A CARD-FISH protocol for the identification and enumeration of cyanobacterial akinetes in lake sediments

Authors


Correspondence: Assaf Sukenik, Israel Oceanographic & Limnological Research, Yigal Allon Kinneret Limnological Laboratory, PO Box 447 Migdal 14950 Israel. Tel.: +972 505621228; fax: +972 4 6724627; e-mail: assaf@ocean.org.il

Abstract

Akinetes are the dormant cells of Nostocales (cyanobacteria) that enable the organisms to survive harsh environmental conditions while resting in bottom sediments. The germination of akinetes assists the dispersal and persistence of the species. The assessment of the akinete pool in lake sediments is essential to predict the bloom formation of the Nostocales population. We present here the implementation of an improved catalysed reporter deposition (CARD)–fluorescence in situ hybridization (FISH) protocol to assist the identification and quantification of akinetes in sediment samples. Several 16S rRNA gene oligonucleotide probes were evaluated for labelling akinetes of various species of Anabaena, Aphanizomenon and Cylindrospermopsis. Akinetes of all the taxa studied were successfully labelled and could be easily detected by their bright fluorescence signal. The probes' specificity was tested with 32 strains of different taxa. All six Cylindrospermopsis raciborskii strains were labelled with a specific probe for its 16S rRNA gene. A more general probe labelled 73% of the Anabaena and Aphanizomenon strains. The counting data of field samples obtained with CARD-FISH and the regular light microscopy approach did not differ significantly, confirming the suitability of both methods. The CARD-FISH approach was found to be less time-consuming because of better visibility of akinetes.

Introduction

Akinetes, which are differentiated resting cells produced by many species of filamentous, heterocystous cyanobacteria, enable the organism to survive in adverse conditions, such as cold winters and dry seasons, and to maintain germination capabilities until the onset of suitable conditions for vegetative growth. Akinetes maintain a low level of metabolic activity, including photosynthesis, respiration and de novo synthesis of proteins and lipids (Thiel and Wolk 1983; Rai et al. 1985; Sarma and Ghai 1998) and can stay viable for decades (Stockner & Lund, 1970; Livingstone & Jaworski, 1980). They germinate in response to resuspension and improved environmental conditions, mainly light and temperature (Huber, 1985; Baker & Bellifemine, 2000; Karlsson-Elfgren et al., 2004; Kaplan-Levy et al., 2010). Thus, akinetes provide a potential inoculum for Nostocales growth (Baker, 1999). Baker (1999) monitored akinetes in the Murray River, Australia, to determine the extent of sporulation and contribution of recruitment from sediments. Rücker et al. (2009) showed for a shallow lake in north-eastern Germany that the akinete ‘seed bank’ in the sediment built up after the pelagic population maximum was reached, but unknown loss processes reduced the number of viable akinetes by 34–50% during winter. Similar observations on seasonal patterns of akinete abundances in sediments were also reported from a small Korean reservoir by Kim et al. (2005). Apart from these few studies, we lack the quantitative knowledge required to evaluate and model akinete germination in the context of the Nostocales life cycle and successive bloom formation (Hense & Beckmann, 2006, 2010; Jöhnk et al., 2011).

So far, the enumeration of akinetes in lake sediments has been performed using light microscopy mainly according to the method of Utermöhl (1958). Sedimentation chambers were filled with diluted sediment samples, and the akinetes were counted with an inverse microscope (Head et al., 1999; Rücker et al., 2009; Suikkanen et al., 2010). Other counting methods using Fuchs-Rosenthal, Sedgewick-Rafter or a haemocytometer have been reported (Hori et al., 2003; Tsujimura, 2004; Kravchuk et al., 2006). However, these methods have several shortcomings. Firstly, it is highly time-consuming and laborious to spot akinetes in the sediment sample because of their low abundance relative to sediment particles of various sizes and shapes. Secondly, in many cases, it is difficult to identify akinetes unambiguously over the sediment background and because they are very similar in size and shape to some benthic diatoms (e.g. Navicula) or to cysts of chrysophytes.

The overall aim of this study was to validate and implement a catalysed reporter deposition–fluorescence in situ hybridization (CARD-FISH) technique to assist in the identification and enumeration of akinetes in sediment samples from lakes. Several oligonucleotide probes targeted at the 16S rRNA gene of Nostocales were applied, and their specificity was examined with isolated akinetes and trichomes from 32 culture strains. Finally, CARD-FISH-assisted enumerations of akinetes in sediment samples were validated by comparative counts using the Utermöhl (1958) method.

