SEARCH

SEARCH BY CITATION

Keywords:

  • bacterial community;
  • DGGE;
  • quantitative PCR;
  • Wolbachia

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Symbiotic bacteria are known to play important roles in the biology of insects, but the current knowledge of bacterial communities associated with mosquitoes is very limited and consequently their contribution to host behaviors is mostly unknown. In this study, we explored the composition and diversity of mosquito-associated bacteria in relation with mosquitoes' habitats. Wild Aedes albopictus and Aedes aegypti were collected in three different geographic regions of Madagascar. Culturing methods and denaturing gradient gel electrophoresis (DGGE) and sequencing of the rrs amplicons revealed that Proteobacteria and Firmicutes were the major phyla. Isolated bacterial genera were dominated by Bacillus, followed by Acinetobacter, Agrobacterium and Enterobacter. Common DGGE bands belonged to Acinetobacter, Asaia, Delftia, Pseudomonas, Enterobacteriaceae and an uncultured Gammaproteobacterium. Double infection by maternally inherited Wolbachia pipientis prevailed in 98% of males (n=272) and 99% of females (n=413); few individuals were found to be monoinfected with Wolbachia wAlbB strain. Bacterial diversity (Shannon–Weaver and Simpson indices) differed significantly per habitat whereas evenness (Pielou index) was similar. Overall, the bacterial composition and diversity were influenced both by the sex of individuals and by the environment inhabited by the mosquitoes; the latter might be related to both the vegetation and the animal host populations that Aedes used as food sources.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

All arthropod pests and vectors harbor a number of commensal and mutualistic microorganisms that have an impact on the ecology and behavior of their hosts (Buchner, 1965; Moran et al., 2008; Moya et al., 2008). Indeed, it is well-known that microbial communities associated with insects can contribute to host reproduction and survival, community interactions, protection against natural enemies and vectorial competence (Buchner, 1965; Moran et al., 2008; Moya et al., 2008; Gottlieb et al., 2010; Oliver et al., 2010). However, such extended phenotypes were mostly shown in phytophagous arthropods, whereas research on hematophagous insects has been limited. Historically, this unawareness was partly due to the lack of data on the composition of native bacterial communities associated with the later group of insects. A few studies have, however, reported a number of bacterial species in some medically important hematophagous insects. A relevant example is the tsetse fly Glossina, which harbors the secondary symbiont Sodalis glossidinius, suspected to enhance vectorial competence (Cheng & Aksoy, 1999; Aksoy & Rio, 2005; Farikou et al., 2010). More recently, bacteria belonging to genera Enterobacter, Enterococcus and Acinetobacter were isolated in Glossina palpalis palpalis, but their role in the tsetse fly biology remains to be determined (Geiger et al., 2009).

Mosquitoes are vectors of a large number of animal and human pathogens, including parasites and viruses. During the last few years, Madagascar and other neighboring islands have experienced severe epidemics of arboviruses, notably chikungunya and dengue. The species Aedes albopictus and Aedes aegypti have expanded over the Indian Ocean Islands (Fontenille & Rodhain, 1989; Salvan & Mouchet, 1994; Delatte et al., 2008; Sang et al., 2008; Bagny et al., 2009a, b) and have been identified as the primary vectors responsible for these outbreaks (Schuffenecker et al., 2006; Vazeille et al., 2007; Delatte et al., 2008; Ratsitorahina et al., 2008; Sang et al., 2008). As for all insects, the successful spreading of mosquitoes worldwide might be partly linked to their symbiosis with microorganisms, notably with bacteria. However, little is known about the current composition of mosquito-associated microbial communities, and consequently, their potential contribution to the host behaviors is mostly ignored. Investigations have been performed to screen bacterial communities in mosquitoes reared under laboratory conditions or collected in the fields, using culture and nonculture methods. These studies have focused mainly on the gut microbial communities of two mosquitoes, Anopheles and Culex, and these revealed the presence of diverse bacterial groups including known genera such as Acinetobacter, Aeromonas, Asaia, Bacillus, Enterobacter, Flavobacterium, Lactoccocus, Pantoea, Pseudomonas, Microbacterium, Staphylococcus and Stenotrophomas (Pumpuni et al., 1996; Straif et al., 1998; Pidiyar et al., 2004; Favia et al., 2007; Terenius et al., 2008; Rani et al., 2009). These surveys highlighted that the relative abundance and the composition of mosquito-associated bacteria varied depending on the developmental stages and laboratory-reared or wild targeted populations. For Aedes mosquitoes, Demaio et al. (1996) reported the occurrence of cultivable bacteria belonging to Enterobacter, Klebsiella, Pseudomonas and Serratia in the midgut of wild Aedes triseriatus. Most recently, this inventory was extended to Acinetobacter, Asaia, Bacillus, Comamonas, Delftia, Pantoea and Wolbachia detected in A. aegypti or A. albopictus, reared in insectaries (Gusmao et al., 2007, 2010; Crotti et al., 2009; Zouache et al., 2009b).

The aim of this study was to survey the composition of bacterial communities associated with wild Aedes mosquitoes and to explore whether the bacterial diversity is related to host ecology. To that end, we used culture and nonculture methods to describe the bacterial composition and diversity of A. albopictus and A. aegypti, males and females, caught from ecologically contrasted regions of Madagascar.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Location and characteristics of survey areas

The sampling regions were selected for their different ecoclimatic characteristics (Table 1) and because they were sites of chikungunya or/and dengue epidemics (Ratsitorahina et al., 2008; Randrianasolo et al., 2010), although no such virus infection was detected in the sampled population (data not shown). Vegetation and animals of the sampling sites are reported in Table 1.

Table 1.   Ecological characteristics of mosquito Aedes sp. capture sites
RegionSiteZonePotentially bitten hostsVegetationA. albopictus*A. aegypti*
FemaleMaleFemaleMale
  • *

    Numbers of individuals collected at each site between February and May 2008.

AnalamangaAmbohidratrimoVillage outskirtsHumans, birds, reptilesBamboo hedge1373500
Tsimbazaza ParkCityHumans, lemurs, reptiles, birdsBamboo, bushes8236200
AnkazobeVillage outskirtsHumans, chickensBamboo forest939500
BoenyMahajanga TownCityHumans, ovine (sheep), bovine (zebu)Fruit trees, bushes2902000
AndranofasikaVillageHumans, birdsMango trees00107
AnkarafantsikaNatural reserveHumans, lemurs, birds, reptilesForest0035
AtsinananaToamasina TownCityHumans, chickens, ducksFruit trees, bamboo hedge, bushes3203000

The Analamanga region (Tsimbazaza Park, Ambohidratrimo and Ankazobe) is located in the centre of Madagascar at an altitude of 1200–1500 m. This region has a highland climate with two seasons: a hot and rainy period from October to March (21 °C average and about 200 mm of precipitation per month), followed by a cold and dry period (with temperatures down to 10 °C and rainfall not exceeding 20 mm month−1). The mean relative humidity in this region is high (77.5% in 2008). The Zoological and Botanic Park of Tsimbazaza is located in the centre of Antananarivo town at 1250 m altitude. Ambohidratrimo Hill is located 25 km to the northwest of Antananarivo with an altitude of 1300 m. Ankazobe is 80 km from the northern limits of Antananarivo at 1500 m altitude. This site is transitional, connecting the central and the western regions. It is surrounded by the nature reserve of Ambohitantely. The climate is wetter and colder than the other towns in the centre.

