsingland
MW8252 (S)L560HQ287450HQ287396HQ287345 Central SwedenJämtland-Hälsingland
MW8253 (S)L561HQ287451HQ287397HQ287346HQ287474 Central SwedenJämtland-Hälsingland
MW8254 (S)L562HQ287452HQ287398HQ287347 Central SwedenJämtland-Hälsingland
MW8207 (S)L563*HQ287475HQ287270Northern SwedenVästerbotten-Ångermanland
MW8207 (S)L564HQ287476HQ287271Northern SwedenVästerbotten-Ångermanland
MW8207 (S)L565HQ287477HQ287272Northern SwedenVästerbotten-Ångermanland
MW8207/2 (S)L566HQ287478HQ287273Northern SwedenVästerbotten-Ångermanland
MW8207/2 (S)L567*HQ287479HQ287274Northern SwedenVästerbotten-Ångermanland
MW8207/2 (S)L568*HQ287480HQ287275Northern SwedenVästerbotten-Ångermanland
MW8207/2 (S)L569HQ287481HQ287276Northern SwedenVästerbotten-Ångermanland
MW8207/2 (S)L570HQ287482HQ287277Northern SwedenVästerbotten-Ångermanland
MW8207/2 (S)L571HQ287483HQ287278Northern SwedenVästerbotten-Ångermanland
MW8207/2 (S)L572HQ287484HQ287279Northern SwedenVästerbotten-Ångermanland
MW8207/2 (S)L573HQ287280Northern SwedenVästerbotten-Ångermanland
MW8207/2 (S)L574HQ287485HQ287281Northern SwedenVästerbotten-Ångermanland
MW8207/2 (S)L575HQ287486Northern SwedenVästerbotten-Ångermanland
MW8220 (S)L587*HQ287282Northern SwedenVästerbotten-Ångermanland
MW8220 (S)L588*HQ287283Northern SwedenVästerbotten-Ångermanland
MW8220 (S)L589HQ287284Northern SwedenVästerbotten-Ångermanland
MW8220 (S)L590HQ287285Northern SwedenVästerbotten-Ångermanland
MW8224 (S)L591HQ287286Northern SwedenVästerbotten-Ångermanland
MW8224 (S)L592HQ287287Northern SwedenVästerbotten-Ångermanland
MW8224 (S)L593HQ287288Northern SwedenVästerbotten-Ångermanland
MW8324 (S)L598HQ287453HQ287348HQ287487 Northern SwedenVästerbotten-Ångermanland
MW8327 (S)L599HQ287349HQ287488 Northern SwedenVästerbotten-Ångermanland
MW8328 (S)L600HQ287489 Northern SwedenVästerbotten-Ångermanland
MW8330 (S)L601HQ287454HQ287399HQ287490 Northern SwedenVästerbotten-Ångermanland
MW8355 (S)L602HQ287455HQ287400HQ287491 Northern SwedenVästerbotten-Ångermanland
MW8356 a (S)L603HQ287456HQ287401HQ287492 Northern SwedenVästerbotten-Ångermanland
MW8356 b (S)L604HQ287457HQ287402HQ287350HQ287493 Northern SwedenVästerbotten-Ångermanland
MW8358 (S)L605HQ287458 Northern SwedenVästerbotten-Ångermanland
MW8359 (S)L606HQ287459HQ287403HQ287351HQ287494 Northern SwedenVästerbotten-Ångermanland
MW8360 (S)L607HQ287495 Northern SwedenVästerbotten-Ångermanland
MW8361 (S)L608HQ287496 Northern SwedenVästerbotten-Ångermanland
MW8362 (S)L609HQ287497 Northern SwedenVästerbotten-Ångermanland
MW8363 (S)L610HQ287498 Northern SwedenVästerbotten-Ångermanland
MW8364 (S)L611HQ287460HQ287352 Northern SwedenVästerbotten-Ångermanland
MW8365 (S)L612HQ287404HQ287353HQ287499 Northern SwedenVästerbotten-Ångermanland
MW8233 (S) fL625HQ287500HQ287289Central SwedenJämtland-Hälsingland
MW8233 (S) iL626HQ287501HQ287290Central SwedenJämtland-Hälsingland
MW8233 (S) lL627HQ287502HQ287291Central SwedenJämtland-Hälsingland
MW8233 (S) mL628HQ287503HQ287292Central SwedenJämtland-Hälsingland
MW8233 (S) nL629HQ287504HQ287293Central SwedenJämtland-Hälsingland
MW8233 (S) pL630HQ287505HQ287294Central SwedenJämtland-Hälsingland
MW8238 (S) aL631*HQ287506HQ287295Central SwedenJämtland-Hälsingland
MW8238 (S) bL632HQ287507HQ287296Central SwedenJämtland-Hälsingland

Molecular analyses

In lichenized samples, fruiting bodies surrounded by algae were dissected using a sterile razor blade. DNA was extracted using the DNAeasy Plant Mini Kit (Qiagen, Vienna, Austria). DNA extractions of isolated algal cultures followed Cubero et al. (1999). The genetic diversity was investigated in three loci both for the fungi and for the algae.

The fungal markers used were the β-tubulin gene, the glyceraldehyde-3-phosphate dehydrogenase (GPDH) gene and the internal transcribed spacers (ITS) and 5.8S rRNA gene (Table 2).

Table 2.   Primers used in PCR and sequencing reactions
 Locus amplifiedPrimer namePrimer sequenceTypeReferences
Fungusβ-Tubulin geneBT3LM5GAACTGCTACTTCAACGAGPCR, sequencingMyllys et al. (2001)
 BT1910RTCTGGTCCTCRACCTCCTTCAPCR, sequencingMyllys et al. (2001)
Glyceraldehyde-3-phosphate dehydrogenase gene (GPDH)GPD_schizFATTGTTCGCAGCATTGAGCAPCR, sequencingIn this study
 GPD_schizRCAATGTCGTCCTCGGTGTAGPCR, sequencingIn this study
Internal transcribed spacer (ITS)ITS1FCTTGGTCATTTAGAGGAAGTAAPCR, sequencingGardes & Bruns (1993)
 ITS4TCCTCCGCTTATTGATATGCPCR, sequencingWhite et al. (1990)
Ribulose bisphosphate carboxylase large subunit gene (rbcL)rbcL320TATTCGAAGAAGGTTCAGTAACPCR, sequencingNozaki et al. (1995)
 rbcL803TCGTGCATAATAATAGGTACACPCR, sequencingNozaki et al. (1995)
AlgaeNuclear small subunit ribosomal DNA (nucSSU)NS8TCCGCAGGTTCACCTACGGAPCR, sequencingWhite et al. (1990)
 NS19CCGGAGAAGGAGCCTGAGAAACPCR, sequencingWhite et al. (1990)
 NS1680schizFATTAAGAGGGACAGTCGGGGGCSequencingIn this study
 NS3033schizRGGCAACCACCAACTAAGAACGGCSequencingIn this study
Internal transcribed spacer (ITS)ITS1TGGAAGGATCATTGAATCTATCGTPCR, sequencingKroken & Taylor (2000)
 ITS4TGGTTCGCTCGCCGCTACTAPCR, sequencingKroken & Taylor (2000)

The photobiont markers used were the chloroplast gene for the ribulose bisphosphate carboxylase large subunit (rbcL), the small nuclear subunit of the rDNA (nucSSU) and the ITS and 5.8S rRNA gene (Table 2). Two sequencing primers were designed in this study for the sequencing of the algal nucSSU (Table 2).