Materials and methods

Culture cultivation and sediment sampling

Various species of Nostocales were cultivated in BG11 (Stanier et al., 1971) or Z8 (Kotai, 1972) medium in a 12 : 12 h light/dark cycle (80 μmol photon m−2 s−1) at 20 °C. All the Nostocales species and strains used in this study are listed in Table 2. Isolated akinetes were prepared from three cultures of Nostocales species (Aphanizomenon ovalisporum, Anabaena planctonica and Cylindrospermopsis raciborskii). For the isolation of akinetes, 100 mM HCl was used to lower the pH of the cultures to 4.0 to destroy vegetative cells. Acidified samples were kept in darkness for 24 h at 4 °C until the akinetes were harvested. The remaining floating filaments and disintegrated cell debris were removed by aspiration or low-speed centrifugation. The akinetes gathered were washed and resuspended in fresh medium. Alternatively, akinetes were harvested from A. ovalisporum culture cultivated for 3 weeks in BG11 lacking potassium, as previously described (Sukenik et al., 2007).

Sediment sampling and culture cultivation

Sediment samples were collected from Lake Kinneret (Sea of Galilee 32°47′N; 35°34′E), Israel, and from two lakes in NE Germany: Lake Scharmützelsee (52°14′N; 14°02′E) and Lake Stechlinsee (53°10′N; 13°02′E). Sampling was carried out during 2008 and 2009. At each site studied, sediment cores were collected from the deepest point of the lake with Perspex tubes (50 mm diameter) using a Tessenow sampler (Tessenow et al., 1977) or an Uwitec corer (Uwitec, Mondsee, Austria). The sediment cores were sliced into 1-cm sections, and corresponding layers of three cores were pooled and mixed to minimize heterogeneity at the sampling site. The samples were transported in dark boxes to the laboratory and then stored at 4 °C until further analysis. In addition, particulate material settling in the water column was collected by sediment traps installed 2–3 m above the bottom in Lake Kinneret. The trap consisted of four PVC tubes, 10 cm in diameter and 60 cm long. A bottle was screwed to the bottom of each tube to collect the settling sediment (Koren & Klein, 2000). Sediment traps were replaced every 21–30 days by a diver.

CARD-FISH method modification and optimization

The CARD-FISH method (Schönhuber et al., 1999) was adjusted to label akinetes of the Nostocales species using horse-radish peroxidase HRP-conjugated primers designed for the short domain of the 16S rRNA gene of the target cyanobacteria. The method calls for five sequential steps: (1) fixation, (2) permeabilization, (3) hybridization, (4) tyramid signal amplification (TSA) and (5) visualization under fluorescence microscopy. The steps of the protocol and various modifications examined during the method verification process are described in detail later and are schematically shown in Fig. 1.

