SEARCH

SEARCH BY CITATION

Keywords:

  • aggregates;
  • bacterial biomasses and diversity;
  • Cyanobacteria;
  • fungal communities;
  • soil fractionation;
  • urban sediment

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

This study focuses on the distribution of bacterial and fungal communities within the microstructure of a multi-contaminated sedimentary layer resulting from urban stormwater infiltration. Fractionation was performed on the basis of differential porosity and aggregate grain size, resulting in five fractions: leachable fitting macroporosity, < 10, 10–160, 160–1000 μm fitting aggregates, > 1000 μm. Amounts of both bacterial and fungal biomasses are greater in the < 10 μm and leachable fractions. The aggregates contain numerous bacteria but very low amounts of fungal biomass. Single-strand conformational polymorphism molecular profiles highlighted the differences between bacterial and fungal communities of the leachable fraction and those of the aggregates. Random Sanger sequencing of ssu clones revealed that these differences were mainly because of the presence of Epsilonproteobacteria and Firmicutes in the leachable fractions, while the aggregates contained more Cyanobacteria. The Cyanobacteria phylotypes in the aggregates were dominated by the sequences related to Microcoleus vaginatus while the leachable fractions presented the sequences of chloroplastic origin. Therefore, more than 50% of the phylotypes observed were related to Proteobacteria while 40% were related to Cyanobacteria and Bacteroidetes. Preferential distribution of clades in almost all the phyla or classes detected was observed. This study provides insight into the identities of dominant members of the bacterial communities of urban sediments. Microcoleus vaginatus appeared to predominate in pioneer soils.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

Millions of tons of solid contaminated materials accumulate yearly on impermeable surfaces in urban areas to form deposits such as wastewater sludge, road dust and sediments. In France, the total dry weight (hereafter DW) of urban sediments accumulated by stormwater run-off has been estimated at several dozen million tons per year (Petavy & Ruban, 2005; Ruban, 2005). Stormwater run-off collected in infiltration basins infiltrates into groundwater and aquifers, leading to the settling of highly polluted deposits, which constitute a potential source of contamination for groundwater (Pitt et al., 1999; Datry et al., 2004). Such sediments are mainly composed of silt-sized particles that contain high levels of metals and petroleum-derived organic matter (OM) (Durand et al., 2004, 2005; Clozel et al., 2006; Badin et al., 2008). They are colonized by consistently active microbial communities (Neto et al., 2007; Mermillod-Blondin et al., 2008) and sustain plant growth (Saulais et al., 2011). The solid materials composing the sedimentary layer have high OM (4–27%) and biomass contents (Durand et al., 2004; Winiarski et al., 2006; Murakami et al., 2008). These sediments can be considered as very young soils formed from parent rock material and OM deposits. However, in contrast to well-formed soil, they have evolved over only a few decades (because infiltration practices began). We propose to consider these materials as the surface layer of a Technosol (Capilla et al., 2006; FAO 2006). A Technosol is defined as a soil whose properties and pedogenesis are dominated by their technical origin.

Soil structure is a dynamic rather than a static property of soil (Hussein & Adey, 1998) that influences the transport of gases and solutes within the soil and between the soil and adjacent compartments, such as the hydrosphere and atmosphere. It is known that run-off bearing mobile solutes and bacteria and which reaches the groundwater is transported by convection in the macropores (> 6 μm advective flow), whereas diffusion mechanisms occur in the micropores (< 6 μm) and are responsible for transforming OM and, indirectly, for pollutant retention (Ranjard et al., 1997; Pallud et al., 2004). Consequently, the leaching of pollutants and bacteria to subsurfaces depends both on their mobility properties and the physical structure of the sediments in the surface layer.

The basic units of soil structure are called aggregates, which are clusters (or lumps) of soil particles that are chemically bound together by clay, OM, polysaccharides and glomalin produced by bacteria and fungi. In addition, they are physically held together by fungal hyphae and plant roots. The forces holding the particles together are much stronger than the forces between adjacent aggregates (Martin et al., 1955). Various soil constituents are responsible for the formation of aggregates. According to Edwards & Bremner (1967), Tisdall & Oades (1982), Oades (1988) and Boix-Fayos et al. (2001), the essential parameters that act on aggregation are OM, microorganisms, clays and divalent cations.

Soils are complex heterogeneous and structured environments (Young & Crawford, 2004). For example, their physical and chemical characteristics differ from point to point, even by a few micrometres, leading to different microenvironments that strongly influence bacterial cells (Hattori & Hattori, 1976; Chenu & Stotzky, 2002; Grundmann, 2004; Franklin & Mills, 2007). Soil structure contains two different microhabitats: the inner part of soil aggregates (associated with microporosity < 2.5–6 μm) and their outer part (i.e. surrounding macroporosity) and surfaces (Hattori & Hattori, 1976; Ranjard et al., 2000; Mummey et al., 2006; Kim & Sansalone, 2008).

Each pore space provides different niches for microbial life. For instance, microorganisms living in macroporosities appear to withstand desiccation but easily obtain nutrients that are carried through the soil during infiltration. On the other hand, microorganisms living in microporosities appear to tolerate anoxia and low nutrient resources, but are protected from predation. Thus, the diversity of soil microhabitats can lead to differences in microbial communities.

The distribution of microorganisms in soil porosities and grain-size fractions in soil has already been assessed (Hattori & Hattori, 1976; Jocteur Monrozier et al., 1991; Ranjard et al., 2000; Sessitsch et al., 2001; Mummey et al., 2006; Kim & Sansalone, 2008). The bacterial communities in the micropores and macropores of certain well-structured soils are different (Hattori & Hattori, 1976; Ranjard et al., 2000; Belnap, 2002; Pallud et al., 2004; Mummey et al., 2006). By contrast, in less-structured soils, no evidence of differential distribution has been found (Blackwood et al., 2006; Kim et al., 2008). Whatever the case, the aggregates of infiltration basin Technosols appear to be very stable (Badin et al., 2009ab), but information on the microorganisms colonizing them in this type of solid material is extremely scarce.

Characterization of the microbial composition in aggregates and of macroporosity fractions is required to better understand the structure formation and the interactions between solid phases and leaching water. Microorganisms can interact with the solid phase and change the properties of aggregates, by degrading OM and sequestering metals. This action may have a considerable impact on the composition of leachates. The main goal of this study was to describe the microbial compositions of the macro and microstructures of urban sediment as the background for studying leaching processes. The Technosol was fractionated into five fractions as a function of aggregate size. The bacterial and fungal molecular profiles were determined by capillary-electrophoresis single-strand conformational polymorphism (CE-SSCP). The bacterial community was further characterized by random sequencing of an ssu library. Our results show that there is a significant difference between the bacterial communities of leachable and aggregated fractions.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

Description of site, sampling and sediment

The infiltration basin studied is located at Chassieu, an urban area NE of Lyon, France. The 1-ha infiltration pond receives stormwater from an urban and industrialized watershed of 185 ha and was described previously (Winiarski et al., 2006). The sampling area (Badin et al., 2008) is located in the infiltration part of the pond.

Sampling was performed with a clean shovel. Five 1-kg samples were taken from a 2-m2 area (samples A to E) on 10 May 2006. This sampling strategy was designed to capture the spatial variability of the site. They were kept at 4 °C for 2 weeks before performing the fractionation experiments. The chemical characteristics of the urban sediment were also reported previously (Badin et al., 2008). Briefly, the sediments studied were silt-sized materials with high total heavy metal (1934 ± 188 mg kg−1 DW) and OM contents (10 ± 2% DW); the organic fraction was mainly composed of petroleum byproducts (Badin et al., 2008). The contents of the following were water, 39 ± 7%; inline image + inline image, 1.62 ± O.77 mg kg−1; inline image, 717 ± 368 mg kg−1.