PCR reactions were prepared for a 30 μL final volume containing double-distilled water, 10 ×Taq polymerase reaction buffer (10 mM Tris pH 8.3), MgCl2 (1 mM), 2.5 mM of each dNTP, 0.1 U of Taq DNA polymerase and 10 μM primers. PCR amplifications were performed with an initial heating step of 2 min at 94 °C, linked to 37 cycles 45 s at 94 °C, of which the first seven cycles were touchdown for 45-s annealing conditions alternative at 57–51 °C for GPDH or 58–52 °C for the photobiont loci rbcL and nucSSU. The annealing temperature in the remaining 30 cycles was 50 °C for GPDH and 52 °C for the photobiont loci. Extensions were run for 1 min 45 s at 72 °C in the 37 cycles and one extension step of 7 min at 72 °C was performed at the end. ITS and β-tubulin primers did not require touchdown and the amplifications were run in 30 cycles with 53 °C and 58 °C annealing, respectively.

PCR products were cleaned using Qiaquick spin columns (Qiagen) or enzymatically (ExoSAP-IT, GE Healthcare, UK). Both strands were sequenced using the BigDye Cycle Sequencing Ready Reaction Kit (Applera, Austria) and sequences were run on an ABI310 automated sequencer (Applera).

Alignment and phylogenetic analysis

Separate alignments for each gene locus were produced automatically with clustalw as implemented in bioedit 5.0.6 (Hall, 1999; and then adjusted manually.

Haplotype networks for the fungal markers were constructed under the 95% parsimony probability criterion (Templeton et al., 1992) using the tcs program (Clement et al., 2000). The haplotypes are shaded differently (Fig. 2a–c) following the geographic provenance according to Table 1.


Figure 2.  Haplotype analyses: 95% probability haplotype networks for β-tubulin (a), GPDH (b) and ITS (c) gene of lichenized (bold) and saprotrophic thalli of Schizoxylon albescens in Central and Northern Sweden. The geographical origin of the samples is mapped on the haplotype networks and listed in the legend.

Download figure to PowerPoint

For each fungal marker, phylogenetic analyses were also performed using mrbayes 3.1.2 (Huelsenbeck & Ronquist, 2003). The optimal nucleotide substitution model, the GTR+I+G model (Rodriguez et al., 1990), was estimated with mrmodeltest v3.7 (Posada & Crandall, 1998) using the Akaike information criterion and the hierarchical likelihood ratio test (Posada & Crandall, 1998), and was used for likelihood calculations. The Bayesian Markov Chain Monte Carlo (B/MCMC) analyses were run for 2 million generations starting from a random tree, with six incrementally heated chains using the default temperature of 0.2, and every 100th tree was sampled. To ensure that all chains had converged at a single level, the burn-in sample of 5K trees was discarded for each run and a majority rule consensus tree was calculated for the remaining 15.001 trees. The burn-in period was determined after testing for the stationarity of likelihood values, i.e. by plotting numbers of generation vs. the log probability and checking for the convergent diagnostic factor, which approached 1 (Ronquist et al., 2005). The program tracer 1.4 (Rambaut & Drummond, 2004) was used to determine chain convergence and the appropriate burn-in.

The ITS, nucSSU and rbcL photobiont datasets were analysed separately; relevant sequences retrieved from GenBank were included. To identify the group of algae to which the Schizoxylon photobiont(s) belongs, we first performed phylogenetic analyses including different representatives of Chlorophyceae (not shown) and then restricted the datasets to the most closely related taxa. Two sequences of Chlorella sp. were selected as outgroup for each dataset. All phylogenetic analyses were carried out according to the same methods and parameters used for the fungal markers. The phylogenetic trees were visualized in treeview (Page, 1996).

Isolation of algal cells in culture

Eleven samples, those presenting the most abundant algal colonies around the fruiting bodies (MW7645, 7919, 8207, 8220, 8230, 8233, 8234, 8235, 8238, 8249, 8251), were selected to isolate algal cells in axenic cultures. In order to minimize bacterial contaminations, the first inocula were carried out on media containing antibiotics (ampicillin and tetracyclin). We applied three different strategies to facilitate the isolation of the right photobionts: (1) one fruiting body was taken with a sterile razor blade and the isolations followed the method described by Yamamoto et al. (2002), with modifications from Stocker-Wörgötter (2002); (2) algal clumps were removed with a sterile needle and transferred directly on the agar medium; and (3) algae clumps were diluted in sterile water and plated by pipetting. If an isolation event resulted in a diversity of colonies, each colony was subcultivated on a new Petri dish. The algae were grown on Trebouxia medium (TM; Ahmadjian, 1967) and Malt Yeast (MY; Ahmadjian, 1967) medium and algal colonies were maintained alive by subculturing them every 2 months. The identity of the isolates was finally checked by DNA sequence analysis of the nucSSU and rbcL loci.

Isolation of fungi in culture

Schizoxylon albescens was isolated from the two non-lichenized MW7919 and MW7664b, and from the lichenized MW7645 samples following Yamamoto et al. (2002), with some modification outlined in Stocker-Wörgötter (2002). The fungi were grown on MY (Ahmadjian, 1967) and Lilly Barnett Medium (LBM; Lilly & Barnett, 1951) media. Fungal thalli grown up to 1 cm in diameter were subcultured every 3–4 months. The identity of the isolates was checked by DNA analysis of the ITS locus.

Algal and fungal isolates are stored as cryostock culture in the Institute of Plant Sciences, Graz.

Co-culture experiments of fungi and algae

The establishment of lichenized structures was studied by setting up mixed cultures of the fungus with the algae. Different combinations of the three isolated fungi, MW7645 (lichenized), MW7664b and MW7919 (nonlichenized), with 10 selected algal isolates (Supporting Information, Table S1) were grown on LBM (Lilly & Barnett, 1951), Lichen Medium (LM; Honegger, 1993), MY and TM (Ahmadjian, 1967) media.