  1. Fixation – A volume of 200 μL of laboratory culture strain (c. 0.1–0.5 μg chl mL−1), an isolated akinetes suspension (˜ 250 000 akinetes in 200 μL) or sediment sample diluted 1 : 1 in distilled H2O (MQ; Millipore) was mixed with 600 μL paraformaldehyde (4% in PBS – phosphate buffer saline; 130 mM NaCl, 10 mM sodium phosphate buffer, pH 8.4) and incubated at 4 °C for 2 h. After incubation, the formaldehyde solution was removed by centrifugation at 16 000  g for 5 min and the pellet was washed twice in PBS. Subsamples were finally suspended in 1 mL of 1 : 1 PBS : Ethanol mix and stored at −20 °C until further processing. The PBS : Ethanol fixed samples were sonicated in a Branson 5510 sonication bath (Bransonic, CT) for four cycles of 10 min each. The samples were filtered with sterilized MQ water onto white polycarbonate membrane filters (pore size 0.2 μm; Whatman International Ltd, Maidstone, UK) supported by a GF/C filter (Whatman) applying gentle vacuum. Dry filters were embedded in 35–40 °C low-melting-point agarose [Lonza, ME,or MetaPhor Bioproducts, Rockland, Maine; 0.1% (wt/v)] in MQ water to avoid cell loss during cell wall permeabilization. Alternatively, an aliquot of a fixed suspension of filaments or isolated akinetes was spotted on a microscope slide and air-dried for at least 2 h. The slides or the air-dried agar-coated filters were subsequently dehydrated with a series of ethanol washes [50%, 80% and 96% (v/v), 3 min each wash] and air-dried.
  2. Permeabilization – The filters/slides were incubated either in lysozyme solution or in proteinase K solution (10 mg lysozyme mL−1 or proteinase K mL−1, 100 mM Tris-HCl pH 7.5 and 50 mM EDTA) at 37 °C for at least 60 min under low continuous shaking in an Eppendorf Thermomixer (Eppendorf, Hamburg, Germany). The incubation time was adjusted for the lysozyme treatment, as proposed for CARD-FISH of marine picoplankton (Pernthaler et al., 2002) and freshwater Actinobacteria (Sekar et al., 2003). Afterwards, the lysozyme solution was removed by ethanol washing series, as described earlier, or proteinase K solution was removed by three washing steps with MQ water for 1 min, respectively. The samples were then treated for inactivation of endogenous peroxidases with either 10 mM HCl or 0.01% H2O2 for 10 min at room temperature (RT) to reduce potential noise in TSA originating from internal peroxidases (Medina-Sánchez et al., 2005). Subsequently, the samples were washed twice in MQ water for 1 min and dehydrated with 96% ethanol. Dried slides were kept at RT, and dried filters were kept in −20 °C until further use.
  3. Hybridization – Samples were hybridized with HRP-conjugated 16S rRNA gene-targeted probe purchased from Thermo Fisher Scientific or Biomersnet (Ulm, Germany). Three oligonucleotide probes (Table 1) were used: (1) NOSTOC probe for the genera Nostoc, Aphanizomenon and Anabaena (Rudi et al., 2000), (2) APHA probe for Aphanizomenon (Rudi et al., 2000) and (3) CYL probe for C. raciborskii (designed for this study). All probes are available at probeBase, http://www.microbial-ecology.net/probebase/ (Loy et al., 2007). The HRP probe (either NOSTOC, APHA or CYL; 2 μL of 500 ng μL−1) was added to 2 mL of hybridization solution [900 mM NaCl, 20 mM Tris-HCl pH 7.5, 20% (v/v) formamide, 0.01% SDS (sodium dodecyl sulphate), MQ water] and applied to samples on slides or filters. The samples were placed in Petri dishes containing blotting paper dipped in hybridization buffer without the probe or filters and were placed in a reaction tube with hybridization solution and incubated at 35 °C for at least 2.5 h (a higher hybridization temperature might harm the probe-conjugated HRP; Pernthaler et al., 2001). Samples were removed from the hybridization mixture and washed twice for 20 min each at 35 °C in prewarmed washing buffer containing 145 mM NaCl, 20 mM Tris-HCl pH 7.5, 5 mM EDTA, and 0.01% SDS. The samples were exposed to hybridization buffer that did not contain any probe for control experiments.
  4. Tyramide signal amplification (TSA) – Hybridized samples were incubated in TNT buffer (100 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.05% Tween 20) at RT for 15 min to equilibrate the probe-delivered HRP. Subsequently, the samples were dabbed onto blotting paper to remove excess buffer, and fluorophore tyramide working solution was applied onto each sample, following the manufacturer's instructions, and incubated at RT for at least 10 min in the dark. The fluorophore working solution of the TSA Plus fluorescence system kit (Perkin Elmer Life and Analytical Sciences, Shelton, CT) consisted of one part fluorophore tyramide stock solution and 50 parts 1× Plus amplification diluent. Samples were consecutively washed three or four times with TNT buffer for 5 min and were air-dried. Samples were immediately stored at −20 °C for up to several days without any loss of fluorescence signal.
  5. Visualization under Fluorescence Microscopy – Samples were embedded with Citifluor mountant (Citifluor Ltd, London, UK) and visualized using either a Zeiss Axioskop or a Zeiss Axioimager 2 epifluorescence microscope. The following filter sets were applied for a tyramide fluorescence signal: either Zeiss filter set 05 and GFP filter (Zeiss filter set 10) or FITC filter (Zeiss filter set 09). A HBO 100-W Hg vapour lamp, a 40× Plan Apochromat objective and an AxioCam for digital photographs (Carl Zeiss, Jena, Germany) were used. Image analyses were processed with Zeiss software AxioVision. In terms of the evaluation of images, critical values were constituted for the intensity of the fluorescence signal: The signal was defined as ‘strong fluorescence’ when akinetes were visible at an exposure time (ex-t) of 100 ms, ‘weak fluorescence’ at 300 ms ex-t and ‘nonfluorescent’ if no cells were observable at 600 ms ex-t.
Figure 1.

A schematic presentation of the CARD-FISH-procedure and its adjustment for the enumeration of akinetes in sediments (see text for more details).

Table 1. Sequences of oligonucleotide probes used in this study
ProbeAccession no.a Target organism (s)Sequence of probe (5′-3′)Targetb site (rRNA positions)Reference
  1. a

    Oligonucleotide probe sequences from probeBase: http://www.microbial-ecology.net/probebase/ (Loy et al., 2007).

  2. b

    Escherichia coli numbering (Brosius et al., 1978).

  3. c

    Sequence in IUPAC code R = G/A.

  4. d

    M = A/C.

NOSTOCpB-00244 Nostoc, Aphanizomenon, Anabaena GCTCAACCARcATMdARAGCAGTGGAAACTA16S (616–644)Rudi et al. (2000)
APHApB-00025 Aphanizomenon CCCCTAGCTTTCGTCCCTCAGTGTCAGT16S (748–775)Rudi et al. (2000)
CYLpB-02627 Cylindrospermopsis raciborskii TAACAGCAGACTTTCAGTTCCACCTGC16S (580–606)This study

Probe design and test of probe specificity with cultured strains

The CYL probe was designed for C. raciborskii based on its 16S rRNA gene sequence information. The similarity of the NOSTOC and APHA probes with various Anabaena and Aphanizomenon strains was checked by sequence alignment. The specificity of the three probes (Table 1) was firstly examined using isolated akinetes of Aph. ovalisporum, Ana. planctonica and Craciborskii. In a second step, the specificity of the NOSTOC and CYL probes was tested with 32 different cyanobacterial strains. The success of labelling was investigated by image analysis using three different exposure times (as described earlier) to evaluate the intensity of the fluorescence signal.