The Atsinanana region (Toamasina) is on the east cost of Madagascar at sea level. The climate is particularly hot and humid: the mean annual rainfall is about 3200 mm with rain all year, the mean annual temperature is 25 °C with a minimum of 18 °C from June to August, and relative humidity is around 87% all year.

The Boeny region (Mahajanga, Andranofasika and Ankarafantsika natural reserve) has an arid tropical climate characterized by a warm summer (mean temperature of 27 °C) with moderate rainfall (mean precipitation is about 400 mm year−1) and high relative humidity (81%) from November to March. Mahajanga is in the northwest of Madagascar, 600 km from Antananarivo in Edge Sea at a 22 m altitude. There are mango trees, bushes and flowers near dwellings in the town. The Andranofasika village is about 110 km from Mahajanga town and 5 km from the National Park of Ankarafantsika.

Mosquito collection

Mosquitoes were collected between February and May 2008. Two methods were used to capture adult mosquitoes: during peaks of biting activity, a tube was used to capture insects landing on the human body or nets were used to capture insects near the grass. Aedes specimens, males and females, were identified using morphological characteristic keys (Ravaonjanahary, 1978). Captured adults were separated according to species and sex and stored in tubes containing silica gel. For each tube, the species, date, location, geographical position, and type of site was recorded. Only nonblooded mosquitoes were used for the analysis.

Bacterial isolation

Only live mosquito specimens from the field were used. Individuals were anaesthetized at 4 °C, rinsed three times in sterile water, surface disinfected in 70% ethanol for 10 min and rinsed five times in sterile water and once in sterile 0.8% NaCl. Two adult mosquitoes per sample were crushed in 150 μL sterile 0.8% NaCl. Homogenates (10 μL) were streaked on plates of modified Luria–Bertani and PYC agar media (Zouache et al., 2009b). After incubation at 26 °C, single distinct colonies were reinoculated onto fresh agar plates of the corresponding medium. Colonies were streaked to check for purity and stored in 25% glycerol at −80 °C until use.

Genomic and plasmid DNA extractions

Mosquitoes were surface disinfected as described above, and then individually crushed in 200 μL of extraction buffer (2% hexadecyltrimethyl ammonium bromide, 1.4 M NaCl, 0.02 M EDTA, 0.1 M Tris pH 8, 0.2% 2-β-mercaptoethanol) heated to 60 °C. Homogenates were incubated for 15 min at 60 °C and proteins were extracted with chloroform : isoamyl alcohol (24 : 1, v/v). DNA was precipitated with isopropyl alcohol, pelleted by centrifugation for 15 min at 12 000 g, washed with 75% ethanol, dried and then dissolved in 30 μL of sterile water.

For bacterial isolates, genomic and plasmid DNA were extracted using the DNeasy Tissue Kit and QIAprep Spin Miniprep Kit, respectively (Qiagen, France).

Diagnostic PCR, amplified ribosomal DNA restriction analysis (ARDRA) and quantitative PCR amplification

Diagnostic PCR amplification was performed with primers listed in Table 2 using a T Gradient Thermocycler (Biometra, France). Reactions (25 or 50 μL volumes) contained genomic DNA template (1 μL), 200 μM of each dNTP, 500 nM of each primer, 0.025 mg mL−1 of T4 gene 32 protein (Roche, France) and 0.5 U of Expand polymerase in 1 × reaction buffer (Roche). PCR products were purified using QIAquick PCR Purification Kit (Qiagen). ARDRA was performed to screen the rrs genes of bacterial isolates in 20 μL reactions containing 200 ng of DNA, 1 × Buffer Tango and 10 U of each endonuclease RsaI and HhaI (Fermentas, France). DNA fragments were separated on 1% or 2% agarose gels stained with ethidium bromide.

Table 2.   Primers used in this study
SamplesGenePrimer namePrimer sequence (5′–3′)Amplicon size (bp)/Tm (°C)References
Organism
 BacteriarrspA5′AGAGTTTGATCCTGGCTCAG3′About 1500/55Bruce et al. (1992)
 pH5′AAGGAGGTGATCCAGCCGCA3′  
V3 region rrs16S (V3) 338F5′GCCGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCAGCAG3′About 200/55Muyzer et al. (1993)
 16S (V3) 520R5′ATTACCGCGGCTGCTGG3′  
 Wolbachiarrs99F5′TTGTAGCCTGCTATGGTATAACT3′864/52O'Neill et al. (1992)
 994R5′GAATAGGTATGATTTTCATGT3′  
wsp81F5′TGGTCCAATAAGTGATGAAGAAAC3′600/55Zhou et al. (1998)
 328F5′CCAGCAGATACTATTGCG3′379/52Zhou et al. (1998)
 183F5′AAGGAACCGAAGTTCATG3′501/52Zhou et al. (1998)
 691R5′AAAAATTAAACGCTACTCCA3′  
Plasmid     
 TOPO 2.1 M13F5′GTAAAACGACGGCCAG3′Variable/Variable 
 M13R5′CAGGAAACAGCTATGAC3′  
 pQuantAlbwsp A groupQAdir15′GGGTTGATGTTGAAGGAG3′264/60Tortosa et al. (2008)
 QArev25′CACCAGCTTTTACTTGACC3′  
wsp B group183F5′AAGGAACCGAAGTTCATG3′112/60Tortosa et al. (2008)
 QBrev25′AGTTGTGAGTAAAGTCCC3′  
actinActAlb-dir5′GCAAACGTGGTATCCTGAC3′139/60Tortosa et al. (2008)
 ActAlb-rev5′GTCAGGAGAACTGGGTGCT3′  

Real-time quantitative PCR was performed using the LightCycler apparatus (Roche). The 20-μL reaction mixture contained 1 × LightCycler DNA Master SYBR Green I (Roche), primers at 300 nM (for wsp) or 200 nM (for actin) (see Table 2) and 10 ng of template DNA. The amplification program was 10 min at 95 °C followed by 40 cycles of 15 s at 95 °C, 1 min at 60 °C and 30 s at 72 °C. Standard curves were constructed using a dilution series (101–108 molecules) of the pQuantAlb plasmid (Tortosa et al., 2008) containing wsp and actin fragments.

Denaturing gradient gel electrophoresis (DGGE)

Ingeny PhorU (Apollo Instruments, Compiègne, France) systems were used for DGGE analysis of the V3 PCR products as published (Zouache et al., 2009a). The 6% acrylamide gels contained a linear chemical gradient of urea and formamide from 35% to 65% urea and 40% deionized formamide (v/v). PCR products (2 μg) were run in 1 × TAE at 60 °C for 17 h at 100 V, and then gels were immersed in SYBR Green for 30 min, rinsed in distilled water and photographed under UV. Bands were excised, washed three times with sterilized water and then 30 μL of water was added to the tubes, which were heated to 60 °C for 30 min and kept overnight at 4 °C. The eluate (2 μL) was used for PCR amplification, and then amplicons were cloned and sequenced as described below.