Grain-size analyses and fractionation

Grain-size analyses and aggregate determination were performed in triplicate for each of the five samples in aqueous phase, by laser diffractometry (Malvern Mastersizer 2000G). Grain-size distribution of the sample was measured before and after 1-min sonication. The measurements were performed by laser diffractometry using a Malvern Mastersizer 2000G with a range of 0.02–2000 μm (in aqueous phase). The aggregates considered were only those that could be destroyed by the amount of energy supplied by ultrasound (US) for 1 min in the diffractometer sample chamber (50–60 Hz). Prior to the analysis, each sample was gently wet-sieved at 1600 μm with tap water.

Fractionation

Six fractions were obtained based on aggregate size distribution: the leachable part and five grain-size fractions: > 1000, 160–1000, 10–160, < 10 μm. The aggregates were mainly found in the 160–1000 μm fraction, but were also found in the < 1000 μm fraction. Fractionation was performed in triplicate for each sample as described previously (Ranjard et al., 1997, 2000). Briefly, the sediment sample was suspended and subjected to 14 cycles of gentle shaking and settling. The supernatant was recovered after each settling and pooled, providing the leachable fraction. The remaining sediment was fractionated by wet sieving (1000 and 160 μm) and sedimentation (10–160 and < 10 μm). This procedure was repeated three times on the five samples collected, with the relative proportions of fractions being very similar (P-value of one way anova > 0.07). Thus, one sample was chosen to further characterize the fractions. The B sediment sample was chosen because it showed the least deviation from the means for water, OM contents, bacterial counts and pH. Fractionation was performed again in triplicate (B1, B2, B3) and subsamples were assigned to various analyses as microbial characterization or OM characterization (Badin et al., 2008).

Bacterial enumeration and fungal biomass determination

Bacterial enumeration

The bacteria counts were obtained by direct counting using epifluorescence microscopy to detect live and dead cells. Bacteria were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Porter & Feig, 1980; Kepner & Pratt, 1994) and counts were performed in triplicate for each bulk sediment sample (A to E) and for each subsample resulting from fractions B1 to B3 within the 3 days following sampling. Live and dead cells and samples for bacteria enumeration were kept at 4 °C.

The bulk sediments, that is, > 1000 and 160–1000 μm, were treated as solid fractions, whereas the leachable fractions < 10 and 10–160 μm were treated as suspensions. The solid fractions were blended for 90 s with sterile NaCl 0.8% in a liquid : solid ratio of 5 : 1. The resulting suspensions were collected in sterile tubes and sonicated for 1 min. Formaldehyde (9 mg mL−1), a solution of glutaraldehyde buffered at pH 7.2 (0.4 mg mL−1), and DAPI stain (0.002 mg mL−1) were added successively. The staining reaction lasted 20 min in the dark. The suspensions were filtered on black-prestained 0.22-μm filters (Millipore isopore GTPB). Fluorescent bacteria were counted in ten areas (along a Z-shaped line) per filter and on three filters per sample.

Fungal biomass determination

Ergosterol is a fungal cellular compound that has been used as a marker of live fungal biomass (Djajakirana et al., 1996). It was extracted by 30-min sonication using 1 g eq DW−1 of sediment and 80 mL of bidistilled ethanol. Filtrated extracts (0.45 μm) were then concentrated by evaporation, and the dry extracts were recovered in a volume of 6 mL of bidistilled ethanol. They were filtered again (0.45 μm) prior to the analysis by Liquid Chromatography (Agilent 1100) and Mass Spectrometry. The mobile phase used in an isocratic run was methanol : water (97 : 3). Detection was performed by Atmospheric Pressure Chemical Ionization (APCI), and quantification was carried out in selecting ion-monitoring mode using the characteristic fragment ion at m/z 279. Ergosterol content was quantified in subsamples resulting from fractions B1 to B3 (duplicates or triplicates) and in four bulk sediment samples (triplicates).

Extraction, amplification and cloning of bacterial ssu genes

DNA extraction from sediments and grain-size fractions

DNA was extracted from bulk sediment samples (triplicates from B) and from each sample resulting from fractions B1 to B3. DNA extractions were performed with the Power SoilTM Extraction Kit (Mo Bio Laboratories, Ozyme, St Quentin en Yvelines, France), using 250 mg fresh-weight sediment or solid fractions (> 1000, 160–1000) per sample and with the UltraClean Water Kit (Mo Bio Laboratories), using 250 mL of the suspended fractions (10–160, < 10 μm) and the leachable fractions, according to the manufacturer's instructions. Three extractions were performed on the bulk sediment and one on each fraction per fractionation assay, that is, 3. The DNA extracts were checked on agarose gel (1% in Tris–Borate–EDTA, hereafter TBE).

PCR-SSCP analyses

The phylogenetic structure of bacterial and fungal communities was assessed using single-strand conformation polymorphisms (SSCP) as described previously (Zinger et al., 2007, 2008; Gury et al., 2008). Briefly, fungal diversity was assessed by the amplification of the ITS1 region using the primer ITS5 (5′-GGAGTAAAAGTCGTAACAAGG-3′) and the fluorescently labelled primer (5′HEX) ITS2 (5′-GCTGCGTTCTTCATCGATGC-3′). To assess the bacterial diversity, the V3 region of ssu was amplified using primer W49 (5′-ACGGTCCAGACTCCTACGGG-3′) and fluorescently labelled primer 5′-FAM W104 (5′-GTGCCAGCAGCCGCGGTAA-3′). The PCR mixture (25 μL) consisted of 2.5 mM MgCl2, 0.2 μM of each primer, 0.05 μM of each dNTP, 1 U Taq polymerase (Roche), and 1 μL of each DNA sample (10 ng μL−1), in Ultrapure water. The PCR conditions were the same for both cases: 95 °C for 10 min; 95 °C for 10 s, 56 °C for 15 s, 72 °C for 15 s (30 cycles); and final extension at 72 °C for 7 min. PCR products were visualized on a 2% TBE agarose gel to assess DNA concentration.

CE-SSCP

A 1-μL aliquot of the PCR product was mixed with 10 μL formamide Hi-Di (applied Biosystems, Courtaboeuf, France), 0.5 μL NaOH (0.3 M) and 0.2 μL of the standard internal DNA molecular weight marker Genescan-400HD ROX (Applied Biosystems). SSCP was performed on an ABI prism 3130 Genetic analyzer (Applied Biosystems), using a 36-cm-long capillary. The polymer contained 5% CAP polymer, 10% glycerol (Applied Biosystems), and the running buffer contained 10% glycerol and 10% 3100 buffer. Injection time and voltage were set at 22 s and 1 kV, respectively. Electrophoresis was performed at 32 °C for 25 min (Zinger et al., 2007, 2008). The profiles obtained from CE-SSCP were retrieved as digits and compared by correspondence analysis. This discriminative analysis orders rows by columns and columns by rows and is usually performed on contingency tables to visualize the distribution of species in different habitats and, conversely, habitat uses by species (Ramette, 2007). Here, it allowed the visualization of phylotypes (by equivalent base pair: nbp) for subsamples, and subsamples for phylotypes. It was performed with the ade-4 software (Dray & Dufour, 2007), an r software package (Team RDC, 2008). Two incongruous profiles were substituted by the mean of their replicates to avoid biases of CoA (one of the aggregated fractions for fungi and bacteria).

Clone library construction and analysis

Bacterial communities were monitored using 800 bp of the ssu gene encompassed by primers 63F (5′- CAGGCCTAACACATGCAAGTC -3′ (positions 43–63 of Echerichia coli ssu) (Marchesi et al., 1998) and Com2-ph reverse (5′- CCGTCAATTCCTTTGAGTTT -3′, positions 907–926 of E. coli ssu) (Schwieger & Tebbe, 1998). Clone libraries were constructed as previously described (Zinger ISME) for the leachable and aggregated samples (DNA extracts were pooled for each fraction). Briefly, eight independent PCR-amplifications were performed on each sample, pooled, purified using QIAquick-PCR Purification Kit (250) QIAGEN and cloned using a TOPO TA PCR 4.1 Cloning Kit (Invitrogen SARL, Molecular Probes, Cergy Pontoise, France). Echerichia coli (TOP10F') was transformed by electroporation. Blue transformants were selected for sequencing. plasmidic DNA that was extracted using NucleoSpin®-Robot96 Cor Kit-MACHEREY-NAGEL. Sanger sequencing was performed by Cogenics (Meylan, France), using M13 primers.