Impact of sediment dilution on akinete enumeration

Sediment samples were diluted with sterile distilled water before filtering on polycarbonate filters for the counting of akinetes in sediment. The dilution was aimed to improve the separation of akinetes from the bulk of sediment particles without affecting the estimation of akinete concentration in the original undiluted sample. Five dilution rates were tested: 1 : 10, 1 : 20, 1 : 50, 1 : 100 and 1 : 200 (v/v). Dilution experiments were carried out with a sediment sample taken from Lake Scharmützelsee (sampling procedure as described later). Akinetes were labelled with the NOSTOC probe and counted in triplicates always covering the same area of the filter.

Standard addition of akinetes into sediment samples

A standard addition (spiking) experiment was performed to verify the reliability of the enumeration of CARD-FISH labelled akinetes in sediments. Aliquots of 50 μL sediment sample (diluted 1 : 100) were mixed, prior to filtration, with different quantities of akinetes collected from laboratory cultures of Aph. ovalisporum. The number of akinetes that were mixed with the sediment aliquots ranged between 4000 and 23 500. All samples were subjected to hybridization with the APHA probe and staining procedure. The number of CARD-FISH positive akinetes was determined by epifluorescence microscopy, and finally, the original number of akinetes added to each sample was plotted against the number of CARD-FISH positive akinetes.

Comparative counts with the CARD-FISH and Utermöhl method

We used bottom sediment and sediment trap material from three lakes for the comparative counting of akinetes (as described later). For the CARD-FISH enumeration, three aliquots of each sediment sample were diluted 1 : 100 and filtered. Filters were further processed by the modified CARD-FISH protocol using the three probes. The akinetes were counted under a epifluorescence microscope at 400× magnification and covering a known area of the filter.

The CARD-FISH signal in samples from sediment traps was differentiated into akinetes with high-intensity fluorescence and akinetes with normal medium–low fluorescence. It is postulated that the high fluorescence akinetes are those with high functionality and those with a better ability to germinate, assuming that all the akinetes are permeable to the 16S rRNA gene-targeted oligonucleotide probe to the same extent.

For the enumeration according to Utermöhl (1958), aliquots of the sediment samples were diluted 1 : 100 with degassed tap water, fixed with Lugol's solution and put into the sedimentation chamber (HYDRO-BIOS, Kiel, Germany). The akinetes were counted under a Wild M40 or a Nikon Diaphot300 inverted light microscope at 400× magnification and covering a known area of the sedimentation chamber.

Intact akinetes in which the cytoplasm was well labelled and visualized could be distinguished from akinetes in which only the envelope was slightly labelled, but no cell content was observed. The akinetes of Anabaena and Aphanizomenon occurring in natural sediment samples could only be identified on a genus level, except for akinetes of Ana. lemmermannii that are bean shaped and appear in nests of up to 200 akinetes. Owing to its high spatial variability, this species was counted separately.

Statistical analysis

Data were statistically analysed using unpaired two-sample t-test (two-tailed) for the comparisons of mean values obtained in the differently treated samples. A P-value of < 0.05 was considered as statistically significant.

Results

Method modification and optimization

The CARD-FISH method (Schönhuber et al., 1999) was modified and adjusted for the labelling of Nostocales cyanobacteria and their akinetes, firstly, qualitatively for laboratory cultures and then, quantitatively for field samples. The following modifications were examined using NOSTOC probe on sediment samples: application of proteinase K vs. lysozyme to enhance cell permeabilization and use of 10 mM HCl vs. 0.01% H2O2 treatment to inactivate endogenous peroxidases. These modifications were compared quantitatively to negative controls of nonhybridization and nondye samples. The permeabilization by proteinase K yielded a lower number of visible akinetes compared with the lysozyme treatment (Fig. 2a) that was used for further analysis. A marked difference in akinetes counted was observed between hydrochloric- and peroxide-treated samples in an effort to inactivate endogenous peroxidases. Peroxide treatment led to the highest number of akinetes in sediment, but high variability among replicates was recorded (Fig. 2b) and, therefore, not further used. All negative control experiments, those without hybridization process and those without TSA, showed very weak negligible unspecific fluorescence (data not shown).

Figure 2.

Akinete yield after different modifications of the CARD-FISH protocol. (a) permeabilization with proteinase K or lysozyme and (b) inactivation of endogenous peroxidases with HCl or H2O2 . Error bars indicate standard deviation (N = 3).