Cloning and sequencing

PCR products were purified using the MinElute PCR Purification Kit (Qiagen), and cloned in the PCR®2.1-TOPO® vector according to the TOPO TA 2.1 Kit (Invitrogen, France). Clones containing DNA inserts were sequenced at Genoscreen (Lille, France). Sequences were analyzed with the blastn program at NCBI (http://www.ncbi.nlm.nih.gov/).

DGGE fingerprints and statistical analyses

Each band was considered as an operational taxonomic unit (OTU). Images acquired with Fisher Bioblock Scientific System (Fisher, Ilkirch, France) were analyzed using gelcompar II version 5.1 packages (Applied Maths, Kortrijk, Belgium). The software carries out a density profile analysis for each lane and calculates the relative contribution of each band to the total band intensity in the lane, with a reference pattern included in all gels. Relative intensity in the profile of each band or OTU (Pi) was calculated by the relative area under the peak in the profile (Pi=ni/N, where ni is the area under the peak i, and N is the sum of the areas for all peaks within the profile). The relative intensity of each band was used to calculate (primer v6 software) Shannon–Weaver (H′=−ΣPi log Pi where Pi=ni/N) and Simpson (1−λ′=1−{ΣiNi(Ni−1)}/{N(N−1)}) diversity indices. We estimated the evenness of the numbers of bacterial species in each sample using Pielou's index (J′=H′/logS, where logS=Hmax). Statistical analyses were performed using splus software and/or r packages.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Collection of mosquitoes and bioecology

To collect Aedes adult mosquitoes, larval development sites were used as indicators (Table 1). Larvae refuges of A. aegypti consisted of natural sites (holes in trees or rocks, wet leaves of bamboo or palm trees and coconuts) outside cities and villages, whereas larvae refuges of A. albopictus were natural and artificial sites (containers or flowerpots) near habitations. Adults were collected around these larvae breeding sites.

Both species were found to be exophilic (which do not enter inside habitations). Except for natural reserves of the Ankarafantsika and the Andranofasika villages, A. albopictus was predominant in all sites sampled (Table 1). Indeed, a total of 137 females and 35 males were caught in the neighborhood of the tourist attraction site of Ambohidratrimo, named ‘Le Palais des Rois’. In Tsimbazaza Park, the presence of bamboo, bushes and many animals creates a favorable environment for A. albopictus development; a total of 823 females and 62 males were captured in this site. In contrast, only 93 females and 95 males were trapped in Ankazobe that has a colder climate (Table 1). The rainy and hot climate throughout the year in Toamasina allows uninterrupted development of A. albopictus, but it was difficult to capture adults during the active rainy season: 320 females and 30 males were trapped in the town itself. The two Aedes species were found in the Boeny region, but in different sites (Table 1). Aedes albopictus was predominant in urban areas, with 290 females and 20 males. Aedes aegypti was the major species found in village (Andranofasika) and forest zones (Ankarafantsika), although few individuals were caught: 13 females and 12 males.

Cultivable bacteria

To search for cultivable bacteria in mosquitoes, insects originating from the Boeny region were chosen as the two species under study were both present in the area: A. albopictus at the Mahajanga site and A. aegypti at the Ankarafantsika site. For the two media used, 22 colony types were obtained from males and 10 from females of A. albopictus. Only four colony types were recovered from A. aegypti females. Two to four representatives of each colony type were used for genomic DNA extraction and PCR amplification of the rrs gene. ARDRA of entire rrs gene amplicons revealed a total of 13 distinct patterns (not shown). Sequencing of the rrs gene of each isolate and blastn analysis allowed identifying two phyla: Proteobacteria and Firmicutes (Table 3). Bacteria belonging to the genus Bacillus were present in all the specimens of both sexes and species. In addition, one isolate from an A. albopictus female was an Agrobacterium sp. whereas isolates of the genera Acinetobacter and Enterobacter were found in A. albopictus males. For all isolates, the sequence similarities were between 98% and 100% with respect to the rrs sequences of type strains reported in databases.

Table 3.   Phylogenetic affiliation of isolates and sequences obtained from Aedes sp.
Species (Sex)OriginName of isolatesSize (bp)Accession numberPhylogenetic affiliationMost closely related organismAccession numberSimilarity (%)
Aedes albopictusMahajangaKZ_Aal_F_Mm11477GU726172AlphaproteobacteriaAgrobacterium sp. JS71AY174112.11476/1477 (99)
(Female)(town)KZ_Aal_F_Mm21541GU726171FirmicutesBacillus sp. 41KBFJ615523.11538/1541 (99)
 KZ_Aal_F_Mm31544GU726173FirmicutesBacillus cereus strain : PDa-1AB247137.11541/1544 (99)
 KZ_Aal_F_Mm41540GU726174FirmicutesBacillus sp. NN106 1AJ973278.11531/1540 (99)
Aedes albopictusMahajangaKZ_Aal_M_Mm11543GU726176FirmicutesBacillus sp. No.49AB066347.11543/1543 (100)
(Male)(town)KZ_Aal_M_Mm21540GU726177FirmicutesBacillus sp. NN106 1AJ973278.11533/1540 (99)
 KZ_Aal_M_Mm31541GU726185FirmicutesBacillus sp. 41KBFJ615523.11540/1541 (99)
 KZ_Aal_M_Mm41532GU726178GammaproteobacteriaAcinetobacter sp. EH 28EU703817.11477/1483 (98)
 KZ_Aal_M_Mm51530GU726180GammaproteobacteriaAcinetobacter sp. SH-94BFN377701.11505/1512(99)
 KZ_Aal_M_Mm61530GU726181GammaproteobacteriaAcinetobacter johnsonii strain S35AB099655.11505/1532 (98)
 KZ_Aal_M_Mm71534GU726182GammaproteobacteriaEnterobacter sp. NJ-1AM396909.11491/1505 (99)
 KZ_Aal_M_Mm81534GU726183GammaproteobacteriaEnterobacter sp. Px6-4EF175731.11499/1503 (99)
 KZ_Aal_M_Mm91537GU726184GammaproteobacteriaEnterobacter cloacae isolate 766AM778415.11515/1534 (98)
Aedes aegyptiAnkarafantsikaKZ_Aae_F_Ma11544GU726175FirmicutesBacillus sp. G2DM-51DQ416786.11539/1544 (99)
(Female)Natural ReserveKZ_Aae_F_Ma21544GU726179FirmicutesBacillus megaterium strain MPF-906DQ660362.11540/1544 (99)

DGGE fingerprints and phylogenetic affiliation of bacterial sequences

To investigate the whole bacterial community of the two Aedes species, PCR-DGGE fingerprints of hypervariable V3 regions were produced. For each sampling site, females and five males (four males for A. aegypti) were analyzed individually. DGGE profiles varied between individuals of the same sex whether from the same site or not (Fig. 1). Banding patterns also differed between females and males of both A. albopictus and A. aegypti. To compare the DGGE profiles better, we analyzed them with gelcompar software and then by principal component analysis (PCA) using r software. In terms of the bacterial communities they host, females and males of A. albopictus from all collection sites are distinct, the first two axes explaining >43.8% of the total variability in PCA (Fig. 2).

image

Figure 1.  DGGE profiles of bacterial communities of Aedes albopictus (a–e) and Aedes aegypti (f) from different regions of Madagascar. W, Wolbachia strain wAlbB from the Aa23 cell line used as an internal gel migration control. L, ladder used as an external gel migration control. Numbers correspond to cloned and sequenced bands (Table 4).