Sequence and statistical analyses

The chimerical sequences were detected with Bellerophon (Huber et al., 2004) and removed from the dataset. We obtained 256 sequences for the leachable fraction and 211 sequences for the aggregated fraction. The sequences were deposited under the EMBL Accession numbers HE658980-HE659348. The taxonomic assignment of ssu sequences was carried out using the Ribosomal Database Project (Cole et al., 2003). The rarefaction analysis was performed both at 97% similarity and at the order level (Supporting Information, Figs S3 and S4). As expected, saturation was not reached at the 97% of similarity. Nevertheless, rarefaction analysis at the order level indicates that most of the diversity at this level was covered with the sequencing depth used here. Additionally, at both levels, the aggregate fraction saturates faster than the leachable fraction. The closest matches were downloaded as references from GenBank (www.ncbi.nlm.nih.gov). The sequences shorter than 800 bp were removed to improve alignment, rendering 209 sequences for the leachable fraction and 164 for the aggregated fraction. The multiple alignments were performed using the ClustalW algorithm (Thompson et al., 1994). After calculating the Jukes–Cantor distance, the phylogenetic tree was constructed with mega 3.1 (Kumar et al., 2004) using neighbour joining with 1000 bootstraps. We computed the nearest taxon index (hereafter NTI), which quantifies the degree of phylogenetic clustering of taxa given their patterns of the presence/absence and their phylogenetic relationships (Webb et al., 2002) provided by the r package ‘picante’ (Kembel et al., 2010).

Data processing

Statistical analyses were performed with r (Team RDC, 2008). Nested anova were performed to test bacteria counts between fractions (the potential effect of subsampling used for fractionation purposes was taken into account). Bacteria counts were log transformed to verify the normality assumptions of residues and the equality of variances. A posteriori Tukey HSD test was performed when statistically significant differences were revealed by anova. The significance level was set at α = 0.05. For fungi, no statistical analysis was performed on the number of fungal biomass data available. Only raw data (min–max) are given.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

Identification of the aggregated fraction

The basic unit of the sedimentary structure is the aggregate. To determine the aggregated fraction of the sediment, we compared the grain-size distribution of unsonicated vs. sonicated sediments. The > 1000 μm fraction was mostly composed of gravels, but also pieces of wood, particulate OM, aggregates, etc. The aggregated fraction was considered to be sensitive to sonication (Badin et al., 2009ab). As shown in Fig. 1, the 160–1000 μm peak was strongly reduced by sonication, indicating that this fraction is mostly made up of aggregates. The proportion of the particles between 10 and 160 μm, which increased in size after sonication, was possibly composed of elementary particles or microaggregates too stable to be disaggregated by ultrasound. Consequently, fractionation thresholds were fixed. The fractions separated were < 10, 10–160, 160–1000 and > 1000 μm, plus the leachable fraction.

image

Figure 1. Particle grain-size distribution of stormwater sediments. The black line matches the measurement performed without preliminary ultra-sonication, the grey one matches the measurement performed after sonication. Note aggregation of the 160–1000 μm fraction.

Download figure to PowerPoint

The mass proportions of the fractions are shown in Table 1. The weight proportions of each grain-size fraction did not differ between the triplicates of the five samples of sediments (P-value of one-way anova > 0.07). The > 1000 μm fraction was the major fraction. The macroaggregated fraction (160–1000 μm) represents 14% of the sediment dry weight and the leachable part only 2%. The leachable fraction consisted of particles finer than 100 μm (> 90%). Given the reproducibility of fractionation, one sample was fractionated three times and analyzed for further studies.

Table 1. Characteristics of the bulk sediment and the fractions. Grain sizes are in micrometres. Analyses were performed in triplicate
 Weight proportions of fractionsBacteria countsFungal biomassHeavy metals (Zn, Pb, Cu, Ni, Cr, Cd)a (Badin et al., 2009a)
In % of DW sedimentsIn bacteria g−1 DW of particles × 10+9bIn bacteria g−1 DW of sediment × 10+9 (% of the total bacteria per unit of sediment)cIn μg of ergosterol g−1 DW of particlesIn μg of ergosterol g−1 DW of sediment (% of the total ergosterol content per unit of sediment)cIn μg metal g−1 DW of sediments
Mean ± SD, n = 5Mean ± SD, n = 3 Min–Max, n = 2 or 3 Mean ± SD, n = 3
  1. a

    Sum of heavy metals measured in aqua regia digests.

  2. b

    Regarding the number of bacteria, the fractions sharing the same letter have not been shown to be significantly different (a posteriori Tukey HSD test, α = 0.05).

  3. c

    Results from calculation: (weight proportion of each fraction) × (bacteria count/ergosterol content in fraction).

> 100070 ± 94.8 ± 2.1 d3.4 (22)0.27–0.330.2 (31)449 ± 108
160–100014 ± 328.1 ± 3.4 b, c4.0 (26)0.08–0.170.0 (3)1464 ± 133
10–16011 ± 439.3 ± 14 b4.4 (29)0.43–2.450.2 (29)2479 ± 321
< 103 ± 170.5 ± 6.2 a2.5 (16)3.71–6.870.2 (28)2365 ± 82
Leach.2 ± 169.0 ± 3.9 a1.2 (8)1.69–6.340.1 (10)2207 ± 297
  Mean ± SD, n = 5 Mean ± SD, n = 4 Mean ± SD, n = 5
Bulk sediments35 ± 9.5 c15.4 (100)5.95 ± 3.020.7 (100)1934 ± 188

Biomass distribution

To assess the distribution of microorganisms in the six fractions studied, the bacteria were counted and the ergosterol content measured in each fraction (Table 1). Regarding the bacteria, the two finest fractions (the leachable and < 10 μm fractions) contained the largest counts per gram of dry weight (around 7 × 1010 bacteria g−1 DW of sediments) (P-values range from 0.000 to 0.020 and 0.000 to 0.013, respectively). The values were significantly lower in the > 1000 μm fraction (P-values = 0.000) and intermediate in the 10–160 and 160–1000 μm fractions. Finally, bacteria counts in the bulk sediments were not shown to be different from the aggregated fraction (160–1000 μm). When considering the contribution of weight of each fraction, the 10–160 and 160–1000 μm fractions accounted for 55% of total bacterial counts, while the leachable fraction only accounted for 8% (counts per gram of total sediment). In brief, the fractions that contained the highest biomass per gram were also the smallest fractions, and therefore, their contribution to the whole sediment was often minor.

The ergosterol content of the fractions suggests that fungal biomass per gram of dry weight was lowest in the aggregated fraction (160–1000 μm) and highest in both the < 10 μm and leachable fractions. Moreover, the ergosterol contents measured in the bulk sediments and the finer fractions were similar. Because fungi are expected to colonize macropores (i.e. outside aggregates), these results further support the hypothesis that macroporosity is represented by the leachable fraction while the < 10 μm fraction is potentially leachable.

Our results indicate that bacteria are found mainly in the aggregate fraction while fungal biomass is found in the macropores. It should be kept on mind that we compared live and dead counts (bacteria) to live biomass (fungi). Nevertheless, we hypothesize that bacterial and fungal niches are different: bacteria mainly colonize the aggregate fraction while fungi colonize the macroporosity.

Genotypic diversity of microbial communities in grain-size fractions

To compare both the bacterial and fungal communities of these size fractions, we performed CE-SSCP on three independent fractionation experiments. The bacterial and fungal data were analyzed by correspondence analysis (CoA).