Fungi and algae were also subcultivated on Petri plates to which sterile Populus wood and bark pieces were added, to test whether the fungus and algae would behave differently when affected by wood or bark.

We finally set up co-cultivation experiments with three additional lichen photobionts available in the culture collection of our laboratory (Graz) to test whether Schizoxylon shows any selectivity towards different photobionts. These were a Trebouxia arboricola (Trebouxiophyceae) isolated from the lichen Tephromela atra, a Chlorella-like photobiont (Trebouxiophyceae) from Flakea papillata and a Trentepohlia sp. (Ulvophyceae) from Cystocoleus ebeneus.

Scanning electron microscopy (SEM) analyses

Scanning electron microscope observations were performed on the two lichenized samples MW8236 and MW8238 (original thalli) and on five well-developed mixed cultures (Table S1). The samples were fixed in 2% paraformaldehyde/2.5% glutaraldehyde in 0.1 M cacodylate buffer with 0.1 M sucrose at pH 7.2 for 4 h (Karnovsky, 1965) at room temperature. After rinsing the cells twice in buffer with 0.1 M sucrose (15 min), the samples were gradually infiltrated with acetone and dried at the CO2-critical point (CPD030, Baltec). The samples were sputtered with gold and analysed using a Philips XL30ESM.


  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References
  10. Supporting Information

Fungal genetic diversity

We obtained a total of 51 new β-tubulin, 56 GPDH and 57 ITS rDNA sequences. One haplotype network was recovered for the β-tubulin and ITS loci (Fig. 2a and c), whereas the GPDH haplotypes formed two distinct networks (Fig. 2b). Jämtland-Hälsingland and Västerbotten-Ångermanland are the regions in which, on average, the highest allelic richness was detected among the individuals. In particular, the highest genetic diversity is observed in the ITS region of samples coming from Jämtland-Hälsingland: 15 different haplotypes are found among 20 specimens. Jämtland-Hälsingland and Lycksele lpm are the regions from which most material was available. Lycksele lpm is also the region where we obtained the most complete dataset for the three fungal markers and where we recovered the lowest genetic diversity (Table S1).

The most frequent β-tubulin haplotype is shared by 26 lichenized and five nonlichenized samples from all the regions of Sweden studied (Fig. 2a). A second haplotype is detected only in three regions and shared by six lichenized and two nonlichenized samples. Ten single β-tubulin haplotypes are recovered, two for Lycksele lpm, of which one belongs to a nonlichenized specimen, three for Västerbotten-Ångermanland and five for Jämtland-Hälsingland (Fig. 2a).

The most common GPD haplotype comprises 24 samples (two nonlichenized), originating from all the Swedish regions studied (Fig. 2b). The second most common haplotype (smaller network) occurs in all Swedish regions (the majority are samples from Lycksele lpm) and from Norway. Fourteen different haplotypes are found in single individuals from Jämtland-Hälsingland (seven), Lule-Pite lpm (one) and Lycksele lpm (three) – one of which is a nonlichenized specimen – and Västerbotten-Ångermanland (three) (Fig. 2b).

Two ITS haplotypes are shared by lichenized (30) and non-lichenized (six) samples coming from all regions in Sweden and Norway (Fig. 2c). Three less common haplotypes are shared by samples coming from Jämtland-Hälsingland (five), Lule-Pite lpm (two) and Lycksele lpm (two). The more frequent of these haplotype (shared by four individuals) is present in three nonlichenized individuals, one from each of these Swedish regions (Fig. 2c). Fifteen haplotypes are found individually in Jämtland-Hälsingland (10), Lule-Pite lpm (one) and Västerbotten-Ångermanland (three). Eight specimens (MWsn04, 7020, 7036, 7077, 8359, and GG2453, 2646, 2616) share the most common haplotype of each marker.

The phylogenetic inferences obtained for each individual marker do not segregate lichenized samples from the saprobes: samples representing both life styles constitute two main groups, distinguished as sp. 1 and sp. 2, in which they are intermixed (Fig. S1a–c). However, members of the sp. 1 and of the sp. 2 are, respectively, unresolved in the GPD and β-tubulin analyses.

Algal genetic diversity

Six ITS, 27 nucSSU and 20 rbcL sequences were obtained from the algae isolated in culture (Table 1). Only rbcL sequences could be obtained out of 27 specimens growing on bark. For these specimens, several attempts to amplify the ITS and nucSSU rDNA algal regions were unsuccessful, possibly due to poor primer matching. We could not obtain any algal sequences directly from DNA extractions of the two samples MW8207 and MW8219 (Table 1). However, for these samples, we gained data for the three fungal loci and we could isolate the algal strains.

All algal sequences, obtained from the amplification of the ITS, nucSSU and rbcL loci, were similar to the sequences of Coccomyxa and Pseudococcomyxa (Chlorophyceae) when conducting blast searches in GenBank (blast score: 97–99% maximum identity).

The rbcL phylogeny groups all Schizoxylon-associated photobionts into one large clade in which two fully supported subclades are distinguished (Fig. 3). Clade A comprises samples exclusively coming from cultured algae isolated from the richly lichenized Schizoxylon samples selected. The sequence of Pseudococcomyxa simplex (EF589155) is nested in clade A. Clade B groups sequences amplified directly from lichenized thalli and three sequences of photobionts isolated in culture. For the specimens MW8233 and MW8238, we generated rbcL algal sequences both from the DNA extractions from the original thalli on bark and from the photobionts that were isolated in cultures. The rbcL sequences (Fig. 3) from MW8233 are present either in clade A (two sequences, L625, L630) or in clade B (three sequences, L626, L628, L629), whereas the algae isolated from MW8238 (two sequences, L631, L632) group are present only in clade A.


Figure 3.  Phylogeny of rbcL genes: 50% majority-rule consensus tree of a B/MCMC sampling procedure. Bold branches are supported by posterior probabilities>95%. Algal strains isolated in cultures are marked in bold; those additionally co-cultivated with the mycobiont are labelled with ‘C’. J-H (Jämtland-Hälsingland) and V-A (Västerbotten-Ångermanland) indicate the geographical provenance. Isolated algal strains from MW8233 and MW8238 and their own original thallus are marked by * and #, respectively. Samples retrieved from GenBank are reported with the NCBI accession numbers.

