SEARCH

SEARCH BY CITATION

Keywords:

  • pleural tuberculosis;
  • interleukin-10;
  • gene polymorphism;
  • pleural fluid;
  • protein production

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Associations of interleukin-10 (IL-10) gene promoter polymorphisms and pleural tuberculosis risk remain unclear. The objective of this study was to determine IL-10 gene promoter polymorphisms at -1082, -819 and -592 sites and their protein production in pleural fluid (PF) in patients with and without pleural tuberculosis. IL-10 gene promoter polymorphisms at the -1082, -819 and -592 sites were genotyped using a SNaPshot assay. Protein levels of IL-10 in PF were measured using an enzyme-linked immunosorbent assay. There were no significant differences in the genotype and allele frequencies of IL-10 gene promoter polymorphisms at position -1082 between the pleural tuberculosis and the control groups. However, the frequency of -819 T or -592 A alleles was significantly more common in patients with pleural tuberculosis than controls. The protein levels of IL-10 in PF were statistically higher in the pleural tuberculosis group than in the control group. Moreover, the polymorphisms at the -1082, -819 and -592 sites were associated with protein levels of IL-10 in PF in the pleural tuberculosis group, while in the control group, only the polymorphism at position -1082 correlated with the protein levels. These findings support the association between IL-10 promoter polymorphisms at -819 and -592 sites and their protein production with pleural tuberculosis risk.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Tuberculosis is a growing public health problem globally; approximately one-third of the world's population is infected with the causal bacterium, Mycobacterium tuberculosis, and only 10% of the population infected by the pathogen will develop the disease. Both host and environmental factors affect the risk of infection by M. tuberculosis following exposure and progression to tuberculosis disease (Bellamy, 2003).

The involvement of the pleural cavity is the second most common form of extrapulmonary tuberculosis after tuberculosis lymphadenitis. Pleural tuberculosis results from a pleural irritation by a granulomatous reaction in the lung or from the rupture of a tuberculous focus, containing small numbers of microorganisms, into the pleural space of a patient who has already mounted T-cell and delayed-type hypersensitivity responses against M. tuberculosis (Rook & Hernandezpando, 1996). Strong evidence for a selective local expression of a T-cell helper type 1 (Th1) cytokine response has been associated with the self-resolving nature of tuberculous pleuritis, in contrast to military tuberculosis (Soderblom et al., 1996; Sharma et al., 2002). The genes that play a role in susceptibility to the development and progression of pleural tuberculosis are unknown. However, cytokine-mediated immune and inflammatory responses have been considered to play an important role in the pathogenesis of pleural tuberculosis (Hodsdon et al., 2001; Ellner, 2010). The role of cytokines has been supported by studies on protein expression of various cytokines. For example, some cytokines such as interleukin (IL)-2, IL-10, interferon-γ (IFN-γ), granulocyte-macrophage colony-stimulating factor, transforming growth factor-β and tumor necrosis factor (TNF) are increased in pleural fluid (PF) of patients with pleural tuberculosis (Chen et al., 2001; Olobo et al., 2001). It is apparent that abnormal production of protein by cytokines may play a crucial role in the pathogenesis of this disease.

IL-10 is an important immunoregulatory cytokine mainly produced by macrophages, monocytes, T cells, B cells, dendritic cells, mast cells and eosinophils. As a Th2 cell-derived cytokine, IL-10 has been shown to inhibit the secretion of Th1 cell-derived cytokines, limit the inflammatory responses and regulate the differentiation and proliferation of several immune cells such as T cells, B cells, natural killer cells, antigen-presenting cells and mast cells (Moore et al., 2001). IL-10 gene-disrupted mice infected with M. tuberculosis have increased antimycobacterial immunity (Murray & Young, 1999). IL-10 downregulates Th1-induced response to M. tuberculosis, reactivates chronic pulmonary tuberculosis in mice and reduces M. tuberculosis-induced apoptosis of murine and human macrophages (Gong et al., 1996; Rojas et al., 1999; Turner et al., 2002; Gil et al., 2004). Patients with tuberculosis have increased IL-10 production, mainly in anergic patients (Lin et al., 1996; Boussiotis et al., 2000). The gene encoding IL-10 has been identified on chromosome 1q31–32. Several polymorphic sites within the IL-10 gene promoter region including three biallelic polymorphisms at positions -1082, -819 and -592 from the transcription start site and two microsatellite polymorphisms have been described (Turner et al., 1997). Twin studies and family studies have shown that >70% of the observed variability of IL-10 secretion is explained by genetic factors (Westendorp et al., 1997). Previous in vitro studies using peripheral blood mononuclear cells (PBMCs) have suggested that the GCC haplotype is associated with higher IL-10 production than other haplotypes. In a recent study, the IL-10-1082 A/A genotype was demonstrated to be associated with pleural tuberculosis, which is a self-cured clinical form of tuberculosis (Henao et al., 2006). Interestingly, some authors have reported that protein levels of IL-10 in PF are significantly increased in patients with pleural tuberculosis compared with controls, although this has not been found in all studies (Arruda et al., 1998; Chen et al., 2001).