Download figure to PowerPoint

image

Figure 2.  Principal component analysis (PCA) of male and female Aedes albopictus from the same collection site (a–d). F, females; M, males. (a) PCA of individuals from Ambohidratrimo. (b) PCA of individuals from Ankazobe. (c) PCA of individuals from Toamasina. (d) PCA of individuals from Tsimbazaza Park. Individuals are represented by dots. Individuals of the same sex are encircled. The percentage indicated within parentheses corresponds to the variance explained by each principal component.

Download figure to PowerPoint

To explore whether the mosquitoes' environment influences the bacteria they host, PCA was performed on the DGGE band profiles from males and females separately. For males (Fig. 3a and c), the type of vegetation (Table 1) may explain the differences because (1) individuals from urban areas (Mahajanga, Antananarivo and Toamasina) characterized by bushes and fruit trees are different from those from suburban areas (Ambohidratrimo and Ankazobe) surrounded by bamboo (PCA1, 17% of total variability); and (2) individuals from Ankazobe that is mainly a natural habitat are distinct from those from the touristic site of Ambohidratrimo (PCA3, 9.9% of variability). Although weaker (PCA3, 9.8% of total variability) for females, in addition to vegetation, differences between sites (Fig. 3b and c) can be linked to the hosts available to bite (Table 1). For instance, poultry were currently found in Toamasina and Ankazobe whereas Mahajanga is the only site where there is extensive ovine and bovine rearing. In contrast, Tzimbazaza Park is well-frequented by tourists and hosts a diverse range of vertebrates. In addition to humans, Ambohidratrimo may host natural fauna.

image

Figure 3.  Principal component analysis (PCA) of Aedes albopictus collected from different sites in Madagascar. Individuals are represented by dots. Individuals from the same collection site are encircled. Percentages correspond to the variance explained by each principal component (PC). (a) PCA of A. albopictus females. AmF, females from Ambohidratrimo (birds, reptiles); AnF, females from Ankazobe (poultry); MF, females from Mahajanga (ovine and bovine); PaF, females from Tsimbazaza Park (lemurs, birds and reptiles); TF, females from Toamasina (poultry). The two axes explain 17% (PC1) and 9.9% (PC3) of the total variability. (b) PCA of A. albopictus males. AmM, males from Ambohidratrimo (bamboo hedge); AnM, males from Ankazobe (bamboo forest); MM, males from Mahajanga; PaM, males from Tsimbazaza Park; TM, males from Toamasina (vegetation of the three cities corresponds to bushes and fruit trees). The two axes explained 9.8% (PC3) and 8.2% (PC4) of the total variability. (c) Map of Madagascar showing sites of Aedes collection. The abbreviations used in the map, after names of collection sites, correspond to those used in PCA panels.

Download figure to PowerPoint

To identify the bacterial community in these mosquito samples, representative DGGE bands were excised from the gel, cloned and sequenced as numbered in Fig. 1. The V3 fragment size obtained varies from 165 to 196 bp, giving only an indication of bacterial phylogenetic affiliation. blast analyses indicated that sequences belonged to Bacteroidetes (2.6% of the sequenced bands), Firmicutes (10.5%) and Proteobacteria (86.9%). At the genus level, sequences were affiliated mostly with Acinetobacter, Asaia, Pseudomonas and an uncultured Gammaproteobacterium (Table 4). Some other bacteria detected included the genera Bradyrhizobium sp., Delftia sp., Herbaspirillum sp., Rhizhobium sp. and Stenotrophomonas sp. as well as members of the Enterobacteriaceae (uncultured Citrobacter sp., Enterobacter sp., Pantoea sp., Shigella sp. and Yokenella sp.). An uncultured Streptococcaceae bacterium and members of the genus Staphylococcus were also identified (Table 4). As expected, sequences of the control bands corresponding to Wolbachia V3 amplicons were seen exclusively in A. albopictus (Fig. 1a–f).

Table 4.   Phylogenetic affiliation of sequences obtained from Aedes sp. in DGGE analysis
Mosquito speciesBandsSize (bp)Accession numberPhylogenetic affiliationMost closely related organismAccession numberSimilarity (%)
Aedes albopictus1; 3; 4; 8a; 42a; 43a195GU985109GammaproteobacteriaAcinetobacter genomosp. 3 strain bpoe135FN563421.1195/195 (100)
2; 7a194GU985110GammaproteobacteriaPseudomonas putida strain S5AB512773.1194/194 (100)
5; 6; 7b195GU985111GammaproteobacteriaPseudomonas sp. XL-NAGU290043.1195/195 (100)
8b194GU985112GammaproteobacteriaPantoea agglomerans strain 14GQ494018.1191/194 (98)
8c194GU985113GammaproteobacteriaStenotrophomonas maltophilia strain Y1GQ268318.1194/194 (100)
9a; 44a194GU985114GammaproteobacteriaUncultured Citrobacter sp. clone GASP-WA1W3_F04AB485746.1193/194 (99)
9b; 11a; 12; 13194GU985115GammaproteobacteriaYokenella regensburgeiAB519797.1194/194 (100)
10a194GU985116GammaproteobacteriaUncultured Citrobacter sp. clone GASP-WA1W3_F04AB485746.1194/194 (100)
10b; 22; 25a; 38; 39169GU985117AlphaproteobacteriaAsaia sp. T-694AB485746.1169/169 (100)
11b165GU985119AlphaproteobacteriaAsaia sp. T-694AB485746.1165/165 (100)
11c194GU985120GammaproteobacteriaPseudomonas sp. XL-NAGU290043.1191/194 (98)
14a; 15a; 45c; 47194GU985121BetaproteobacteriaDelftia sp. LP2MMGU272362.1194/194 (100)
14b169GU985122AlphaproteobacteriaUncultured Bradyrhizobium sp. clone PSB011.C21 G01GU300452.1169/169 (100)
14c195GU985123FirmicutesUncultured Streptococcaceae bacterium clone Cat008D_G01AEU5725351.1195/195 (100)
15b194GU985124BetaproteobacteriaDelftia sp. LP2MMGU272362.1193/194 (99)
16a; 21168GU985125AlphaproteobacteriaAsaia sp. T-694AB485746.1168/168 (100)
16b194GU985126GammaproteobacteriaShigella flexneri 2002017CP001383.1194/194 (100)
17; 18; 24; 26; 27; 32-35194GU985127GammaproteobacteriaUncultured bacterium clone 100p7FJ934840.1194/194 (100)
19; 20; 29; 30; 36; 37; 40; 41169GU985150AlphaproteobacteriaWolbachia pipientis (host Aedes albopictus)X61767169/169 (100)
23194GU985129FirmicutesUncultured bacterium clone FFCH17137EU134660.1182/196 (92)
25b171GU985131AlphaproteobacteriaRickettsia endosymbiont of Hemiclepsis marginataFJ562342.1171/171 (100)
28a169GU985132AlphaproteobacteriaUncultured Rhizobium sp. clone PSB011.C21GU300273.1169/169 (100)
28b189GU985133BacteroidetesUncultured bacterium clone AFYEL_aaj68h06EU465158.1182/190 (95)
31194GU985134BetaproteobacteriaHerbaspirillum sp. AU13533EU549851.1186/194 (95)
42c; 43c194GU985135FirmicutesStaphylococcus sp. NT15I3.2BGQ365194.1194/194 (100)
44b194GU985136GammaproteobacteriaEnterobacter sp. GA47-2GQ114854.1193/194 (99)
45a; 46; 49b194GU985137GammaproteobacteriaPseudomonas sp. XL-NAGU290043.1193/194 (99)
45b194GU985138GammaproteobacteriaUncultured Citrobacter sp. clone GASP-WA1W3_F04AB485746.1191/194 (98)
48a194GU985139GammaproteobacteriaUncultured Citrobacter sp. clone GASP-WA1W3_F04AB485746.1192/194 (98)
48b194GU985140BetaproteobacteriaDelftia sp. LP2MMGU272362.1192/194 (98)
49a194GU985141GammaproteobacteriaEnterobacter sp. GA47-2GQ114854.1194/194 (100)
 189GU985142GammaproteobacteriaEnterobacter sp. GA47-2GQ114854.1189/189 (100)
Aedes aegypti50195GU985143GammaproteobacteriaAcinetobacter genomosp. 13TU strain BL Ac12FJ860871.1194/195 (99)
51194GU985144FirmicutesStaphylococcus saprophyticus strain YSY1-8GU197539.1194/195 (99)
52; 54194GU985145GammaproteobacteriaPseudomonas sp. ND6AY589689.1189/194 (97)
53194GU985146GammaproteobacteriaAcinetobacter sp. CCGE2017EU867306.1193/196 (98)
55a194GU985147GammaproteobacteriaEnterobacter sp. DgG7FJ599777.1194/194 (100)
55b194GU985148GammaproteobacteriaPseudomonas sp. PRB5GU223119.1194/194 (100)
56a194GU985149GammaproteobacteriaPseudomonas sp. YM-M-129GU220065.1194/194 (100)
57; 58169GU985118AlphaproteobacteriaAsaia sp. T-694AB485746.1169/169 (100)
59194GU985130FirmicutesUncultured bacterium clone FFCH17137EU134660.1182/196 (92)
60194GU985128GammaproteobacteriaUncultured bacterium clone 100p7FJ934840.1194/194 (100)