Hybridization buffer was optimized using different formamide concentrations, and the final washing step was optimized (up to four washes). The concentration of 20% formamide was found to be ideal for all probes applied in this study, and three final washing post-TSA stages were adequate to remove excess fluorescein (not shown).

Probe design and test of probe specificity with culture strains

The alignment of the 16S rRNA gene sequences of various Nostocales strains and the three complementary oligonucleotide probes are shown in Fig. 3. The CYL probe designed matches only to C. raciborskii sequences. The other two probes, NOSTOC and APHA, targeted other regions in the 16S rRNA gene and showed substantial homology with various Aphanizomenon and Anabaena species. Examples of CARD-FISH labelled isolated akinetes from cultures of Aph. ovalisporum (using APHA probe), Ana. planctonica (using NOSTOC probe) and C. raciborskii (using CYL probe) are presented in Fig. 4. All akinetes showed easily observed strong fluorescence signals.

Figure 3.

Alignment of nucleotide sequences of the 16S rRNA gene in the binding region of probes NOSTOC (616–644 bp), APHA (748–775 bp) and CYL (580–606 bp) from Anabaena, Aphanizomenon and Cylindrospermopsis raciborskii strains used in this study (compare with Table 2). Dots represent the same nucleotides as in the probe.

Figure 4.

Bright field and fluorescence micrographs of akinetes (upper panels) and fluorescence micrographs of filaments (lower panels) of Aphanizomenon ovalisporum (left), Anabaena planctonica (middle) and Cylindrospermopsis raciborskii (right) labelled with wither APHA, NOSTOC or CYL probes (labelled white letters). Aph. ovalisporum was not labelled with NOSTOC probe, and Ana. planctonica was not labelled with APHA probe. Pictures taken at magnification 400× with a light microscopy (pictures at top left) or epifluorescence microscopy and an exposure time of 100 ms; scale bar: 10 μm.

The NOSTOC and CYL probes were tested for their specificity with a collection of Nostocales strains and some other non-Nostocales species (Table 2). The NOSTOC probe positively labelled most of the Anabaena and Aphanizomenon strains, but not the strains of C. raciborskii; 73% of the 22 Anabaena and Aphanizomenon strains tested were easily detected with that probe.

Table 2. Specificity of probes NOSTOC and CYL for various Nostocales strains. Two species of the order Chroococcales were used as controls
TaxonStrainGeographic originNOSTOCa CYLa
Nob WeakStrongNoWeakStrong
  1. a

    Probe (see sequences in Table 1).

  2. b

    Fluorescence signals – the signal was defined as ‘strong fluorescence’ when akinetes were visible at an exposure time (ex-t) of 100 ms, ‘weak fluorescence’ as akinetes were visible at 300 ms ex-t and ‘non-fluorescent’ if no cells were only observable at 600 ms ex-t or not observed at all.

  3. c

    Recently was reclassification to the genus Sphaerospermopsis: Sphaerospermopsis aphanizomenoides (Forti) Zapomĕlová, Jezberová, Hrouzek, Hisem, Rĕháková et Komárková, comb. nov. (Zapomĕlová et al., 2009).

Anabaena
 Anabaena bergii AB2008/45Melangsee, GER++
AB2010/02Lake Kinneret, ISR++
AB2010/03Lake Kinneret, ISR++
ZIE26ABZierker See, GER++
 Anabaena circinalis ST08_15Stechlinsee, GER++
 Anabaena crassa AB2008/56Nehmitzsee, GER++
 Anabaena flos-aquae AB2008/22Scharmützelsee, GER++
AB2008/84Nehmitzsee, GER++
 Anabaena planctonica AB2008/24Scharmützelsee, GER++
ST07_195Stechlinsee, GER++
 Anabaena spiroides AB2008/55Langer See, GER ++
Aphanizomenon
 Aphanizomenon aphanizomenoides c 22C4-9Heiliger See, GER++
 Aphanizomenon flos-aquae ST07_115Stechlinsee, GER++
ST07_42Stechlinsee, GER++
 Aphanizomenon gracile AB2008/16Scharmützelsee, GER++
AB2008/31Scharmützelsee, GER++
AB2008/62Langer See, GER++
AB2008/65Melangsee, GER++
 Aphanizomenon issatschenkoi SP08_33Stolpsee, GER++
SP08_34Stolpsee, GER++
 Aphanizomenon ovalisporum AB2010/05Lake Kinneret, ISR++
AB2010/06Lake Kinneret, ISR++
Cylindrospermopsis
 Cylindrospermopsis raciborskii 24G7Kl. Werbellinsee, GER++
AB2010/01Lake Kinneret, ISR++
AB2010/04Lake Kinneret, ISR++
19F6Melangsee, GER++
26D9Rangsdorfer See, GER++
ZIE11CRZierker See, GER++
Anabaenopsis
 Anabaenopsis elenkinii AB2008/61Langer See, GER++
Others
 Chroococcus sp.AB2008/113Scharmützelsee, GER++
 Microcystis aeruginosa 49_018Unknown++
 Microcystis aeruginosa 14_524Unknown++