Download figure to PowerPoint

The nucSSU contains a very small amount of genetic difference (we detected among 1350 bp only six variable sites and some scattered indels), and our sequences group into one single fully supported, but unresolved clade (Fig. 4), including four Coccomyxa sequences from GenBank. The ITS sequences likewise showed high similarity (blast score: 99% maximum identity) to published Coccomyxa sequences from lichen photobionts (Zoller & Lutzoni, 2003). The ITS sequences were not used further in our phylogenetic studies.


Figure 4.  Phylogeny of nucSSU genes: 50% majority-rule consensus tree of a B/MCMC sampling procedure. Bold branches are supported by posterior probabilities>95%. Algal strains isolated in cultures are marked in bold. Samples retrieved from GenBank are reported with the NCBI accession numbers.

Download figure to PowerPoint

Isolation in axenic cultures and co-culture experiments

The fungus S. albescens was successfully isolated in culture from all the three selected samples (MW7645, MW7664 and MW7919). The Schizoxylon fungi formed white-pink colonies, which usually developed three-dimensionally with aerial hyphae.

Twenty-five algal isolates were obtained from four lichenized samples (MW8207, 8220, 8233, 8238). Initially, 40 algal inoculates were set; 15 were discarded due to fungal and bacterial contaminations. Of the remaining isolates, 10 were selected to set up co-culture experiments with the fungi (Table S2). Three algal strains correspond to the cultivated algae in clade B and six correspond to samples present in clade A of Fig. 3; rbcL sequence data were not obtained for L573 PL3-3 (Table S2). Generally, the Schizoxylon fungus and algae grew better on MY and LBM media. We observed no difference between the samples grown directly on the media (Fig. 5b–d) and those partially grown on the bark or the wood pieces (Fig. 5a). The algal cells and colonies show the diagnostic characteristics described by Jaag (1931) for Coccomyxa cultures: the algae grew in circular colonies c. 1–2 mm above the medium, with well-delimited margins, dark green colour and a glossy surface (partially visible in Fig. 5d), but became paler when old. The algal cells are rather small and regularly elliptic/ovoid.


Figure 5.  Co-cultures of the fungus Schizoxylon albescens MW7919 together with isolated algal strains (Coccomyxa) PL2.1 (a), PL4.1 (b), MW8233n (c) and MW8238a (d), on LBM medium (a, d) and on MY medium (b, c). Scale bar=0.5 cm.

Download figure to PowerPoint

In the co-cultures with the Coccomyxa-like algae, the fungus often covered the algal colonies with a thin white mat of hyphae (Fig. 5b and c). Under the light microscope, fungal hyphae were observed to be surrounding and closely adhered to algal cells. Five well-grown co-cultures were selected for SEM analyses (Table S2).

In co-culture with Trebouxia sp., the algae developed healthy colonies, but the fungus did not grow together with them (Fig. 6a). Trentepohlia sp. grew very poorly and slowly whereas the fungus formed a rather well-developed mycelium (Fig. 6b). In culture with the Chlorella-like photobiont of F. papillata, both the alga and the fungus developed very small and independent colonies (Fig. 6c). Because only the cultures set with Trentepohlia sp. and with the Chlorella-like photobiont were more conspicuous, they were investigated using SEM.


Figure 6.  Additional co-cultivation experiments: Schizoxylon fungus co-cultivated with Trebouxia sp. (a), Trentepohlia sp. (b, d) and the Chlorella-like photobiont of Flakea papillata (c, e, f), in light microscopy (a–c) and SEM (d–f). Fungal hyphae (arrows) and algal cells (a) are indicated. Scale bars=1 mm (a), 2 mm (b), 0.5 mm (c), 10 μm (d, e) and 4 μm (f).

Download figure to PowerPoint

Analyses of symbiotic interactions with SEM

Algal cells associated with the fungus in the environmental samples of lichenized thalli of MW8236 and MW8238 are spherical to elliptical in shape and group in small relatively dense packets (Fig. 1d–f). The fungal hyphae grow intermixed with the algae clumps, and occasionally, the hyphae cover the algal cells with a secreted, unidentified filamentous matrix. This matrix fuses the hyphae to the algal cell wall and keeps the algae together in packets (Fig. 1d). Bacteria and fungal spores are also entangled in the lichenized thallus (Fig. 1e) and occasionally fungal hyphae are adhering to the algal cell walls (Fig. 1f).

In the co-cultures, the arrangement of the algae and the hyphae resembles the pattern observed both in the environmental samples and with the stereomicroscope for the cultures. A relatively thick algal layer, conspicuous in the transversal section, grew beneath the fungal hyphae. The hyphae are branched and spread on and among the algae and cover the upper surface of the algal layer with a very thin sheet of the filamentous matrix (Fig. 7a, c and f). In some cases, hyphae and the filamentous matrix are so tightly appressed to the algal cell walls that it is almost impossible to identify the boundary between them (Fig. 7d, g and h). In some areas, the matrix is distributed continuously on the algae, whereas in other parts, it seems to tear, probably due to the overgrowth of the algae (Fig. 7b, e, g and h). We did not observe fungal penetration hyphae (pegs or haustoria, hyphal structures penetrating the algal cell walls, produced in many lichen interactions with other algae) in any specimens or co-cultures.


Figure 7.  SEM analyses of co-cultures of Schizoxylon albescens and isolated algal (Coccomyxa) strains. (a–c, f, h) MW7919 with algal strain MW8238a; (d) MW7919 with algal strain MW8233n; (e) MW7919 with algal strain PL2.1; (g) MW7664 with algal strain MW8233n. Fungal hyphae (arrows), algal cells (a) and filamentous matrix (fm) are indicated. Scale bars=20 μm (a, c), 10 μm (f), 5 μm (b, e), 4 μm (g, h), 2 μm (d).

Download figure to PowerPoint

In co-cultures with Trentepohlia (Fig. 6d) or with the coccoid photobiont of F. papillata (Fig. 6e and f), we noticed neither a thick net of fungal hyphae or filamentous matrix nor interactions among hyphae and algal cells. In both cases, the hyphae grow inconspicuously among the algal cells. Particularly in the co-culture with the coccoid photobiont of F. papillata, S. albescens develops extremely thin hyphae, which break into small fragments and do not form any continuous net (Fig. 6e and f).