Bacterial diversity analysis

We evaluated the bacterial diversity and evenness in A. Albopictus from the different sampling sites. Considering all the sampling sites, the Shannon–Weaver (H′) index varied from 1.16 to 2.45 and the Simpson diversity (1−λ′) index varied from 0.63 to 0.89. The Pielou's index (J′) was between 0.80 and 0.86 (Table 5). Statistical analyses for all indices showed that there was a significant difference (P<0.01, Tukey) linked to the sex for individuals from Tsimbazaza Park only. In addition, Shannon–Weaver and Simpson diversity indices varied between sampling sites. In particular, significant differences (P<0.01, Tukey) were found between samples from Ankazobe, Mahajanga and Tsimbazaza Park. The regions Ambohidratrimo and Toamasina had intermediary values (Table 5). No differences in evenness between sampling sites were observed with Pielou's index.

Table 5.   Diversity indices and evenness values of Aedes albopictus
LocationSexH*1−λ′J
  • Values are mean values ± SEs.

  • *

    Shannon–Weaver diversity index (H′=−ΣPi log PiN).

  • Simpson diversity index (1−λ′=1−{ΣiNi (Ni−1)}{N (N−1)}).

  • Estimation of the evenness of the number of bacterial species in each sample.

  • Pielou's index (J′=H′/log where logS=Hmax).

MahajangaF1.82 ± 0.530.78 ± 0.130.81 ± 0.01
M1.54 ± 0.300.73 ± 0.100.81 ± 0.07
AmbohidratrimoF1.97 ± 0.240.83 ± 0.040.84 ± 0.02
M2.04 ± 0.080.85 ± 0.010.86 ± 0.04
AnkazobeF2.07 ± 0.120.84 ± 0.030.83 ± 0.04
M2.45 ± 0.240.89 ± 0.030.86 ± 0.02
ToamasinaF1.89 ± 0.340.80 ± 0.070.80 ± 0.04
M1.97 ± 0.140.83 ± 0.030.86 ± 0.07
Tsimbazaza ParkF1.16 ± 0.470.63 ± 0.010.76 ± 0.07
M1.95 ± 0.330.82 ± 0.070.83 ± 0.04

Wolbachia prevalence and density in A. albopictus

Usually, A. albopictus harbors two Wolbachia strains named wAlbA and wAlbB (Sinkins et al., 1995). Diagnostic PCR using wsp primers against the subset (685 of a total of 1905) of wild A. albopictus revealed double infection in 99% females (n=413) and 98% males (n=272); four females and six males found were singly infected with wAlbB strain (not shown).

Wolbachia's density was estimated by quantitative PCR targeting the wsp gene with primers designed to be strain specific toward wAlbA and wAlbB strains and the host gene encoding the cytoskeleton protein actin (Table 2). The relative numbers of bacterial genes per host gene are given as the copy number ratio of Wolbachia wsp to host actin. Overall, the relative numbers of the wAlbA strain varied from 0 to 5.19 per female (Fig. 4) and from 0 to 1.67 × 10−2 per male (Supporting Information, Fig. S1). The wAlbB density was also extremely variable, between 4.56 × 10−4 and 5.16 per female (Fig. 4) and from 9.42 × 10−3 to 1.16 per male (Fig. S2). In general, Wolbachia strains wAlbA and wAlbB were significantly (P<0.05, Tukey) more abundant in females than in males. Interestingly, Wolbachia's density in females varied depending on either the bacterial strains present or the mosquitoes' geographical origin (Fig. 4). The relative density of strain wAlbA was significantly higher (P<0.05, Tukey) than that of wAlbB in females from Tsimbazaza Park only. The densities of each Wolbachia strain in females were compared between sampling sites. Results indicated that wAlbA strain was more abundant (P<0.05, Tukey) in Tsimbazaza Park than in Mahajanga, whereas wAlbB strain predominated (P<0.05) in Ambohidratrimo compared with Mahajanga and Tsimbazaza Park. Differences in Wolbachia densities in males were not statistically significant between sites, probably due to a high interindividual variability.

image

Figure 4.  Relative density of Wolbachia in Aedes albopictus females from different sites in Madagascar. The relative numbers of Wolbachia are given as the copy number ratio of wsp to host actin. wAlbA (black) and wAlbB (grey) strains were measured in five female individuals per sampling site. Bars indicate SEs.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Our data illustrate the current distribution and preferential habitats of A. albopictus and A. aegypti, two major mosquito vectors of arbovirus, in seven localities of Madagascar (Table 1 and Fig. 3c). Aedes albopictus was found to be predominant in urban and suburban areas, whereas A. aegypti specimens were exclusively recovered in sylvan habitats showing weakly anthropophilic behavior (Table 1). In contrast to previous reports showing a high prevalence of A. aegypti in Mahajanga (Ravaonjanahary, 1978; Fontenille & Rodhain, 1989), we noted the current dominance of A. albopictus in this region. These data are in line with what is known on the undercurrent expansion of A. albopictus in Indian Ocean Islands and worldwide, affecting the density of sister taxon A. aegypti concomitantly (Salvan & Mouchet, 1994; O'Meara et al., 1995; Delatte et al., 2008; Bagny et al., 2009a, b, c; Paupy et al., 2010).