The CoA on the genotypic diversity of the bacterial communities is plotted in Fig. 2. The first canonical axis (eigenvalue = 0.026) explained 77% of the total variation in the data, and the second (0.003), a further 8%. The replicates of the > 1000 μm fraction differed greatly, indicating that bacterial communities living in the largest grain-size fraction could be very different from one sampling point to another. This high spatial variability supports the 1st axis of the CoA, and may reflect the variety of substrates observed in the > 1000 μm fraction (pieces of wood, large aggregates, gravels), possibly selecting different bacterial communities. The discriminative peaks along the 1st axis are for phylotypes (or OTU) from 202 to 205.5 bp. By contrast, the replicates of the other fractions and of the bulk sediment are well grouped, indicating that bacterial communities are homogeneous. The samples of the bulk sediment and the < 10, 10–160, 160–1000 μm fractions cluster at the centre of the CoA map (Fig. 2). Thus, the genotypic fingerprints of the bacterial communities of bulk sediment are similar to those of the finer fractions. Moreover, they are composed of the majority of the phylotypes (otu) detected overall. On the other hand, the samples of the leachable fraction are clearly discriminated from the bulk sediment and the finer fractions. These results strongly suggest that bacterial communities from macropores differ from those of the solid fractions.

image

Figure 2. Mapping of the fungal genotypic diversity in the grain-size fractions and bulk sediment. Results from correspondence analysis (CoA) for fungal SSCP profiles in fractionated grain-size fractions (in μm). The first two axes are kept for mapping (77% and 8%); the first is horizontal. Leach. = leachable fractio

Download figure to PowerPoint

The CoA on the genotypic diversity of fungal communities is shown in Fig. 3. The first canonical axis (eigenvalue = 0.208) explained 45% of the total variation in the data, while the second (0.076), a further 17%. Almost 40% of the total inertia of fungi diversity was not taken into account for mapping. The variability between replicates of the bulk sediment, the > 1000 and 160–1000 μm fractions, is huge and seems to support the 1st axis. On the contrary, the replicates of the finer (> 10 and 10–160 μm) and leachable fractions are well grouped. The 2nd axis seems to be supported by the difference between fungal communities living in the < 10 μm fraction and in the leachable and 10–160 μm fractions.

image

Figure 3. Mapping of the fungal genotypic diversity in the grain-size fractions and bulk sediment. Results from correspondence analysis (CoA) for fungal SSCP profiles in fractionated grain-size fractions (in μm). The first two axes are kept for mapping (45% and 17%); the first is horizontal. Leach. = leachable fraction.

Download figure to PowerPoint

Thus, fungi communities appear to be very heterogeneous in the larger fractions, whereas they are homogeneous in the finer fractions. At least, three homogeneous fungal communities were detected: those living in the macropores, the < 10 μm and 10–160 μm fractions.

The bacterial and fungal communities from the macropores of the urban sediments are both different from those from the sediment micropores.

Composition of the bacterial communities living inside the aggregates and in the macropores

On the basis of both Technosol structure and the genotypic diversity of the bacterial communities, the bacteria living in the leachable fraction (fitting the macroporosity) and the aggregated fraction (160–1000 μm) were subjected to further investigation.

We obtained 457 bacterial ssu gene sequences (256 sequences for the leachable fraction and 201 sequences for the aggregated fraction). The sequences were grouped by 97% similarity, rendering 98 groups for the leachable fraction and 101 groups for the aggregated fraction. The Shannon–Weaver diversity indices were 7.64 and 4.83 for the leachable and aggregated fractions, respectively. Thus, both fractions display high but different bacterial diversities. The analysis of the phylogenetic structure indicated that the aggregated fraction was over-dispersed (NTI = −0.43) but not significantly so (P = 0.66), while the leachable fraction was clustered (NTI 1.65 P = 0.047). The latter results indicate that the leachable fraction was subject to environmental constraints.

The clone libraries were compared using LibCompare of RDPII. The results are presented in Fig. 4. An overall analysis reveals that in both samples most phylotypes are related to Proteobacteria, a substantial number to Bacteriodetes and only a few sequences to Actinobacteria (only 11 in the leachable fraction). Second, the bacterial communities from the macropores (the leachable fraction) and from the aggregates (the 160–1000 μm) are quite dissimilar (Fig. 4), supporting the CE-SSCP results. At phylum level, the proportion of Cyanobacteria is significantly higher in the aggregates (32.4% vs. 7.6%, P-value = 1.98 × 10−9). The proportions of the Proteobacteria (63.5% vs. 45.7%, P-value = 6.00 × 10−4), and the Firmicutes (6.6% vs. 0%, P-value = 2.94 × 10−4), are significantly higher in the macroporosity communities. The difference in Proteobacteria is attributed to the class Epsilonproteobacteria (9.6% vs. 0%, P-value = 6.70 × 10−6).

image

Figure 4. Proportions of clones of the leachable (macroporosity, in red) and the aggregated fractions (in blue). Bacteria belonging to aggregates: red, to the leachable fraction (macroporosity): blue. ***P-value < 0.001.

Download figure to PowerPoint

To search for the presence of specific phylotypes in each sample, the sequences from both samples were merged and clustered using phylogenetic approaches (Figs S1 and S2). For the group of Cyanobacteria, the ssu sequences were clustered into two main clades, with one of them representing chloroplastic sequences (Fig. 5). The prokaryotic clade contains most of the ‘cyanobacterial’ sequences from the aggregated fraction (39/54), while the chloroplastic clade groups most of the sequences of the leachable fraction. The most abundant prokaryotic phylotype is related to Microcoleus vaginatus (37 sequences of the aggregated fraction and three from the leachable fraction). Interestingly, the chloroplastic sequences were related to algae and diatoms, namely the algae Scenedesmus obliquus (leachable) and Spirogyra maxima (aggregate), the diatom Nitzschia frustulum (aggregated) and an unknown group (leachable).

image

Figure 5. Cyanobacteria and chloroplastic diversity of the leachable (circle) and aggregated fractions (triangle). The numbers of sequences observed are indicated in brackets.

Download figure to PowerPoint

For the group of Proteobacteria, the sequences were also clustered into four main classes (Alpha, Beta, Gamma and Epsilonoproteobacteria) (Fig. 6). The class of Alphaproteobacteria, accounting for 35/209 sequences in the leachable fraction and 20/164 sequences in the aggregate fraction, also seems to contain phylotypes displaying preferential distribution. Indeed, most of the sequences related to Sphingomonas sp. were found only in the leachable fraction. The other sequences, related to Skermanella, Porphyrobacter neustonensis, Devosia, Bradyrhizobium, Brevundimonas and uncultured phylotypes, did not display preferential distribution. The class Betaproteobacteria contained (36/209) in the leachable fraction and (24/164) in the aggregated fraction. Most of the phylotypes related to Acidovorax defluvii were from the leachable fraction, while phylotypes related to an uncultured Betaproteobacterium were from the aggregate fraction. The clades associated with Ideonella sp. and Rhodoferax sp. were dominated by aggregate and leachable phylotypes, respectively. For the other clades (Aquaspirillum, Methylibium fluvum and Dechloromonas hortensis), there was no clear trend. Thus, even if there is no significant difference in the distribution of this class, it seems that distribution is preferential for certain Betaproteobacterium phylotypes. The class of Gammaproteobacteria, which represented (31/209) in the leachable fraction and (22/164) in the aggregated fraction, presented phylotypes related to Thermomonas brevis, Aspromonas and uncultured species (Chromatiales and Gammaproteobacterium) without a trend in distribution. Finally, the class of Epsilonproteobacteria (19/209 sequences in the leachable fraction) was dominated by phylotypes related to Arcobacter sp.

image

Figure 6. Proteobacteria diversity of the leachable (circle) and aggregated fractions (triangle). The numbers of sequences observed are indicated inside brackets.