  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References
  10. Supporting Information

Mycobiont genetic diversity: species concept and life styles

The lichenized and the saprotrophic morphs of S. albescens do not correspond to separate phylogenetic species. Our haplotype analyses do not show any genetic differentiation between the two life styles, nor is the genetic difference correlated with geographical origin in any of the markers. Further, the most commonly found haplotypes are shared among individuals belonging to different geographic origins. Up to 15 single haplotypes are recovered for each genetic marker among samples of the same geographic origin, thus indicating a certain degree of genetic diversity. In comparison, a high degree of genetic difference – described by increased rates of nucleotide substitutions – was demonstrated to correlate to the transition between lichenization and mutualism among closely related species of the basidiomycete genus Omphalina (Lutzoni & Pagel, 1997). Our study, however, focuses on the within-species genetic diversity of an optionally lichenized fungus, S. albescens. Here, we do not find any correlation between the allelic richness and the different life styles. Similarly, Wedin et al. (2004) could not find any genetic difference within optionally lichenized Stictis sp., which are closely related to Schizoxylon. However, later, the same authors (Wedin et al., 2006) could correlate a substantial morphological within-species variation to the fungal life styles, concluding that optionally lichenization apparently affects the anatomy and morphology of these fungi.

Schizoxylon albescens clearly forms two genetically distinct units in the haplotype analyses, which cannot be separated on morphology alone. These results are further supported by the phylogenetic inferences reconstructed for each marker (Fig. S1): here, both units are monophyletic in the ITS rDNA, sp. 2 without significant support; however, sp. 1 is further supported as monophyletic in the GPDH tree and sp. 2 is supported in the β-tubulin phylogeny. Although the information present in these markers is somehow limited for phylogenetic analyses, and the resolution in these phylogenies is thus not impressive, the overall congruent patterns between single-marker phylogenies and haplotype analyses suggest that two distinct genetic units are present. We are tempted to interpret these two units as representing morphologically cryptic species, identified here through haplotype analyses and concordance of gene genealogies (Grube & Kroken, 2000; Taylor et al., 2000). In lichen fungal systematics, the phylogenetic species concept has been applied in several species groups including the difficult Letharia vulpina/columbiana sp. complex (Kroken & Taylor, 2001) and the heavy-metal-accumulating Acarospora smaragdula complex (Wedin et al., 2009). Schizoxylon albescens s.l. is thus another example in the Stictidaceae of two morphologically extremely similar sister lineages showing optional lichenization (as in Stictis confusa/Stictis populorum; Wedin et al., 2004).

Algae strains in the optional lichenization and their genetic diversity

Lichenized algal colonies are normally present in varying amounts around the fungal fruiting bodies on bark (Fig. 1a–c). It can be argued that the molecular data obtained for the photobionts appear fragmentary and unsuitable for phylogenetic analyses due to our failure to amplify all the markers for all the samples. By contrast, they are very valuable for an approximate identification of the algae and for comparing how easily different genotypes grow in cultures. The nucSSU and the ITS rDNA sequences show a high similarity to Coccomyxa lichen photobionts when performing blast searches in GenBank. The most similar sequences come from a unique algal endophyte of Ginkgo trees (Coccomyxa glaronensis, Tremouillaux-Guiller & Huss, 2007) and from a Coccomyxa parasitizing mussels (Rodríguez et al., 2008). Both the diagnostic morphological characteristics observed and the sequence data obtained thus indicate that these algae are closely related to Coccomyxa. This genus is still very poorly known taxonomically, which is indicated by the limited number of Coccomyxa photobiont sequences available in public databases. In the phylogenetic analysis of the nucSSU, all the algae isolated in culture form one unresolved group, but this analysis lacks data from thalli of samples from the field. In the tree based on the rbcL locus, however, which includes DNA data both from the algal isolates and from direct thallus extractions, the algae form two distinct clades corresponding to clade A and to clade B, respectively. Only three algal cultures, L626, L628 and L629, fall into the clade B. The results clearly show that the nucSSU rDNA does not contain enough genetic diversity to distinguish species in this group, but that the rbcL locus is more variable and can be considered a more appropriate marker to estimate genetic variation. The rbcL analysis indicates that there is a substantial diversity of algal strains and the detection of two main distinct clades may be explained in two ways. The dominant strain in the thallus, which would be the most important photobiont, is not the best competitor under the culture conditions provided. The clade A includes no algal sequences obtained directly from the thalli, indicating that these algae may not be the major components of the lichen association, but rather represent admixed algae present on the bark that just happen to grow better in culture while others lack growth factors present in the natural habitat. Under these circumstances, the culture-dependent approach underestimates the diversity of involved photobionts and may even select algae that are not necessarily involved as photobionts. The clade A groups together with a sample of Pseudococcomyxa, which is closely related to Coccomyxa, of which no rbcL sequences are available at present (2009–2010) in GenBank. An alternative explanation would be that the rbcL locus of a certain group of algae amplifies better due to primer biases. The main symbiotic partner could be represented by those cultured strains, but in environmental samples, the rbcL primers would anneal better with the DNA of algae that are present in minor amounts in the thalli. This finding could have implications for culture-based studies of potential lichen photobionts, especially in cases where the photobionts are commonly found to be free-living.

Coccomyxa is a relatively common unicellular green alga in the class Trebouxiophyceae, and is distantly related to other lichen photobiont genera, for example Trebouxia or Stichococcus (Karsten et al., 2005). The genus is polyphyletic (Rodríguez et al., 2008) and includes free-living species, parasitic species of marine echinoderms, epiphytic or endophytic species of higher plants and lichen thalli, and lichen photobionts (Jaag, 1931; Honegger, 1991; Gray et al., 1999; Rodríguez et al., 2008). Also in our analysis of the nucSSU gene (Fig. 4), Coccomyxa is polyphyletic. Coccomyxa is known to lichenize with Ascomycetes in the Peltigerales (i.e. Nephroma, Peltigera, Solorina), with species of the genus Icmadophila (Jaag, 1931), and with species of the basidiomycetous genus Omphalina (Jaag, 1931; Zoller & Lutzoni, 2003).

As we know nothing about the within-species variation of the rbcL in these algae, we cannot state whether more than one Coccomyxa sp. takes part in the optional lichenization. There is still a considerable genetic variation both between algal isolates from different Schizoxylon samples and between the different algal isolates from the sample MW8233. Even those isolates (L626, L628 and L629) grouping in the clade B are not identical to the sequences in the same clade obtained from the DNA extractions directly from the original thallus. This indicates that a number of comparatively closely related algal strains, possibly several species, may be involved in the lichenization of Schizoxylon.