No fluorescence signals were observed for two Ana. flos-aquae strains and four Aph. gracile strains. The NOSTOC probe did not hybridize with any of the six C. raciborskii strains as they showed no fluorescence signals. The CYL probe hybridized with all C. raciborskii strains studied as an enhanced fluorescence signal was observed (Fig. 4). The CYL probe also labelled eight of 22 Anabaena and Aphanizomenon strains tested. The APHA probe was only tested with one strain of A. ovalisporum and one strain of C. raciborskii. The probe labelled A. ovalisporum but not C. raciborskii (Fig. 4).

Impact of sediment dilution on akinete enumeration

The sediment samples were diluted to reduce the interference of sediment particles in the observation and counting of akinetes. Dilution factors, ranged between 10 and 200, were implied (Fig. 5). The number of akinetes estimated was rather constant at dilution rates 1 : 100 and 1 : 200, but about two times higher than in lower dilution rates. High variability in the akinete number estimated in the original sediment sample was recorded at high dilutions, as the same area of the filter that presented only a fraction of the total filter area was counted in all dilutions. Increasing the area covered during the enumeration decreased the variability, as more akinetes were included in the counting. For further analysis of samples, a dilution of 1 : 100 was used and the filter area covered during the enumeration was adjusted to count between 100 and 200 intact akinetes.

Figure 5.

The effect of sediment dilution on CARD-FISH akinete enumeration. A sediment sample taken from Lake Scharmützelsee was diluted before filtering on polycarbonate filters. Akinetes were labelled with the NOSTOC probe followed by the CARD-FISH protocol and counted in triplicates covering always the same area of the filter. The estimated number of intact akinetes in each filtrated sample is presented as a function of the dilution rate. Error bars indicate standard deviation of triplicate counting.

Verification of CARD-FISH enumeration by standard addition

The number of CARD-FISH positive akinetes in sediment samples amended with a known number was determined and plotted as a function of the number of akinetes added (Fig. 6). The intercept of the line with the y-axis represents the number of akinetes in the original sediment sample. Sediment samples free of externally added akinetes (control) were labelled and counted using the same procedure and yielded very similar numbers of akinetes compared with the standard addition extrapolated value (5500 and 5100 akinetes, respectively).

Figure 6.

Enumeration of Aphanizomenon ovalisporum akinetes in 1 : 100 diluted sediment samples of Lake Kinneret to which known amounts of isolated akinetes were added (‘standard addition’ or ‘spiking’ experiment). All samples were subjected to hybridization with the APHA probe and staining procedure prior to enumeration under fluorescence microscope. A linear relationship between the number of added akinetes and counted akinetes is assumed (r 2 = 0.812), and the intercept of the line with Y-axis represents the number of akinetes initially presented in the sample.

Comparative counts by the CARD-FISH and Utermöhl method

In comparison with the light microscopy approach, the application of CARD-FISH improves the visibility of akinetes in sediment samples because of their fluorescence, as demonstrated in Fig. 7 for Ana. lemmermannii and Aph. ovalisporum. The CARD-FISH labelled akinetes are clearly observed with a defined fluorescence signal over a dark, homogeneous background. However, under light microscopy, the akinetes in sediment samples must be of an appropriate contrast to differentiate them from detritus particles, diatoms and chrysophyceae cysts over a bright heterogeneous background.

Figure 7.

Akinetes in lake sediments: (a) Anabaena lemmermanni of Lake Stechlinsee hybridized by NOSTOC probe under light microscopy (indicated by a circle and arrow) and (b) the same object observed by fluorescence microscopy (c) Cylindrospermopsis raciborskii akinete in Lake Scharmützelsee labelled by CYL probe and observed using light microscope (d) the same object observed by fluorescence microscopy. Scale bar: 10 μm.

The numbers of akinetes determined with CARD-FISH and Utermöhl are in the same order of magnitude for all sediment samples (Figs 8 and 9). There is no general trend indicating higher or lower akinete numbers obtained with the CARD-FISH or Utermöhl method, as the following examples demonstrate. Counting the Aph. ovalisporum akinetes in bottom sediments of Lake Kinneret by CARD-FISH protocol using APHA probe (Fig. 8, upper panel) yielded a smaller (statistically insignificant P < 0.05) mean value of total akinetes relative to the Utermöhl method (20 × 106 and 36 × 106 g−1 DW sediment, respectively). In sediment samples collected in Lake Stechlinsee, comparable numbers of total akinetes (average 4 × 106 g−1 DW sediment) were counted using both methods (Fig. 8, middle panel), although we found considerable differences in the numbers of Anabaena sp. and Ana. lemmermannii akinetes and envelopes (Fig. 8). In the sediments of Lake Scharmützelsee, the mean total number of akinetes identified by CARD-FISH with NOSTOC and CYL probes was nearly equal to the values determined by the Utermöhl method (Fig. 8, lower panel). Anabaena sp. akinetes represented the largest proportion of akinetes in Lake Scharmützelsee sediments, and their abundance was clearly comparable using both methods (an average of 0.35 × 106 g−1 DW sediment). While no akinetes of C. raciborskii were detected in Lake Scharmützelsee sediments by the Utermöhl method, ca. 0.25 × 106 akinetes g−1 DW sediment was detected by CARD-FISH.