In this study, we aimed to investigate whether IL-10 gene promoter polymorphisms are associated with IL-10 protein production in PF and pleural tuberculosis risk and thus may play a role in the pathogenesis of pleural tuberculosis.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Study subjects

Two hundred and one consecutive patients undergoing thoracoscopic treatment from January 2008 through December 2008 at Shanghai Pulmonary Hospital Affiliated to Tongji University School of Medicine were recruited for this study. The tuberculosis pleurisy group consisted of 123 patients diagnosed with tuberculosis pleurisy. All patients had unilateral exudative effusions without clinical evidence of concomitant pulmonary tuberculosis or HIV infection. The diagnosis was confirmed by either pathologic demonstration of granulomatous pleuritis on closed pleural biopsy or the growth of M. tuberculosis from PF or tissue. All patients responded to antituberculosis therapy. The control group included 78 patients who had no history of prior pulmonary or pleural disease. A detailed history and physical examination, chest radiography and complete pulmonary function testing confirmed that all subjects were in prefect health, except for the presence of pneumothorax. As the pulmonary tuberculosis group, 112 pulmonary tuberculosis patients without pleurisy were also enrolled in the study. The diagnosis of pulmonary tuberculosis was established by Ziehl-Neelsen staining of sputum smears and culture. In specific cases, a diagnosis was made by chest radiograph and epidemiological and clinical parameters. All pulmonary tuberculosis patients were HIV negative and none was known to present any immunosuppressive condition. Informed consent was obtained from every patient, and the study was approved by the Ethics Committee of Shanghai Pulmonary Hospital Affiliated to Tongji University School of Medicine. All the case and normal control subjects belong to the same region and ethnic background.

Determination of IL-10 protein levels in PF

PF was firstly aspirated from the pleural cavity avoiding blood contamination and before any irrigation. PF was collected in a sterile syringe and centrifuged at 600 g for 10 min at 4 °C. The supernatant was collected, aliquoted and stored at −70 °C until use. The protein levels of IL-10 in PF were measured by an enzyme-linked immunosorbent assay (ELISA) using a human IL-10 ELISA kit (Antigenix America Inc.) designed specifically to measure IL-10 in body fluids according to the manufacturer's instructions. The sensitivity of the assay was <1.5 pg mL−1, and the intra- and interassay coefficients of variation were 3.2% and 5.6%, respectively. To avoid subjective bias, an experienced technician blind to the status of the subjects at the laboratory conducted the detection of IL-10 protein levels in PF. For each sample, duplicate samples of PF were assayed.