Symbiotic interactions in culture

Although in vitro studies focusing on the initial stages of the lichenization process have shown that axenically isolated lichen mycobionts and photobionts can reform lichenized structures in culture (Ahmadjian et al., 1980; Ahmadjian & Jacobs, 1981; Bubrick et al., 1985; Ott, 1987; Galun & Garty, 1988; Stocker-Wörgötter, 1995, 2001; Schaper & Ott, 2003), we did not observe any penetration peg or haustorium – a typical structure of lichenization in which fungal hyphae enter the photobiont cells to extract nutrients (Honegger & Brunner, 1981; Tschermak-Woess, 1988; Honegger, 1991, 1993) – in our culture experiments. Only fungal hyphae adhering tightly to the algal cells were observed. This, however, is the expected situation in symbioses involving Coccomyxa and there are a couple of alternative explanations of why no penetrating hyphae are formed in such interactions. Plessl (1963) stated that Coccomyxa cells might be too small to be penetrated by fungal hyphae, but Honegger & Brunner (1981) and Honegger (1984) provided a more likely explanation by suggesting that the absence of fungal penetrating hyphae is due to the characteristic structure of the cell wall in Coccomyxa. In both free-living and lichenized species of Coccomyxa, the outermost cell wall layer contains sporopollenin, which is a highly efficient barrier against fungal parasitism (Honegger & Brunner, 1981; Honegger, 1991). This layer would just allow wall-to-wall apposition and very tight adhesion of the algal and fungal cells. For these reasons, in our experiments, it is also more difficult to determine where hyphae would terminate their linear growth when coming in contact with one or more algal cells, and start to embrace and surround the algae completely, as observed in typical symbiotic interactions (Joneson & Lutzoni, 2009). Consequently, SEM observations made at the very early stages of development would probably not be sufficiently convincing and interpretable in this case. The contacts between algae and hyphae are more evident on the uppermost layers of the cultures, where the fungus builds a densely branched hyphae mat and a filamentous matrix, and the hyphae grow densely among the algae (Fig. 7a, c and f). The lower layers are indeed composed mainly by algal cells, the fungal hyphae do not penetrate much into the algal colonies, and in transversal sections, a net of hyphae is not as well detectable as on the surface of the cultures. Nevertheless, the matrix we observed should not be mistaken for the gelatinous sheet typically produced by Coccomyxa cells. Free-living Coccomyxa usually produce a mucilaginous substance, which keeps the algal cells together, sometimes also including different species, and maintains a colony structure (Jaag, 1931; Tschermak-Woess, 1988). In cultures, the filaments of the matrix clearly originate from the fungal hyphae and spread over the algal cells, and also between hyphae that have not yet come into contact with the algae (Fig. 7b, d, e, g and h). Coccomyxa cells usually produce no gelatinous matrix when they are in a lichenized state (Tschermak-Woess, 1988). The lack of a matrix in both the natural samples and the cultures is thus a further confirmation that the fungus and algae establish an association.

In lichens, mycobionts and photobionts are considered compatible if they enter into the second stage of development, characterized by the increased branching of the hyphae around the algal cells (Ahmadjian et al., 1978; Galun, 1988; Joneson & Lutzoni, 2009). As this was indeed observed in our co-cultures, we interpret this as evidence for considering the algae compatible photobionts. The samples analysed by scanning microscopy were co-cultures established with two algal strains, L628 and L629, belonging to clade B, which group sequences obtained directly from the DNA extraction from the thalli, and one strain, L631, belonging to clade A. If strains of the clade A would be just algae that represent better competitors in culture, we would expect that L631 would not interact with the mycobiont as well as L628 and L629. However, we did not observe any difference in the interactions, and the mycobiont developed the same thalline growth structures in all cases. This might be explained by the fact that our preliminary co-culture experiments selected the best-growing algae rather than the ‘best’ photobionts, and that growth conditions were maintained constant for all the co-cultures. Our observations may thus be interpreted as that Schizoxylon may lichenize with algae that are closely related to, but not identical to the main photobiont as long as they are compatible. A certain lack of specificity is also known from certain other lichens: Lecanora rupicola, Protoparmeliopsis muralis, Cladonia subulata, Cladonia macilenta and Evernia mesomorpha form thalli with different photobiont species of the same genus (Guzow-Krzemiñska, 2006; Doering & Piercey-Normore, 2009; O. Peksa & P. Škaloud, unpublished data).

Brunauer et al. (2007) noticed similar tight parietal adhesion between Coccomyxa cells co-cultivated with a lichenicolous fungus, but the same fungus developed haustoria when co-cultured with Trebouxia photobionts. However, S. albescens does not seem to interact with any of the other photobionts tested. Cultures with Trebouxia sp., Trentepohlia sp. and the Chlorella-like photobionts revealed no signs of interaction between the fungus and the algae. If S. albescens would have also interacted with the other lichen photobionts tested, any specificity for certain algal partners could have been stated from our observations. The preference of the fungus to interact in culture with certain algal strains of the Coccomyxa/Pseudococcomyxa-type strengthens the molecular results in which only Coccomyxa/Pseudococcomyxa-like sequences are detected.


  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References
  10. Supporting Information

We have investigated the S. albescens fungal and algal partners in detail. Schizoxylon albescens was shown to represent two distinct, but cryptic fungal species: both form optional lichenization and grow very well in culture. Schizoxylon forms loosely lichen-structured symbioses with photobionts related to the known lichen photobiont Coccomyxa. The photobionts isolated in culture show substantial genetic variation, and three fungal isolates did not show preference between algal isolates originating from thallus fragments.

The study of lichen symbiosis has long suffered from a lack of model organisms and easily cultivable lichens in which the lichenization does not collapse under controlled laboratory conditions. As the Schizoxylon–‘Coccomyxa’ system is common in the northern Scandinavian boreal forests, and our first attempts indicate that it is easily established and maintained in culture, we suggest that it should be explored further in functional studies of lichen fungal–algal interactions under controlled laboratory conditions. We suggest that it could potentially become a model system for such interactions including simple lichen associations. If further cultivation experiments prove successful, relichenization with these fungi in vitro could provide us with a valuable insight into the biology of lichens and of the understanding of symbiotic systems in general.


  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References
  10. Supporting Information

This study was supported by The Swedish Research Council (VR 621-2006-3760 and VR 621-2009-5372) to M.W. The staff at the Molecular Systematics Laboratory at The Swedish Museum of Natural History provided invaluable laboratory assistance. The assistance of Regina Willfurth in SEM preparation is greatly acknowledged.