Figure 8.

Comparison of akinete numbers determined by the CARD-FISH (left) and the Utermöhl (right) method in sediment samples of the three studied lakes. Error bars indicate standard deviation of triplicate counting.

Figure 9.

Comparison of akinete numbers determined by the CARD-FISH (left) and the Utermöhl (right) method in sediment traps deposited in Lake Kinneret from August to November 2008. Asterisk represents high-intensity fluorescence. Error bars indicate standard deviation (N = 3)

Suspended material collected in sediment traps placed in Lake Kinneret was examined for the presence of akinetes of Aph. ovalisporum using the CARD-FISH protocol with APHA probe in comparison with the Utermöhl light microscopy method (Fig. 9). In these samples, akinetes could be differentiated into cells with high fluorescence intensity (labelled with an asterisk in Fig. 9) and akinetes with medium–low fluorescence (Fig. 9). A similar seasonal trend was obtained by both CARD-FISH and Utermöhl methods, but no clear difference in the number of akinetes estimated by either method was found. In addition, empty envelopes of akinetes were observed in bottom sediments as well as in sediment trap samples (Figs 8 and 9).

The time and costs comparison of CARD-FISH vs. the Utermöhl method showed that CARD-FISH is time-consuming concerning the handling time of protocol steps and more cost intensive (Table 3). However, the advantage of the protocol was to process simultaneously a batch of 24 samples in less than 10 h, and the microscopic counting of 1.5 h was less in time than Utermöhl (4 h). In total, the working time of 2 h for one CARD-FISH-applied sediment sample was two times lower than for one sample worked with the Utermöhl method.

Table 3. Time and cost expenditure of CARD-FISH and Utermöhl method used for visualization and enumeration of Nostocales akinetes in Lake's sediment samples
StepsCARD-FISH protocol (for a batch of 24 samples)
Handling timeReaction time
(1) Fixation4 h2 h
(2) Permeabilization1 h1.5 h
(3) Hybridization3.5 h2.5 h
(4) Tyramide signal amplification1 h25 min
(5) Microscopical counting (for 24 filters)36 h
Total working time (for 24 samples)45.5 h
(for 1 sample)~ 2 h
Costs~ 10 € for 24 samples or
0.42 € per sample
Lower cost in manpower because of shorter observation time
StepsUtermöhl (for one sample)
Handling timeSedimentation time
Sample preparation5 min3 h or longer depending on volume
Microscopical counting (for one sedimentation chamber)4 h
Total working time (for 1 sample)~4 h
CostsLow cost in expendables but high cost in manpower

Discussion

In this study, we successfully validated and implemented CARD-FISH to identify and enumerate cyanobacterial akinetes in sediment samples.

Method modification

The outer cell wall of cyanobacteria consists of a peptidoglycan layer, which is in most cases thicker than in other gram-negative bacteria (Stanier & Cohen-Bazire, 1977). The cell wall of matured akinetes is very robust and comprises different layers with portions of electron-dense substance (Jensen & Clark, 1969). Therefore, a successful fixation and permeabilization of akinetes were required to make cells accessible for the large marker molecule HRP of 40 kDa, which increases with linked molecules such as oligonucleotides (Schönhuber et al., 1999; Pernthaler et al., 2002). Samples that were not treated with lysozyme showed a lower detection level, as indicated by Pernthaler et al. (2002). No positive effect of proteinase K on cell permeability was observed in our study, as also previously reported by Schönhuber et al. (1999). Negative controls without probe yielded negligible fluorescence signals. The embedding of sediment subsamples in low-melting-point agarose on polycarbonate filters was found to be crucial to avoid cell loss during the permeabilization procedure. Unspecific binding of excess probes and dye to sediment particles were overcome by additional washing steps after hybridization and TSA.

The potential advantage of the CARD-FISH application could arise from the intense labelling of ribosomes. The reporter deposition procedure assures that even relatively old akinetes from deeper sediment layers, in which the ribosome content has presumably decreased, will be visualized and detected. It is important to note that in some cases, fluorescence signals of envelopes of empty akinete were observed, presumably due to nonspecific adsorption of residues of 16S rRNA gene to the inner cell wall. However, only viable, intact akinetes (as opposed to empty envelopes) are important for the estimation of Nostocales recruitment and bloom formation and the CARD-FISH is an appropriate detection method.