Download figure to PowerPoint

The Bacteroidetes group presented sequences in both the leachable (28/209) fraction and the aggregated fraction (33/164). These sequences were clustered into five main clades. Flavobacteriaceae was largely represented by phylotypes related to Flavobacterium, Glacier bacterium, Candidatus Amoebinatus and uncultured Chryseobacterium. Interestingly, the branches related to Flavobacterium  kamogawaensis clustered phylotypes from the aggregated fraction. There were two cases related to uncultured Bacteroidetes, both of them grouping mostly phylotypes from the aggregated fraction. In the Sphingobacteriaceae group, there was a clear distinction between the phylotypes from the leachable and aggregated fractions. The phylotypes from the aggregated fraction were related to Sphingobacterium sp., whereas the phylotypes from the leachable fraction were related to uncultured strains (Crenotrichaceae). The fifth class was related to Flexibacteriaceae and grouped mostly phylotypes from the aggregated fraction. These phylotypes were related to Cytophaga hutchinsoni, Arcocella aquatica, Rhodocytophaga aerolata and Flexibacterium bacterium. Once again, phylogenetic analysis revealed preferential distribution of the phylotypes.

For the phylum of Firmicutes (24/209), present only in the leachable fraction, the sequences were related to Nocardioides, Microbacterium, Clostridium, Fusibacter and Anaerovorax.

Therefore, phylogenetic analysis revealed preferential distribution of clades in almost all the phyla or classes detected.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

Human activities in urban areas generate huge volumes of solid materials that can be transported and deposited in stormwater infiltration devices, leading to the formation of urban sediment. Although their contaminant levels are often assessed, little is known about their physical structure and the microbial communities they accommodate. Moreover, analysis of the leachable fraction is relevant not only as a descriptor of a microhabitat of urban sediment, but also because the pollutants and bacteria (some of which can be pathogenic) present can reach the groundwater. In our study, we found that the distributions of fungal and bacterial communities in the sediment differed. The former colonized the leachable fraction, while the latter were also present in the aggregates. Moreover, the phylogenetic structure of bacterial communities from the aggregates differed from that of the leachable fraction.

General pattern of bacterial diversity in this urban sediment

When considering both the aggregate and leachable fractions, more than 50% of the phylotypes observed were related to Proteobacteria, while a further 40% were also related to Cyanobacteria and Bacteroidetes. Actinobacteria and Acidobacteria represented < 3% and 2% of total bacteria, respectively. Indeed, the general trend in natural soils is that Alphaproteobacteria, Acidobacteria and Actinobacteria are often dominant; content in Bacteroidetes seemed to vary between soils while Firmicutes and Planctomycetes are generally less abundant (Janssen, 2006; Roesch et al., 2007). The differences between soil and Technosol can be due to many reasons. First, soil formation requires plants, though these may select a specific bacterial cortege. Second, the times required for soil formation exceed several hundred years; the time possibly necessary for the recruitment of microbial species. Third, the quality of the soil metal content and OM may play a central role in microorganism selection. Indeed, although OM in soils is derived from plants and microbial species are better adapted to thrive on it, the OM of the Technosol studied here is derived from petroleum byproducts. The urban sediment studied here was rich in organic compounds with petroleum byproducts [steranes and terpanes, unresolved complex mixture (UCM) and polycyclic aromatic hydrocarbons (PAH)], but plant and bacteria biomarkers were also found in the form of phytol and derivatives, or sterols (Badin et al., 2008). Such organic compounds may be either recalcitrant to degradation or offer low bioavailability. Moreover, our Technosol contained considerable amounts of metal pollutants (see above). Both the complex OM and metal content may impose the selection of bacterial phylotypes adapted to cope with them, with selection occurring for bacterial phylotypes similar to those present in contaminated sites (see Table 2). Indeed, many of the phylotypes found here have previously been found in polluted environments such as contaminated soils and wastewater (Table 2) and could be involved in the degradation of complex OM.

Table 2. Report of several bacterial strains in various environments
EnvironmentsBacterial strains observed
Wastewater treatment and activated sludgeAquaspirillum psychrophilum (Morgan-Sagastume et al., 2008), Simplicispira (Grabovich et al., 2006), Leptothrix (Kraigher et al., 2008), Thermomonas brevis (Mergaert et al., 2003), Afipia (Cole et al., 2004), Nocardiodaceae (Yoon & Park, 2006), Algoriphagus (Okabe et al., 2007)
Heavy metal-contaminated soil and sedimentMicrocoleus (Trzcińska & Pawlik-Skowrońska, 2008)
Oil-contaminated soil and sedimentNitzchia frustulum (Paissé et al., 2008), Acidovorax (Li et al., 2008; Paissé et al., 2008), Comamonadaceae, Janthinobacterium agaricidamnosum, Sphingomonadaceae, Rhodobacter, Clostridium, Flavobacterium (Li et al., 2008), Microbacterium (Evtushenko & Takeuchi, 2006), Leptothrix (Omoregie et al., 2008), Xanthomonas (Kim & Crowley, 2007; Paissé et al., 2008), Skermanella (Kim & Crowley, 2007), Afipia (Nogales et al., 2001), Erythromicrobium (Leys et al., 2004)
Extreme habitatsErythromicrobium (Rathgeber et al., 2008), Silanimonas lenta (Manucharova et al., 2008), Taxeobacter (Reichenbach, 2006)

The abundance of Cyanobacteria was unexpected. This phylum was considered to be competitive in the absence of a large pool of organic carbon, such as in desert and early successional soils formed from receding glacier soil (Gundlapally & Garcia-Pichel, 2006; Nemergut et al., 2007). Urban sediments can be considered to lack a large pool of bioavailable OM, because its OM is complex and recalcitrant to degradation. In this context, the presence of photosynthetic autotrophs (Cyanobacteria and algae) suggest that C fixation by photosynthesis would be more competitive than OM degradation (Badin et al., 2008). Thus, this urban sediment harboured bacterial communities with different C uptake characteristics (photosynthesis and OM degradation). It is tempting to speculate that the behaviour of part of the microbial community feeding on recalcitrant OM is oligotrophic, as it is not competitive enough to preclude Cyanobacteria development.

It is noteworthy that large proportions of Cyanobacteria are present in the early stages of soil formation in the absence of vegetation, for instance in desert biological crusts (Garcia-Pichel et al., 2001; Gundlapally & Garcia-Pichel, 2006; see also below), tailing dumps resulting from a former Zn-Cd mine (Trzcińska & Pawlik-Skowrońska, 2008) and early successional soils from a receding glacier (Nemergut et al., 2007). The presence of this pioneer phylum suggests that this urban sediment is a soil in early successional state. As expected, these results underline functional differences between natural soils and our urban sediments.

Microbial distribution within soil fractions

Reports in the literature on the influence of aggregation on microbial community structure provide contrasting evidence. Although the differential distribution of microbial communities was not observed (Blackwood et al., 2006; Kim et al., 2008) in agricultural soils, Sessitsch et al. (2001) showed that particle size has a notable impact on microbial diversity and community structure. This also seems to be the case for urban sediments as judged by molecular profile analysis. Moreover, our molecular analyses further support the distinction between microbial communities of micropores (aggregates) and macropores (outer, leachable fraction) previously observed (Hattori & Hattori, 1976; Ranjard et al., 2000; Mummey et al., 2006). However, the fungal communities from the bulk, > 1000 and aggregated fractions were heterogeneous, indicating a lack of structure of this community at the scale studied here. It is possible that increasing the sampling scale (the whole basin rather than the plot) or increasing the amount of soil extracted would reveal a structure. However, it is also possible that the fungal community has not yet been structured and that we captured a dispersal phase. Indeed, the Technosol may not be an appropriate habitat, as the complexity of the OM present may preclude utilization by fungi. This hypothesis is also supported by the presence of photosynthetic organisms, which indirectly supports the proposal of Technosol as a pioneer soil (see below).

Another important point is the presence of pathogenic bacteria that may leach towards the groundwater. It is important to stress that the methods used here are not specific for pathogenic bacteria and are insufficiently accurate. Nonetheless, Arcobacter sp. a strain reported to be of faecal origin, was found in the leachable fraction, a finding further supported by the presence of faecal sterols [wastewater markers (coprostanol, coprostanone, 24-ethyl-coprostanol) reported in these specific sediments (Badin et al., 2008)]. More appropriate methods are needed to asses this point.