  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References
  10. Supporting Information
  • Ahmadjian V (1967) A guide to the algae occurring as lichen symbionts: isolation, culture, cultural physiology, and identification. Phycologia 6: 127160.
  • Ahmadjian V & Jacobs JB (1981) Relationship between fungus and alga in the lichen Cladonia cristatella Tuck. Nature 289: 169172.
  • Ahmadjian V, Jacob JB & Russell LA (1978) Scanning electron microscope study of early lichen symbiosis. Science 200: 10621064.
  • Ahmadjian V, Russell LA & Hildreth KC (1980) Artificial reestablishment of lichens. I. Morphological interactions between the phycobionts of different lichens and the mycobionts of Cladonia cristatella and Lecanora chrysoleuca. Mycologia 72: 7389.
  • Aptroot A (1991) A monograph of the Pyrenulaceae (excluding Anthracothecium and Pyrenula) and the Requienellaceae, with notes on the Pleomassariaceae, the Trypetheliaceae and Mycomicrothelia (lichenized and non-lichenized Ascomycetes). Bibl Lichenol 44: 1178.
  • Baloch E, Gilenstam G & Wedin M (2009) Phylogeny and classification of Cryptodiscus, with a taxonomic synopsis of the Swedish species. Fungal Divers 38: 5168.
  • Brunauer G, Blaha J, Hager A, Türk R, Stocker-Wörgötter E & Grube M (2007) An isolated lichenicolous fungus forms lichenoid structures when co-cultured with various coccoid algae. Symbiosis 44: 127136.
  • Bubrick P, Frensdorff A & Galun M (1985) Selectivity in the lichen symbiosis. Lichen Physiology and Cell Biology (BrownDH, ed), pp. 319334. Plenum Press, New York.
  • Clement M, Posada D & Crandal KA (2000) TCS: a computer program to estimate gene genealogies. Mol Ecol 9: 16571659.
  • Cubero OF, Crespo A, Fatehi J & Bridge PD (1999) DNA extraction and PCR amplification method suitable for fresh, herbarium stored and lichenized fungi. Plant Syst Evol 217: 243249.
  • Doering M & Piercey-Normore MD (2009) Genetically divergent algae shape an epiphytic lichen community on jack pine in Manitoba. Lichenologist 41: 6980.
  • Galun M (1988) Lichenization. CRC Handbook of Lichenology, Vol. II (GalunM, ed), pp. 153169. CRC Press Inc., Boca Raton, FL.
  • Galun M & Garty J (1988) Soredia formation of compatible and incompatible lichen symbionts. Cell to Cell Signals in Plant, Animal and Microbial Symbiosis (ScanneriniS, SmithD, Bonfante-FasoloP & Gianinazzi-PearsonV, eds), pp. 207217. Springer-Verlag, Berlin.
  • Gardes M & Bruns TD (1993) ITS primers with enhanced specificity for basidiomycetes. Application for the identification of mycorrhizae and rust. Mol Ecol 2: 113118.
  • Gilenstam G (1969) Studies in the genus Conotrema. Ark Bot 7: 149179.
  • Gray AP, Lucas IAN, Seed R & Richardson CA (1999) Mytilus edulis chilensis infested with Coccomyxa parasitica (Chlorococcales, Coccomyxaceae). J Mollus Stud 65: 289294.
  • Grube M (2005) Frigidopyrenia– a new genus for a peculiar subarctic lichen, with notes on similar taxa. Phyton 45: 305318.
  • Grube M & Kroken S (2000) Molecular approaches and the concept of species and species complexes in lichenized fungi. Mycol Res 104: 12841294.
  • Grube M & Hawksworth DL (2007) Trouble with lichen: the re-evaluation and re-interpretation of thallus form and fruit body types in the molecular era. Mycol Res 111: 11161132.
  • Guzow-Krzemiñska B (2006) Photobiont flexibility in the lichen Protoparmeliopsis muralis as revealed by ITS rDNA analysis. Lichenologist 38: 469476.
  • Hall TA (1999) BioEdit: a user friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acid Symp Ser 41: 9598.
  • Hawksworth DL & Honegger R (1994) The lichen thallus: a symbiotic phenotype of nutritionally specialized fungi and its response to gall producers. Plant Galls. Organisms, Interactions, Populations. The Systematics Association Special Volume (WilliamsMAJ, ed), pp. 7798. Clarendon Press, Oxford.
  • Honegger R (1984) Cytological aspects of the mycobiont–phycobiont relationship in lichens. Haustorial types, phycobiont cell wall types, and the ultrastructure of the cell surface layers in some cultured and symbiotic mycobionts and phycobionts. Lichenologist 16: 111127.
  • Honegger R (1991) Functional aspects of the lichen symbiosis. Annu Rev Plant Phys 42: 553578.
  • Honegger R (1993) A simple outdoor culturing system for the foliose macrolichens Xanthoria parietina (L.) Th. Fr. and Parmelia sulcata Taylor. Bot Helv 103: 223229.
  • Honegger R & Brunner U (1981) Sporopollenin in the cell walls of Coccomyxa and Myrmecia phycobionts of various lichens: an ultrastructural and chemical investigation. Can J Botany 59: 27132734.
  • Huelsenbeck JP & Ronquist F (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 15721574.
  • Jaag O (1931) Morphologische und physiologische Untersuchungen über die zur Gattung Coccomyxa gehörenden Flechtengonidien. Verh Schwei Nat Gesell 1931: 331332.
  • Joneson S & Lutzoni F (2009) Compatibility and thigmotropism in the lichen symbiosis: a reappraisal. Symbiosis 47: 109115.
  • Karnovsky MJ (1965) A formaldehyde–glutaraldehyde fixative of high osmolarity for use in electron microscopy. J Cell Biol 27: 137A138A.
  • Karsten U, Friedl T, Schumann R, Hoyer K & Lembcke S (2005) Mycosporine-like amino acids and phylogenies in green algae: Prasiola and its relatives from the Trebouxiophyceae (Chlorophyta). J Phycol 41: 557566.
  • Kohlmeyer J, Hawksworth DL & Volkmann-Kohlmeyer B (2004) Observation of two marine and maritime ‘borderline’ lichens: Mastodia tesellata and Collemopsidium pelvetiae. Mycol Prog 3: 5156.
  • Kroken S & Taylor JW (2000) Phylogenetic species, reproductive mode, and specificity of the green alga Trebouxia forming lichens with the fungal genus Letharia. Bryologist 103: 645660.
  • Kroken S & Taylor JW (2001) A gene genealogical approach to recognize phylogenetic species boundaries in the lichenzed fungus Letharia. Mycologia 93: 3853.
  • Lilly VG & Barnett HL (1951) Physiology of Fungi. McGraw-Hill, New York.
  • Lumbsch HT & Papong K (2009) Ocellularia gyrostomoides belongs to the genus Schizoxylon (Stictidaceae, Ascomycota). Mycotaxon 109: 319322.