To examine whether the environment inhabited by the mosquitoes influenced the diversity of bacterial communities associated with wild mosquitoes, DGGE analysis was performed. Profiles varied between individuals and capture sites. This variation could be linked to environmental features, suggesting that some bacterial species that colonize mosquitoes may originate from the environment. Thus, vegetation used as food sources or resting and potential hosts for biting appear to be factors influencing the bacterial community associated with A. albopictus and A. aegypti. Bacterial communities associated with mosquitoes were mainly studied from laboratory-reared populations, which may not reflect those of wild populations. Indeed, it was shown that field-caught Anopheles mosquitoes harbor a greater bacterial diversity than laboratory populations (Rani et al., 2009). Studies on other insects such as the ground beetle Poecilus chalcites have also shown a higher bacterial diversity in wild populations in comparison with those from laboratories (Lehman et al., 2009). In addition, it was demonstrated that either nutrition regime or breeding technique could affect the composition of insects' commensal microbial community (Rani et al., 2009; Zouache et al., 2009a). Conversely, the bacterial populations can influence the behavior and the biology of insect hosts as well (Tsuchida et al., 2004; Moran & Degnan, 2006). Generally, such extended phenotypes issuing from these reciprocal interactions are evidenced in symbioses between insects and their vertically transmitted endosymbiotic bacteria (Buchner, 1965; Moran et al., 2008). Actually, only a few bacterial symbionts horizontally acquired from the environment have been shown to significantly impact the insects' fitness. This is the case of the heteropteran stinkbug Riptortus clavatus which acquires the beneficial gut bacterial symbiont Burkolderia from the environment in each generation (Kikuchi et al., 2007). Other examples consist of gut microbiota that may contribute to nutrition and detoxification of some insects such as termites and the beetle Tenebrio molitor (Genta et al., 2006; Warnecke et al., 2007), or provide protection against pathogens in Lepidoptera or desert locust (Dillon & Charnley, 2002; Raymond et al., 2008, 2009), albeit the environmental origin of these microbiota was not clearly established. Altogether, these studies highlighted the importance of taking into account environmental factors such as ecological niches when analyzing symbiotic microbiota associated with wild animal populations. Whether the bacterial communities found here may contribute to adaptive behavior and successful invasion of A. albopictus is under investigation.

At the genus level, several bacteria detected in this study are commonly described in soil and some have been found in hematophagous species of Culicidae, including A. triseriatus (Demaio et al., 1996), Culicoides sonorensis (Campbell et al., 2004), Culex quinquefasciatus (Pidiyar et al., 2004), Anopheles darlingi (Terenius et al., 2008), Anopheles gambiae (Dong et al., 2009), A. albopictus (Zouache et al., 2009b) and A. aegypti (Gusmao et al., 2007, 2010; Crotti et al., 2009). Intriguingly, three genera, Acinetobacter, Asaia and Pseudomonas, that are known to contain cultivable species were constantly found in the two species studied here. This suggests either a continuous acquisition through the environment or a vertical inheritance through generations. Interestingly, the genus Asaia was previously found in laboratory-reared Anopheles stephensi and A. aegypti, as well as in wild A. gambiae where it was demonstrated to be transmitted vertically (Favia et al., 2007; Crotti et al., 2009; Damiani et al., 2010). Our results are the first description of Asaia sp. in natural populations of both A. albopictus and A. aegypti. The ability of Asaia to be inherited both paternally and maternally is attracting attention as a potential candidate for blocking transmission of mosquito-borne pathogens through paratransgenesis (Favia et al., 2008). Functions have been suggested for some of the other bacterial genera isolated here. The genus Bacillus may probably be involved in cellulose and hemicellulose degradation in termites (reviewed in Konig, 2006). Members of the Enterobacteriaceae family are thought to provide an additional nitrogen source to the fruit fly Ceratitis capitata (Behar et al., 2005). A recent study has shown that an Acinetobacter sp. strain is able to inhibit a tobacco mosaic virus by producing an antiviral compound (Lee et al., 2009). Many other groups of bacteria detected for the first time in mosquitoes perform unknown functions. A better knowledge of the mosquito-associated bacteria will allow investigating their role in the host biology.

Usually, natural populations of A. albopictus have been found singly or doubly infected with Wolbachia (Kittayapong et al., 2000, 2002; Tortosa et al., 2010). When associated with A. albopictus, Wolbachia manipulates the reproduction of its host, inducing a density-dependent cytoplasmic incompatibility phenomenon, which increases the proportion of infected individuals in the population (Sinkins et al., 1995; Dobson et al., 2001). Interestingly, Wolbachia was recently demonstrated to inhibit mosquito-borne pathogens in some circumstances (Moreira et al., 2009; Bian et al., 2010; Glaser & Meola, 2010). Here, the survey of Wolbachia in A. albopictus wild populations revealed a high rate of double infection by Wolbachia wAlbA and wAlbB strains in both sexes. The densities of the two Wolbachia strains varied depending on the sex and the sampling region. These results are in accordance with previous data on high variability in Wolbachia densities in field populations (Ahantarig et al., 2008; Unckless et al., 2009). A few cases of single infection by wAlbB were also detected both in males and in females (Fig. 4). Loss of wAlbA strain in A. albopictus males' aging in the laboratory was recently reported in previously doubly infected populations from the Reunion island (Tortosa et al., 2010). Surprisingly, a different pattern was found in field populations of A. albopictus from Thailand, where single infection consists of either Wolbachia wAlbA or wAlbB strains (Kittayapong et al., 2000; Ahantarig et al., 2008), suggesting that different factors may account for the prevalence of Wolbachia in this mosquito species, which in turn could potentially interfere with the extended population phenotype.

In conclusion, the results presented here highlight the link between the habitats and the bacterial diversity of wild mosquitoes. As pathogens transmitted by mosquitoes coexist with associated bacteria that can affect insect population dynamics and vectorial competence, characterizing the bacterial composition and diversity of A. albopictus and A. aegypti in their environment is a step forward in understanding the ecology and the multipartite interactions occurring in these two major vectors of arbovirus.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