Bacterial communities associated with aggregates recalls pioneer soils phylums

The sizes and proportions of the aggregated fraction were first evaluated, and the fractionation protocol was designed to keep the most representative aggregated fraction: 160–1000 μm. Several phylotypes were shown to be preferentially associated with this fraction, M. vaginatus being that most represented. This bacterium has been described as a large, highly mobile, filamentous species lacking a heterocyst (unable to fix N2), that is also ubiquitous and capable of colonizing soils within only a few days after soil disturbance if the soil is wet (Belnap, 2002). Indeed, M. vaginatus was previously observed to dominate certain biological soil crust communities. Biological soil crusts are the topmost layers of the soil wherever higher plant cover is restricted, most notably in arid regions (Garcia-Pichel et al., 2001; Gundlapally & Garcia-Pichel, 2006). Although the urban sediment studied here presents a high water content, the low bioavailability of OM (see above), causes it to be like pioneer soils and thus poor in nutriments, with selection occurring preferentially for autotrophic bacteria. The pioneering role of M. vaginatus may be related to the transformation of sediment structure. Indeed, M. vaginatus was reported to contribute to soil microstructure by coating, enmeshing, binding and gluing particles (Malam Issa et al., 2007).

Other Cyanobacteria, heterotrophic bacteria and fungi also contribute to the formation of biological soil crusts (Garcia-Pichel et al., 2001; Gundlapally & Garcia-Pichel, 2006). Roeselers et al. (2007) reported the study of successional changes of community composition of freshwater phototrophic biofilms growing on polycarbonate slides and inoculated with biofilm samples obtained from the sedimentation tank of a wastewater treatment plant. They reported the dominance of M. vaginatus and the presence of other phylotypes: algae (S. obliquus), some Bacteriodetes (Cytophagales, Taxeobacter) and some Betaproteobacteria (Acidovorax). Interestingly, we also observed the phylotypes just cited. The question remains about the N supply that may be contributed by heterocystous Cyanobacteria, although they were not found here. The absence of N2 fixing Cyanobacteria in our data set can be explained by failure to extract DNA from these strains [because of their thick extracellular sheaths (Garcia-Pichel et al., 2001)]. It is also possible that the inline image present in our samples (Badin et al., 2011) was sufficient to support growth of bacteria.

Bacterial communities associated with leachable fraction reveals habitat fragmentation

When water infiltrates through a porous material, the advective flow is mostly driven by macropores. Indeed, as much as 1410 μg of Zn, 224 μg of Cu and 8% and 10% of the total bacterial and fungal biomasses respectively were leached from the same Technosol in a controlled drying experiment carried out in a laboratory column (Badin et al., 2011). Here, the leachable fraction fits with the macroporosity present. The leachable bacterial community (macroporosity) is clearly different from those of the nonfractionated sediments and other fractions (Fig. 2). Phylotypes related to the following species were identified only or preferentially in the leachable fraction: Sphingomonas sp., A. defluvii, Arcobacter sp., Sphingobacteriaceae, Crenotrichaceae, Nocardioides, Microbacterium, Clostridium, Fusibacter and Anaerovorax. Some are known to grow preferentially anaerobically (i.e. Clostridium (Wiegel et al., 2006), Anaerovorax sp. (Matthies et al., 2000) and others, aerobically [i.e. Microbacterium (Evtushenko & Takeuchi, 2006)]. Thus, the bacterial composition suggests that the macroporosity not only is a uniform aerobic habitat, but also comprises anaerobic regions. This is compatible with the present knowledge on urban sediments. The Technosol fraction is a porous material for which around 50% of the pores were filled with water, giving rise to aquatic and aerial niches. Additionally, the different drainage times may have led to different levels of dissolved O2 (Lassabatere et al., 2010). The composition of the bacterial community provides an accurate reflection of at least two microenvironments differing in O2 content. Thus, even such small fractions exhibit heterogeneous habitats.

Conclusion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

This study described the characteristics of the microbial communities found in urban sediment resulting from stormwater infiltration facilities. The distribution of bacteria and fungi in the microstructure was also investigated by the analyses of the leachable fraction (macroporosity) and different grain-size fractions. While fungal biomass is more abundant in the macropores, bacteria are present in both macro- and micropores.

Genotypic diversity of both bacterial and fungal communities highlighted not only the heterogeneity of niches in the larger fraction (> 1000 μm), but also similarity for smaller fractions. The bacterial communities of the micropores differed strongly from those of the macropores. The bacterial communities of the aggregate fraction were compatible with those of poor soil habitats or contaminated material, whereas the leachable fraction revealed the presence of microenvironments.

The succession of microbial communities through time should be investigated further. Moreover, the fate of the leached microorganisms in the subsoil requires investigation to assess the risk for groundwater quality.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