  • Lumbsch HT, Schmitt I, Palice Z, Wiklund E, Ekman S & Wedin M (2004) Supraordinal phylogenetic relationships of Lecanoromycetes based on a Bayesian analysis of combined nuclear and mitochondrial sequences. Mol Phylogenet Evol 31: 822832.
  • Lumbsch HT, Schmitt I, Wiklund E & Wedin M (2007) The phylogenetic placement of Ostropales within Lecanoromycetes (Ascomycota) revisited. Mycol Res 111: 257267.
  • Lutzoni F & Pagel M (1997) Accelerated evolution as a consequence of transitions to mutualism. Proc Nat Acad Sci 94: 1142211427.
  • Myllys L, Lohtander K & Tehler A (2001) Beta-tubulin, ITS and group I intron sequences challenge the species pair concept in Physcia aipolia and P. caesia. Mycologia 93: 335343.
  • Nozaki H, Ito M, Sano R, Uchida H, Watanabe MM & Kuroiwa T (1995) Phylogenetic relationships within the colonial Volvocales (Chlorophyta) inferred from rbcL gene sequence data. J Phycol 31: 970979.
  • Ott S (1987) The juvenile development of lichen thalli from vegetative diaspores. Symbiosis 3: 5774.
  • Page RDM (1996) TREEVIEW: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12: 357358.
  • Plessl A (1963) Über die Beziehungen von Haustorienstypus and Organisationshohe bei Flechten. Österr Bot Z 110: 19941269.
  • Posada D & Crandall KA (1998) Modeltest – testing the model of DNA substitution. Boinformatics 14: 817818.
  • Rambaut A & Drummond A (2004) Tracer 1.4. Available from (Accessed February 2010).
  • Rodriguez F, Oliver JL, Marin A & Medina JR (1990) The general stochastic model of nucleotide substitution. J Theor Biol 142: 485501.
  • Rodríguez F, Feist SW, Guillou L, Harkestad LS, Bateman K, Renault T & Mortensen S (2008) Phylogenetic and morphological characterisation of the green algae infesting blue mussel Mytilus edulis in the North and South Atlantic oceans. Dis Aquat Organ 81: 231240.
  • Ronquist F, Huelsenbeck JP & van der Mark P (2005) MyBayes 3.1 Manual. Available from (Accessed June 2009).
  • Schaper T & Ott S (2003) Photobiont selectivity and interspecific interactions in lichen communities. I. Culture experiments with the mycobiont Fulgensia bracteata. Plant Biology 5: 441450.
  • Sherwood MA (1977a) The ostropalean fungi. Mycotaxon 5: 1277.
  • Sherwood MA (1977b) The ostropalean fungi II: Schizoxylon, with notes on Stictis, Acarosporina, Coccopeziza, and Carestiella. Mycotaxon 6: 215260.
  • Stocker-Wörgötter E (1995) Experimental cultivation of lichens and lichen symbionts. Can J Botany 73: S579S589.
  • Stocker-Wörgötter E (2001) Experimental lichenology and microbiology of lichens: culture experiments, secondary chemistry of cultured mycobionts, resynthesis, and thallus morphogenesis. Bryologist 104: 576581.
  • Stocker-Wörgötter E (2002) Investigating the production of secondary compounds in cultured lichen mycobionts. Protocol in Lichenology, Culturing Biochemistry, Ecophysiology and Use in Biomonitoring (KannerI, BeckettRP & VarmaAK, eds), pp. 296306. Springer, Berlin, Germany.
  • Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS & Fisher MC (2000) Phylogenetic species recognition and species concepts in fungi. Fungal Genet Biol 31: 2132.
  • Templeton AR, Crandall KA & Sing CF (1992) A cladistic analysis of phenotypic associations with haplotype inferred from restriction endonuclease mapping and DNA sequence data. III. Cladogram estimation. Genetics 132: 619633.
  • Tremouillaux-Guiller J & Huss VA (2007) A cryptic intracellular green alga in Ginkgo biloba: ribosomal DNA markers reveal worldwide distribution. Planta 226: 553557.
  • Tschermak-Woess E (1988) The algal partner. Handbook of Lichenology, Vol. I (GalunM, ed), pp. 3991. CRC Press Inc., Boca Raton, FL.
  • Wedin M, Döring H & Gilenstam G (2004) Saprotrophy and lichenization as options for the same fungal species on different substrata: environmental plasticity and fungal lifestyles in the Stictis–Conotrema complex. New Phytol 164: 459465.
  • Wedin M, Döring H, Könberg K & Gilenstam G (2005a) Generic delimitations in the family Stictidaceae (Ostropales, Ascomycota) – the StictisConotrema problem. Lichenologist 37: 6775.
  • Wedin M, Wiklund E, Crewe A, Döring H, Ekman S, Nyberg Å, Schmitt I & Lumbsch T (2005b) Phylogenetic relationships of the Lecanoromycetes (Ascomycota) as revealed by analyses of mtSSU and nLSU rDNA sequence data. Mycol Res 109: 159172.
  • Wedin M, Döring H & Gilenstam G (2006) Stictis s. lat. (Ostropales, Ascomycota) in northern Scandinavia, with a key and notes on morphological variation in relation to lifestyle. Mycol Res 110: 773789.
  • Wedin M, Westberg M, Crewe AT, Tehler A & Purvis OW (2009) Species-delimitation and evolution of mineral bioaccumulation in the lichenized Acarospora smaragdula (Ascomycota, Fungi) complex. Cladistics 25: 161172.
  • White TJ, Burns TD, Lee S & Taylor J (1990) Amplification and direct sequencing of fungal ribosomal DNA genes for phylogenies. PCR Protocols, a Guide to Methods and Applications (InnisMA, GelfandDH, SniskyJJ & WhiteTJ, eds), pp. 315322. Academic Press, San Diego.
  • Yamamoto Y, Kinoshita Y & Yoshimura I (2002) Culture of thallus fragments and re-differentiation of lichens. Protocol in Lichenology, Culturing Biochemistry, Ecophysiology and Use in Biomonitoring (KrannerI, BeckettRP & VarmaAK, eds), pp. 3446. Springer, Berlin, Germany.
  • Zoller S & Lutzoni F (2003) Slow algae, fast fungi: exceptionally high nucleotide substitution rate differences between lichenized fungi Omphalina and their symbiotic green algae Coccomyxa. Mol Phylogenet Evol 29: 629640.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References
  10. Supporting Information

Fig. S1. Schematic representation of the phylogenetic inferences obtained for each fungal marker: β-tubulin (a), GPD (b), and ITS (c).

Table S1. Estimation of haplotype diversity in the β-tubulin, GPD, and ITS loci in Schizoxylon albescens.

Table S2. Co-culture experiments of Schizoxylon albescens and algal strains.

Please note: Wiley-Blackwell is not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

FEM_1002_sm_suppinfo.doc121KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.