This paper is dedicated to the memory of Dr Jesus Caballero-Mellado (Centro de Ciencia Genómica, Cuernavaca, Morelos, Mexico) who left us in October 2010. We are grateful to Madagascar National Parks (formerly ANGAP) for authorizing collection of wild mosquitoes and to Biofidal-DTAMB Laboratory of IFR41 in University Lyon 1 for technical assistance. K.Z. was supported by PhD fellowships from the French Ministère de l'Education Nationale, de la Recherche et des Nouvelles Technologies. F.N.R. was supported by the Fondation pour la Recherche sur la Biodiversité (FRB, formerly IFB). This work was funded by grants ANR-06-SEST07 and FRB-CD-AOOI-07-012, and was carried out within the frameworks of GDRI ‘Biodiversité et Développement Durable à Madagascar’ and COST action F0701 ‘Arthropod Symbioses: from fundamental to pest disease management’.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Ahantarig A, Trinachartvanit W & Kittayapong P (2008) Relative Wolbachia density of field-collected Aedesalbopictus mosquitoes in Thailand. J Vector Ecol 33: 173177.
  • Aksoy S & Rio RV (2005) Interactions among multiple genomes: tsetse, its symbionts and trypanosomes. Insect Biochem Molec 35: 691698.
  • Bagny L, Delatte H, Elissa N, Quilici S & Fontenille D (2009a) Aedes (Diptera: Culicidae) vectors of arboviruses in Mayotte (Indian Ocean): distribution area and larval habitats. J Med Entomol 46: 198207.
  • Bagny L, Delatte H, Quilici S & Fontenille D (2009b) Progressive decrease in Aedesaegypti distribution in Reunion Island since the 1900s. J Med Entomol 46: 15411545.
  • Bagny L, Freulon M & Delatte H (2009c) First record of Aedesalbopictus, vector of arboviruses in the Eparse Islands of the Mozambique Channel and updating of the inventory of Culicidae. B Soc Pathol Exot 102: 193198.
  • Behar A, Yuval B & Jurkevitch E (2005) Enterobacteria-mediated nitrogen fixation in natural populations of the fruit fly Ceratitiscapitata. Mol Ecol 14: 26372643.
  • Bian G, Xu Y, Lu P, Xie Y & Xi Z (2010) The endosymbiotic bacterium Wolbachia induces resistance to dengue virus in Aedesaegypti. PLoS Pathog 6: e1000833.
  • Bruce KD, Hiorns WD, Hobman JL, Osborn AM, Strike P & Ritchie DA (1992) Amplification of DNA from native populations of soil bacteria by using the polymerase chain reaction. Appl Environ Microb 58: 34133416.
  • Buchner P (1965) Endosymbiosis of Animals with Plant Microorganisms. Interscience, New York.
  • Campbell CL, Mummey DL, Schmidtmann ET & Wilson WC (2004) Culture-independent analysis of midgut microbiota in the arbovirus vector Culicoides sonorensis (Diptera: Ceratopogonidae). J Med Entomol 41: 340348.
  • Cheng Q & Aksoy S (1999) Tissue tropism, transmission and expression of foreign genes in vivo in midgut symbionts of tsetse flies. Insect Mol Biol 8: 125132.
  • Crotti E, Damiani C, Pajoro M et al. (2009) Asaia, a versatile acetic acid bacterial symbiont, capable of cross-colonizing insects of phylogenetically distant genera and orders. Environ Microbiol 11: 32523264.
  • Damiani C, Ricci I, Crotti E et al. (2010) Mosquito–bacteria symbiosis: the case of Anopheles gambiae and Asaia. Microb Ecol.
  • Delatte H, Dehecq JS, Thiria J, Domerg C, Paupy C & Fontenille D (2008) Geographic distribution and developmental sites of Aedesalbopictus (Diptera: Culicidae) during a Chikungunya epidemic event. Vector Borne Zoonot 8: 2534.
  • Demaio J, Pumpuni CB, Kent M & Beier JC (1996) The midgut bacterial flora of wild Aedestriseriatus, Culexpipiens, and Psorophoracolumbiae mosquitoes. Am J Trop Med Hyg 54: 219223.
  • Dillon R & Charnley K (2002) Mutualism between the desert locust Schistocercagregaria and its gut microbiota. Res Microbiol 153: 503509.
  • Dobson SL, Marsland EJ & Rattanadechakul W (2001) Wolbachia-induced cytoplasmic incompatibility in single- and superinfected Aedesalbopictus (Diptera: Culicidae). J Med Entomol 38: 382387.
  • Dong Y, Manfredini F & Dimopoulos G (2009) Implication of the mosquito midgut microbiota in the defense against malaria parasites. PLoS Pathog 5: e1000423.
  • Farikou O, Njiokou F, Mbida Mbida JA et al. (2010) Tripartite interactions between tsetse flies, Sodalisglossinidius and trypanosomes – an epidemiological approach in two historical human African trypanosomiasis foci in Cameroon. Infect Genet Evol 10: 115121.
  • Favia G, Ricci I, Damiani C et al. (2007) Bacteria of the genus Asaia stably associate with Anophelesstephensi, an Asian malarial mosquito vector. P Natl Acad Sci USA 104: 90479051.
  • Favia G, Ricci I, Marzorati M, Negri I, Alma A, Sacchi L, Bandi C & Daffonchio D (2008) Bacteria of the genus Asaia: a potential paratransgenic weapon against malaria. Adv Exp Med Biol 627: 4959.
  • Fontenille D & Rodhain F (1989) Biology and distribution of Aedesalbopictus and Aedesaegypti in Madagascar. J Am Mosqito Contr 5: 219225.
  • Geiger A, Fardeau ML, Grebaut P et al. (2009) First isolation of Enterobacter, Enterococcus, and Acinetobacter spp. as inhabitants of the tsetse fly (Glossina palpalis palpalis) midgut. Infect Genet Evol 9: 13641370.
  • Genta FA, Dillon RJ, Terra WR & Ferreira C (2006) Potential role for gut microbiota in cell wall digestion and glucoside detoxification in Tenebrio molitor larvae. J Insect Physiol 52: 593601.
  • Glaser RL & Meola MA (2010) The native Wolbachia endosymbionts of Drosophilamelanogaster and Culexquinquefasciatus increase host resistance to West Nile virus infection. PLoS One 5: e11977.
  • Gottlieb Y, Zchori-Fein E, Mozes-Daube N et al. (2010) The transmission efficiency of Tomato yellow leaf curl virus by the whitefly Bemisiatabaci is correlated with the presence of a specific symbiotic bacterium species. J Virol 84: 93109317.
  • Gusmao DS, Santos AV, Marini DC, Russo Ede S, Peixoto AM, Bacci Junior M, Berbert-Molina MA & Lemos FJ (2007) First isolation of microorganisms from the gut diverticulum of Aedesaegypti (Diptera: Culicidae): new perspectives for an insect–bacteria association. Mem I Oswaldo Cruz 102: 919924.
  • Gusmao DS, Santos AV, Marini DC, Bacci M Jr, Berbert-Molina MA & Lemos FJ (2010) Culture-dependent and culture-independent characterization of microorganisms associated with Aedesaegypti (Diptera: Culicidae) (L.) and dynamics of bacterial colonization in the midgut. Acta Trop 115: 275281.
  • Kikuchi Y, Hosokawa T & Fukatsu T (2007) Insect–microbe mutualism without vertical transmission: a stinkbug acquires a beneficial gut symbiont from the environment every generation. Appl Environ Microb 73: 43084316.
  • Kittayapong P, Baisley KJ, Baimai V & O'Neill SL (2000) Distribution and diversity of Wolbachia infections in Southeast Asian mosquitoes (Diptera: Culicidae). J Med Entomol 37: 340345.
  • Kittayapong P, Baimai V & O'Neill SL (2002) Field prevalence of Wolbachia in the mosquito vector Aedesalbopictus. Am J Trop Med Hyg 66: 108111.