The work presented was funded in part by the ECOPLUIE project backed by the PRECODD research program (2005) (no. ANR: ANR-05-ECOT-006-07, no. ADEME: 0594C-0089) and the Ministère de l'Ecologie, de l'Energie, du Développement Durable et de l'Aménagement du Territoire – Direction de la recherche et de l'innovation (Convention no. 07 DST S 002). We also thank the two anonymous reviewers whose comments have considerably improved the paper. It was also carried out in the framework of the regional observatory on urban hydrology (OTHU).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information
  • Badin A-L, Faure P, Bedell J-P & Delolme C (2008) Distribution of organic pollutants and natural organic matter in urban storm water sediments as a function of grain size. Sci Total Environ 403: 178187.
  • Badin A-L, Bedell J-P & Delolme C (2009a) Effect of water content on aggregation and contaminant leaching: the study of an urban Technosol. J Soil Sediment 9: 653663.
  • Badin A-L, Méderel G, Béchet B, Borschneck D & Delolme C (2009b) Study of the aggregation of the surface layer of Technosols from stormwater infiltration basins using grain size analyses with laser diffractometry. Geoderma 153: 163171.
  • Badin A-L, Monier A, Volatier L, Geremia RA, Delolme C & Bedell J-P (2011) Structural stability, microbial biomass and community composition of sediments affected by the hydric dynamics of an urban stormwater infiltration basin. Microbiol Ecol 61: 885897.
  • Belnap J (2002) Nitrogen fixation in biological soil crusts from southeast Utah, USA. Biol Fertil Soils 35: 128135.
  • Blackwood CB, Dell CJ, Smucker AJM & Paul EA (2006) Eubacterial communities in different soil macroaggregate environments and cropping systems. Soil Biol Biochem 38: 720728.
  • Boix-Fayos C, Calvo-Cases A, Imeson AC & Soriano-Soto MD (2001) Influence of soil properties on the aggregation of some Mediterranean soils and the use of aggregate size and stability as land degradation indicators. Catena 44: 4767.
  • Capilla X, Schwartz C, Bedell JP, Sterckeman T, Perrodin Y & Morel JL (2006) Physicochemical and biological characterisation of different dredged sediment deposit sites in France. Environ Pollut 143: 106116.
  • Chenu C & Stotzky G (2002) Interaction between microorganisms and soil particles: an overview. Interactions between Soil Particles and Microorganisms (Huang PM, Bollag J-M & Senesi N, eds), pp. 571. John Wiley and Sons, New York.
  • Clozel B, Ruban V, Durand C & Conil P (2006) Origin and mobility of heavy metals in contaminated sediments from retention and infiltration ponds. Appl Geochem 21: 17811798.
  • Cole JR, Chai B, Marsh TL et al. (2003) The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy. Nucleic Acids Res 31: 442443.
  • Cole AC, Semmens MJ & LaPara TM (2004) Stratification of activity and bacterial community structure in biofilms grown on membranes transferring oxygen. Appl Environ Microbiol 70: 19821989.
  • Datry T, Malard F & Gibert J (2004) Dynamics of soluted and dissolved oxygen in shallow urban groundwater below a stormwater infiltration basin. Sci Total Environ 329: 215229.
  • Djajakirana G, Joergensen RG & Meyer B (1996) Ergosterol and microbial biomass relationship in soil. Biol Fertil Soils 22: 299304.
  • Dray S & Dufour AB (2007) The ade4 package: implementing the duality diagram for ecologists. J Stat Softw 22: 120.
  • Durand C, Ruban V, Ambles A & Oudot J (2004) Characterization of the organic matter of sludge: determination of lipids, hydrocarbons and PAHs from road retention/infiltration ponds in France. Environ Pollut 132: 375384.
  • Durand C, Ruban V & Amblès A (2005) Characterisation of complex organic matter present in contaminated sediments from water retention ponds. J Anal Appl Pyrolysis 73: 1728.
  • Edwards AP & Bremner JM (1967) Microaggregates in soils. J Soil Sci 18: 6473.
  • Evtushenko LI & Takeuchi M (2006) The family Microbacteriaceae. The Prokaryotes, Vol. 3 (York SN, ed), pp. 10201098. Springer, New York.
  • FAO (Food and Agriculture Organization of the United Nations), IUSS (International Union of Soil Sciences), ISRIC (International Soil Reference and Information Centre) (2006) World reference base for soil resources. A framework for international classification, correlation and communication, Rome, Italy p. 128. ISBN: 92-5-105511-4. (http://www.fao.org/ag/agl/agll/wrb/doc/wrb2006final.pdf).
  • Franklin RB & Mills AL (2007) Introduction. The Spatial Distribution of Microbes in the Environment (Franklin RB & Mills AL, eds), p. 333. Springer, Dordrecht, the Netherlands.
  • Garcia-Pichel F, López-Cortés A & Nübel U (2001) Phylogenetic and morphological diversity of Cyanobacteria in soil desert crusts from the Colorado Plateau. Appl Environ Microbiol 67: 19021910.
  • Grabovich M, Gavrish E, Kuever J, Lysenko AM, Podkopaeva D & Dubinina G (2006) Proposal of Giesbergeria voronezhensis gen. nov., sp. nov. and G. kuznetsovii sp. nov. and reclassification of [Aquaspirillum] anulus, [A.] sinuosum and [A.] giesbergeri as Giesbergeria anulus comb. nov., G. sinuosa comb. nov. and G. giesbergeri comb. nov., and [Aquaspirillum] metamorphum and [A.] psychrophilum as Simplicispira metamorpha gen. nov., comb. nov. and S. psychrophila comb. nov. Int J Syst Evol Microbiol 56: 569576.
  • Grundmann GL (2004) Spatial scales of soil bacterial diversity – the size of a clone. FEMS Microbiol Ecol 48: 119127.
  • Gundlapally SR & Garcia-Pichel F (2006) The community and phylogenetic diversity of biological soil crusts in the Colorado Plateau studied by molecular fingerprinting and intensive cultivation. Microb Ecol 52: 345357.
  • Gury J, Zinger L, Gielly L, Taberlet P & Geremia RA (2008) Exonuclease activity of proofreading DNA polymerases is at the origin of artifacts in molecular profiling studies. Electrophoresis 29: 24372444.
  • Hattori T & Hattori R (1976) The physical environment in soil microbiology: an attempt to extend principles of microbiology to soil microorganisms. CRC Crit Rev Microbiol 4: 423461.
  • Huber T, Faulkner G & Hugenholtz P (2004) Bellerophon: a program to detect chimeric sequences in multiple sequence alignments. Bioinformatics 20: 23172319.
  • Hussein J & Adey MA (1998) Changes in microstructure, voids and b-fabric of surface samples of a Vertisol caused by wet/dry cycles. Geoderma 85: 6382.
  • Janssen PH (2006) Identifying the dominant soil bacterial taxa in libraries of 16S rRNA and 16S rRNA genes. Appl Environ Microbiol 72: 17191728.
  • Jocteur Monrozier L, Ladd JN, Fitzpatrick RW, Foster RC & Rapauch M (1991) Components and microbial biomass content of size fractions in soils of contrasting aggregation. Geoderma 50: 3762.
  • Kembel S, Cowan P, Helmus M, Cornwell W, Morlon H, Ackerly D, Blomberg S & Webb CO (2010) picante: R tools for integrating phylogenies and ecology. Bioinformatics. 26(11): 14631464.
  • Kepner RL Jr & Pratt JR (1994) Use of fluorochromes for direct enumeration of total bacteria in environmental samples: past and present. Microbiol Rev 58: 603615.
  • Kim JS & Crowley DE (2007) Microbial diversity in natural asphalts of the Rancho La Brea Tar Pits. Appl Environ Microbiol 73: 45794591.
  • Kim J-Y & Sansalone JJ (2008) Event-based size distributions of particulate matter transported during urban rainfall-runoff events. Water Res 42: 27562768.
  • Kim JS, Dungan RS & Crowley D (2008) Microarray analysis of bacterial diversity and distribution in aggregates from a desert agricultural soil. Biol Fertil Soils 44: 10031011.
  • Kraigher B, Kosjek T, Heath E, Kompare B & Mandic-Mulec I (2008) Influence of pharmaceutical residues on the structure of activated sludge bacterial communities in wastewater treatment bioreactors. Water Res 42: 45784588.
  • Kumar S, Tamura K & Nei M (2004) MEGA3: integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform 5: 150163.
  • Lassabatere L, Angulo-Jaramillo R, Goutaland D, Letellier L, Gaudet JP, Winiarski T & Delolme C (2010) Effect of the settlement of sediments on water infiltration in two urban infiltration basins. Geoderma 156: 316325.
  • Leys NMEJ, Ryngaert A, Bastiaens L, Verstraete W, Top EM & Springael D (2004) Occurrence and phylogenetic diversity of Sphingomonas strains in soils contaminated with Polycyclic Aromatic Hydrocarbons. Appl Environ Microbiol 70: 19441955.
  • Li D, Yang M, Li Z, Qi R, He J & Liu H (2008) Change of bacterial communities in sediments along Songhua River in Northeastern China after a nitrobenzene pollution event. FEMS Microbiol Ecol 65: 494503.