Probe specificity

The NOSTOC probe and the CYL probe designed are located in the variable region V7, which is the most informative sequence in the 16S rRNA gene region (Rudi et al., 2000). Thereby, the NOSTOC probe includes a few wobble bases to hybridize with different species of Nostoc, Anabaena and Aphanizomenon spp. The APHA probe is located in a conserved region of the 16S rRNA gene, which we assumed not to be specific enough to distinguish between Aphanizomenon and Anabaena spp. As no Anabaena sp. was detected in Lake Kinneret, we concluded that the APHA probe could be useful for the detection of Aphanizomenon akinetes in the sediments of Lake Kinneret.

The CYL probe was suitable to label all Craciborskii strains studied; nevertheless, false positive fluorescence signals were also observed in two Aphanizomenon strains and six Anabaena strains from a total of 22 strains. However, false positive counts in field samples can be excluded because of the clearly different morphology of C. raciborskii akinetes. Moreover, according to the specificity test made on a C. raciborskii strain from Lake Kinneret with APHA probe, no false positive signal was observed.

With the NOSTOC probe, 73% of the Anabaena and Aphanizomenon strains studied were correctly labelled. Therefore, the NOSTOC probe bears the risk of underestimating akinete abundance by 27%. However, the problem of underestimation also applies when using the light microscopy approach, as discussed later. The lower specificity of the probe might be due to wobble bases that were needed to cover a wide range of different taxa.

Method validation

The CARD-FISH enumeration approach was validated by a standard addition experiment that showed a good recovery rate of known amounts of added akinetes in sediment samples. Additionally, the comparative counts with CARD-FISH and Utermöhl clearly showed akinete numbers in the same order of magnitude, which proves that CARD-FISH is a reliable approach for akinete enumeration.

Potentials and Limitations of CARD-FISH vs. the Utermöhl method

Akinetes are hard to distinguish from their background under light microscopy, and the enumeration process is rather slow. The clear advantage of the CARD-FISH method is the excellent visibility of akinetes because of their bright fluorescence. This simplifies the detection and allows for much faster counting of akinetes. The specific fluorescent labelling of akinetes also prevents false positive counts of other sediment particles or organisms of similar size and shape (e.g. diatoms), which can lead to overestimation when using ordinary light microscopy.

False positive counts of C. raciborskii akinetes that are theoretically possible, as the CYL probe also labelled some of the Anabaena and Aphanizomenon strains studied, can be excluded because of the clear morphological differences between the species’ akinetes. The CARD-FISH method bears the risk of underestimation of Anabaena and Aphanizomenon akinetes because the NOSTOC probe did not hybridize with 27% of the strains studied. However, the comparative counting with CARD-FISH and Utermöhl did not reflect a general trend of 27% lower numbers of Anabaena and Aphanizomenon akinetes detected with CARD-FISH. Therefore, it might be possible that the number of akinetes was underestimated with Utermöhl as well because of overlapping sediment clumps and distracting particles that can obscure the view of akinetes. Nevertheless, the comparison between the Utermöhl and CARD-FISH methods does not show a clear trend. In some cases, the Utermöhl method yielded higher values, whereas in other samples, the CARD-FISH assisted enumeration gave a higher akinete number. In all cases, these differences appeared to be statistically insignificant by t-test. The counting error of both methods was found to be relatively high. High counting errors were also found in other studies using different light microscopy approaches (e.g. Kravchuk et al., 2006; Rücker et al., 2009). The reason for this is the relatively low abundance of akinetes (‘the signal’) compared with the highly abundant sediment particles of various shapes and sizes (‘the noise’). Of course, the counting error in both methods could be reduced by enlarging the counting area on the filter or in the chamber, although this would also become more time-consuming, especially when using the Utermöhl method.

In summary, we successfully adjusted a CARD-FISH protocol that allows for an easier detection and a less time-consuming enumeration of akinetes in sediments in comparison with the Utermöhl method. The time expenditure for akinete enumeration per sample is twice as long with Utermöhl (4 h) compared with CARD-FISH (2 h) when including all procedure steps (Table 3). The shorter counting time of the CARD-FISH procedure is attributed to the clear fluorescence signal, which undoubtedly makes the akinete identification step easier and faster than in the regular light microscopy approach with untreated samples.

Acknowledgements

We thank Thomas Gonsiorczyk for counting akinetes, Monika Degebrodt for her help in the laboratory, Grit Mehnert and Claudia Dziallas for contributing laboratory strains, and Matthias Knie for helpful discussions. This study was part of the Joint German-Israeli-Project (FKZ 02WT0985, WR803): Life cycle of Nostocales – an intrinsic dynamic component essential to predict cyanobacterial blooms in lakes and reservoirs, funded by the German Ministry of Research and Technology (BMBF) and the Israel Ministry of Science and Technology (MOST).

Ancillary