  • Konig H (2006) Bacillus species in the intestine of termites and other soil invertebrates. J Appl Microbiol 101: 620627.
  • Lee JS, Lee KC, Kim KK, Hwang IC, Jang C, Kim NG, Yeo WH, Kim BS, Yu YM & Ahn JS (2009) Acinetobacter antiviralis sp. nov., from Tobacco plant roots. J Microbiol Biotechn 19: 250256.
  • Lehman RM, Lundgren JG & Petzke LM (2009) Bacterial communities associated with the digestive tract of the predatory ground beetle, Poeciluschalcites, and their modification by laboratory rearing and antibiotic treatment. Microb Ecol 57: 349358.
  • Moran NA & Degnan PH (2006) Functional genomics of Buchnera and the ecology of aphid hosts. Mol Ecol 15: 12511261.
  • Moran NA, McCutcheon JP & Nakabachi A (2008) Genomics and evolution of heritable bacterial symbionts. Annu Rev Genet 42: 165190.
  • Moreira LA, Iturbe-Ormaetxe I, Jeffery JA et al. (2009) A Wolbachia symbiont in Aedesaegypti limits infection with dengue, Chikungunya, and Plasmodium. Cell 139: 12681278.
  • Moya A, Pereto J, Gil R & Latorre A (2008) Learning how to live together: genomic insights into prokaryote–animal symbioses. Nat Rev Genet 9: 218229.
  • Muyzer G, de Waal EC & Uitterlinden AG (1993) Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microb 59: 695700.
  • Oliver KM, Degnan PH, Burke GR & Moran NA (2010) Facultative symbionts in aphids and the horizontal transfer of ecologically important traits. Annu Rev Entomol 55: 247266.
  • O'Meara GF, Evans LF Jr, Gettman AD & Cuda JP (1995) Spread of Aedesalbopictus and decline of Ae. aegypti (Diptera: Culicidae) in Florida. J Med Entomol 32: 554562.
  • O'Neill SL, Giordano R, Colbert AM, Karr TL & Robertson HM (1992) 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. P Natl Acad Sci USA 89: 26992702.
  • Paupy C, Ollomo B, Kamgang B et al. (2010) Comparative role of Aedesalbopictus and Aedesaegypti in the emergence of Dengue and Chikungunya in central Africa. Vector Borne Zoonot 10: 259266.
  • Pidiyar VJ, Jangid K, Patole MS & Shouche YS (2004) Studies on cultured and uncultured microbiota of wild Culexquinquefasciatus mosquito midgut based on 16s ribosomal RNA gene analysis. Am J Trop Med Hyg 70: 597603.
  • Pumpuni CB, Demaio J, Kent M, Davis JR & Beier JC (1996) Bacterial population dynamics in three anopheline species: the impact on Plasmodium sporogonic development. Am J Trop Med Hyg 54: 214218.
  • Randrianasolo L, Raoelina Y, Ratsitorahina M, Ravolomanana L, Andriamandimby S, Heraud JM, Rakotomanana F, Ramanjato R, Randrianarivo-Solofoniaina AE & Richard V (2010) Sentinel surveillance system for early outbreak detection in Madagascar. BMC Public Health 10: 31.
  • Rani A, Sharma A, Rajagopal R, Adak T & Bhatnagar RK (2009) Bacterial diversity analysis of larvae and adult midgut microflora using culture-dependent and culture-independent methods in lab-reared and field-collected Anophelesstephensi– an Asian malarial vector. BMC Microbiol 9: 96.
  • Ratsitorahina M, Harisoa J, Ratovonjato J et al. (2008) Outbreak of dengue and Chikungunya fevers, Toamasina, Madagascar, 2006. Emerg Infect Dis 14: 11351137.
  • Ravaonjanahary C (1978) Les Aedes de Madagascar. Travaux et documents de 1'ORSTOM, France.
  • Raymond B, Lijek RS, Griffiths RI & Bonsall MB (2008) Ecological consequences of ingestion of Bacilluscereus on Bacillusthuringiensis infections and on the gut flora of a lepidopteran host. J Invertebr Pathol 99: 103111.
  • Raymond B, Johnston PR, Wright DJ, Ellis RJ, Crickmore N & Bonsall MB (2009) A mid-gut microbiota is not required for the pathogenicity of Bacillus thuringiensis to diamondback moth larvae. Environ Microbiol 11: 25562563.
  • Salvan M & Mouchet J (1994) Aedesalbopictus and Aedesaegypti at Ile de la Reunion. Ann Soc Belg Med Tr 74: 323326.
  • Sang RC, Ahmed O, Faye O et al. (2008) Entomologic investigations of a chikungunya virus epidemic in the Union of the Comoros, 2005. Am J Trop Med Hyg 78: 7782.
  • Schuffenecker I, Iteman I, Michault A et al. (2006) Genome microevolution of chikungunya viruses causing the Indian Ocean outbreak. PLoS Med 3: e263.
  • Sinkins SP, Braig HR & O'Neill SL (1995) Wolbachia superinfections and the expression of cytoplasmic incompatibility. Proc Biol Sci 261: 325330.
  • Straif SC, Mbogo CN, Toure AM, Walker ED, Kaufman M, Toure YT & Beier JC (1998) Midgut bacteria in Anophelesgambiae and An. funestus (Diptera: Culicidae) from Kenya and Mali. J Med Entomol 35: 222226.
  • Terenius O, de Oliveira CD, Pinheiro WD, Tadei WP, James AA & Marinotti O (2008) 16S rRNA gene sequences from bacteria associated with adult Anophelesdarlingi (Diptera: Culicidae) mosquitoes. J Med Entomol 45: 172175.
  • Tortosa P, Courtiol A, Moutailler S, Failloux AB & Weill M (2008) Chikungunya–Wolbachia interplay in Aedesalbopictus. Insect Mol Biol 17: 677684.
  • Tortosa P, Charlat S, Labbe P, Dehecq JS, Barre H & Weill M (2010) Wolbachia age-sex-specific density in Aedesalbopictus: a host evolutionary response to cytoplasmic incompatibility? PLoS One 5: e9700.
  • Tsuchida T, Koga R & Fukatsu T (2004) Host plant specialization governed by facultative symbiont. Science 303: 1989.
  • Unckless RL, Boelio LM, Herren JK & Jaenike J (2009) Wolbachia as populations within individual insects: causes and consequences of density variation in natural populations. Proc Biol Sci 276: 28052811.
  • Vazeille M, Moutailler S, Coudrier D et al. (2007) Two Chikungunya isolates from the outbreak of La Reunion (Indian Ocean) exhibit different patterns of infection in the mosquito, Aedesalbopictus. PLoS One 2: e1168.
  • Warnecke F, Luginbuhl P, Ivanova N et al. (2007) Metagenomic and functional analysis of hindgut microbiota of a wood-feeding higher termite. Nature 450: 560565.
  • Zhou W, Rousset F & O'Neil S (1998) Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc Biol Sci 265: 509515.
  • Zouache K, Voronin D, Tran-Van V & Mavingui P (2009a) Composition of bacterial communities associated with natural and laboratory populations of Asobaratabida infected with Wolbachia. Appl Environ Microb 75: 37553764.
  • Zouache K, Voronin D, Tran-Van V, Mousson L, Failloux AB & Mavingui P (2009b) Persistent Wolbachia and cultivable bacteria infection in the reproductive and somatic tissues of the mosquito vector Aedesalbopictus. PLoS One 4: e6388.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Fig. S1. Relative density of Wolbachia wAlbA in Aedes albopictus males from different collection sites in Madagascar.

Fig. S2. Relative density of Wolbachia wAlbB in Aedes albopictus males from different sites in Madagascar.

Please note: Wiley-Blackwell is not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

FilenameFormatSizeDescription
FEM_1012_sm_fig-s1.png621KSupporting info item
FEM_1012_sm_fig-s2.png608KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.