  • Malam Issa O, Defarge C, Le Bissonnais Y, Marin B, Duval O, Bruand A, D'Acqui LP, Nordenberg S & Annerman M (2007) Effects of the inoculation of cyanobacteria on the microstructure and the structural stability of a tropical soil. Plant Soil 290: 209219.
  • Manucharova NA, Vlasenko AN, Tourova TP, Panteleeva AN, Stepanov AL & Zenova GM (2008) Thermophilic chitinolytic microorganisms of brown semidesert soil. Microbiology 77: 610614.
  • Marchesi JR, Sato T, Weightman AJ, Martin TA, Fry JC, Hiom SJ & Wade WG (1998) Design and evaluation of useful bacterium-specific PCR primers that amplify genes coding for bacterial 16S rRNA. Appl Environ Microbiol 64: 795799.
  • Martin JP, Martin WP, Page JB, Raney WA & De Ment JD (1955) Soil aggregation. Adv Agron 7: 137.
  • Matthies C, Evers S, Ludwig W & Schink B (2000) Anaerovorax odorimutans gen. nov., sp. nov., a putrescine-fermenting, strictly anaerobic bacterium. Int J Syst Evol Microbiol 50: 15911594.
  • Mergaert J, Cnockaert MC & Swings J (2003) Thermomonas fusca sp. nov. and Thermomonas brevis sp. nov., two mesophilic species isolated from a denitrification reactor with poly(E-caprolactone) plastic granules as fixed bed, and emended description of the genus Thermomonas. Int J Syst Evol Microbiol 53: 19611966.
  • Mermillod-Blondin F, Nogaro G, Vallier F & Gibert J (2008) Laboratory study highlights the key influences of stormwater sediment thickness and bioturbation by tubificid worms on dynamics of nutrients and pollutants in stormwater retention systems. Chemosphere 72: 213223.
  • Morgan-Sagastume F, Nielsen JL & Nielsen PH (2008) Substrate-dependent denitrification of abundant probe-defined denitrifying bacteria in activated sludge. FEMS Microbiol Ecol 66: 447461.
  • Mummey D, Holben W, Six J & Stahl P (2006) Spatial stratification of soil bacterial populations in aggregates of diverse soils. Microb Ecol 51: 404411.
  • Murakami M, Nakajima F & Furumai H (2008) The sorption of heavy metal species by sediments in soakaways receiving urban road runoff. Chemosphere 70: 20992109.
  • Nemergut DR, Anderson SP, Cleveland CC, Martin AP, Miller AE, Seimon A & Schmidt SK (2007) Microbial community succession in an unvegetated, recently deglaciated soil. Microb Ecol 53: 110122.
  • Neto M, Ohannessian A, Delolme C & Bedell JP (2007) Towards an optimized protocol for measuring global dehydrogenase activity in storm-water sediments. J Soils Sediments 7: 101110.
  • Nogales B, Moore ERB, Llobet-Brossa E, Rossello-Mora R, Amann R & Timmis KN (2001) Combined use of 16S Ribosomal DNA and 16S rRNA to study the bacterial community of Polychlorinated Biphenyl-polluted soil. Appl Environ Microbiol 67: 18741884.
  • Oades JM (1988) The retention of organic matter in soils. Biogeochemistry 5: 3570.
  • Okabe S, Odagiri M, Ito T & Satoh H (2007) Succession of sulfur-oxidizing bacteria in the microbial community on corroding concrete in sewer systems. Appl Environ Microbiol 73: 971980.
  • Omoregie EO, Mastalerz V, De Lange G, Straub KL, Kappler A, Røy H, Stadnitskaia A, Foucher J-P & Boetius A (2008) Biogeochemistry and community composition of iron- and sulfur-precipitating microbial mats at the Chefren mud volcano (Nile deep sea fan, eastern Mediterranean). Appl Environ Microbiol 74: 31983215.
  • Paissé S, Coulon F, Goñi-Urriza M, Peperzak L, McGenity TJ & Duran R (2008) Structure of bacterial communities along a hydrocarbon contamination gradient in a coastal sediment. FEMS Microbiol Ecol 66: 295305.
  • Pallud C, Dechesne A, Gaudet J-P, Debouzie D & Grundmann GL (2004) Modification of spatial distribution of 2,4-dichlorophenoxyacetic acid degrader microhabitats during growth in soil columns. Appl Environ Microbiol 70: 27092716.
  • Petavy F & Ruban V (2005) Estimation des gisements (LCPC, ed.), pp. 5254. LCPC, Bouguenais, France.
  • Pitt R, Clark S & Field R (1999) Groundwater contamination potential from stormwater infiltration practices. Urban Water J 1: 217236.
  • Porter KG & Feig YS (1980) The use of DAPI for identifying and counting aquatic microflora. Limnol Oceanogr 25: 943948.
  • Ramette A (2007) Multivariate analyses in microbial ecology. FEMS Microbiol Ecol 62: 142160.
  • Ranjard L, Richaume A, Jocteur Monrozier L & Nazaret S (1997) Response of soil bacteria to Hg(II) in relation to soil characteristics and cell location. FEMS Microbiol Ecol 24: 321331.
  • Ranjard L, Nazaret S, Gourbière F, Thioulouse J, Linet P & Richaume A (2000) A soil microscale study to reveal the heterogeneity of Hg(II) impact on indigenous bacteria by quantification of adapted phenotypes and analysis of community DNA fingerprints. FEMS Microbiol Ecol 31: 107115.
  • Rathgeber C, Lince MT, Alric J et al. (2008) Vertical distribution and characterization of aerobic phototrophic bacteria at the Juan de Fuca Ridge in the Pacific Ocean. Photosynth Res 97: 235244.
  • Reichenbach H (2006) Chapter 6.7: The order Cytophagales. Prokaryotes, Vol. 7 (Dworkin M, ed), pp. 549590. Springer, New York.
  • Roesch LF, Fulthorpe RR, Riva A, Casella G, Hadwin AKM, Kent AD, Daroub SH, Camargo FAO, Farmerie WG & Triplett EW (2007) Pyrosequencing enumerates and contrasts soil microbial diversity. ISME J 1: 283290.
  • Roeselers G, Van Loosdrecht MCM & Muyzer G (2007) Heterotrophic pioneers facilitate phototrophic biofilm development. Microb Ecol 54: 578585.
  • Ruban V (2005) Caractérisation et gestion des sédiments de l'assainissement pluvial. Génie urbain EG 19, Laboratoire Central des Ponts et Chaussées (LCPC), Paris. p. 151.
  • Saulais M, Bedell J-P & Delolme C (2011) Cd, Cu and Zn mobility in contaminated sediments from an infiltration basin colonized by wild plants: the case of Phalaris arundinacea and Typha latifolia. Water Sci Technol 64: 255262.
  • Schwieger F & Tebbe CC (1998) A new approach to utilize PCR-single-strand-conformation polymorphism for 16S rRNA gene-based microbial community analysis. Appl Environ Microbiol 64: 48704876.
  • Sessitsch A, Weilharter A, Gerzabek MH, Kirchmann H & Kandeler E (2001) Microbial population structures in soil particle size fractions of a long-term fertilizer field experiment. Appl Environ Microbiol 67: 42154224.
  • Team RDC (2008) R: A Language and Environment for Statistical Computing. Computing RFfS, Vienna, Austria.
  • Thompson JD, Higgins DG & Gibson TJ (1994) Clustal-W – improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acid Res 22: 46734680.
  • Tisdall JM & Oades JM (1982) Organic matter and water-stable aggregates in soils. J Soil Sci 33: 141163.
  • Trzcińska M & Pawlik-Skowrońska B (2008) Soil algal communities inhabiting zinc and lead mine spoils. J Appl Phycol 20: 341348.
  • Webb CO, Ackerly DD, McPeek MA & Donoghue MJ (2002) Phylogenies and community ecology. Annu Rev Ecol Evol Syst 33: 475505.
  • Wiegel J, Tanner R & Rainey F (2006) An introduction to the family Clostridiaceae. The Prokaryotes, Vol. 4 (York SN, ed), pp. 654678. Springer, New York.
  • Winiarski T, Bedell JP, Delolme C & Perrodin Y (2006) The impact of stormwater on a soil profile in an infiltration basin. Hydrogeol J 14: 12441251.
  • Yoon JH & Park YA (2006) The genus Nocardioides. The Prokaryotes (Dworkin M, ed), pp. 10991113. Springer, New York.
  • Young IM & Crawford JW (2004) Interactions and self-organization in the soil-microbe complex. Science 304: 16341637.
  • Zinger L, Gury J, Giraud F, Krivobok S, Gielly L, Taberlet P & Geremia RA (2007) Improvements of polymerase chain reaction and capillary electrophoresis single-strand conformation polymorphism methods in microbial ecology: toward a high-throughput method for microbial diversity studies in soil. Microb Ecol 54: 203216.
  • Zinger L, Gury J, Alibeu O, Rioux D, Gielly L, Sage L, Pompanon F & Geremia RA (2008) CE-SSCP and CE-FLA, simple and high-throughput alternatives for fungal diversity studies. J Microbiol Methods 72: 4253.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information
FilenameFormatSizeDescription
fem1354-sup-0001-FigureS1.tifimage/tif207KFig. S1. Phylotypes diversity in the leachable fraction.
fem1354-sup-0002-FigureS2.tifimage/tif268KFig. S2. Phylotypes diversity in the aggregates.
fem1354-sup-0003-FigureS3.tifimage/tif338KFig. S3. Collector curves for MOTUs at 97% of similarity.
fem1354-sup-0004-FigureS4.tifimage/tif342KFig. S4. Collector curves for MOTUs at the order level.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.