DNA preparation and IL-10 genotyping

Genomic DNA was extracted from blood samples using a commercially available DNA extraction kit (QIAamp Genomic DNA Isolation Mini Kit; Qiagen, China) according to the manufacturer's instructions. DNA plates were arranged such that 20% of the samples were duplicated. Genomic DNA was amplified by PCR using MJ Research model PTC-225 thermal cyclers (MJ Research, Waltham, MA) under the following conditions: 5 ng genomic DNA, 0.2 μmol L−1 of each primer, 200 μmol L−1 of each dNTP, 2 mmol L−1 MgCl2, 0.5 U AmpliTaq Gold DNA polymerase (ABI Perkin-Elmer, Foster City, CA) and the manufacturer's buffer with the following primer pairs: IL-10: ATCCAAGACAACACTACTAA and TAAATATCCTCAAAGTTCC. Annealing temperatures were 59, 62 and 45 °C, respectively. PCR products (1.0 μL each) were pooled and incubated for 60 min at 37 °C with 1 U shrimp alkaline phosphatase and 1 U exonuclease I. Enzymes were inactivated by incubation at 75 °C for 15 min. Single base extension using gene-specific primers was performed according to the manufacturer's protocol (ABI Prism SNaPshot Multiplex System, Applied Biosystems, Foster City, CA) with the following modifications: 1 μL reaction mix, 5 μL pooled purified PCR product, single base extension primers and water to a final reaction volume of 10 μL. Single base extension primers were IL-10_1082G/A (rs1800896) ACTACTAAGGCTTCTTTGGGA (0.83 μmol L−1), IL-10_819C/T (rs1800871) GGTGTACCCTTGTACAGGTGATGTAA (0.83 μmol L−1) and IL-10_592C/A (rs1800872) AGCCTGGAACACATCCTGTGACCCCGCCTGT (0.83 μmol L−1). Reactions consisted of 25 cycles of 96 °C for 10 s, 50 °C for 5 s, and 60 °C for 30 s and 37 °C for 60 min with 5 U shrimp alkaline phosphatase, followed by 15 min at 75 °C. Purified reaction (0.5 AL each) was run on an ABI Prism 3100 Genetic Analyzer according to the manufacturer's instructions. Analysis was performed using ABI Prism genescan version 3.7 and genotyper version 3.7 (Applied Biosystems).

Statistical analysis

For statistical analysis, all data were nonparametric and described as medians (ranges). The medians of IL-10 protein levels in PF were compared using the Mann–Whitney U-test. Pleural tuberculosis and control populations were tested for conformity to Hardy–Weinberg equilibrium using the χ2-test between observed and expected frequencies. The differences in the distribution of phenotypes and allele frequencies were analyzed using the χ2-test or Fisher's exact test as appropriate. All odds ratios (OR) were calculated as estimates of the relative risk, and confidence intervals (CI) were calculated at the 95% level (95% CI). Associations between the protein levels and the polymorphisms were examined using the Mann–Whitney U-test or the Kruskal–Wallis H-test as appropriate. All statistical analyses were performed using statistics package for window spss version 12.0. A P value of <0.05 was considered statistically significant. Also, significant probability values obtained were corrected for multiple testing (Bonferroni correction; Pc).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

The Hardy–Weinberg equilibrium test was used to test for the genotype distribution of polymorphisms at positions -1082, -819 and -592 of the IL-10 gene promoter region between observed and expected frequencies in the pleural tuberculosis, pulmonary tuberculosis and control groups. The χ2-test showed that the pleural tuberculosis group, pulmonary tuberculosis and the control group were in Hardy–Weinberg equilibrium, indicating that populations selected from the pleural tuberculosis, pulmonary tuberculosis and control groups had successful matching.

The frequencies of the IL-10 single-nucleotide polymorphisms (SNPs) in the control, pulmonary tuberculosis and pleural tuberculosis individuals were analyzed and are shown in Tables 1 and 2. Genotype and allele frequencies were almost identical in the control and pulmonary tuberculosis groups. No statistically significant association was found between IL-10 polymorphisms and pulmonary tuberculosis. A significant association was only found between pleural tuberculosis and IL-10 gene polymorphisms. Analysis of allele frequencies of IL-10 polymorphisms at positions -1082, -819 and -592 demonstrated that the IL-10-819 T (or -592 A) allele frequency were significantly more common in patients with pleural tuberculosis than those in control without pleural tuberculosis (78.7% vs. 64.1%, OR=2.09, 95% CI=1.11–3.9, P=0.021). Statistically significant difference was still retained after Bonferroni correction of the P values (Pc) (Table 1). There were no significant differences in the genotype and allele frequencies of IL-10-1082 between the pleural tuberculosis and control groups (P>0.05). The distribution of the IL-10-819 genotype and allele frequencies was the same as IL-10-592, indicating that the -819 T allele was closely linked with the -592 A allele. The genotype and allele frequencies of IL-10-819 (or -592) were 44.9% for the T/T (or A/A) genotype, 39.7% for the T/C (or A/C) genotype, 15.4% for the C/C (or C/C) genotype, 64.1% for the T (or A) allele and 35.7% for the C (or C) allele in the control group, and 61.0% for the T/T (or A/A) genotype, 35.8% for the T/C (or A/C) genotype, 3.2% for the C/C (or C/C) genotype, 78.7% for the T (or A) allele and 21.3% for C (or C) in the pleural tuberculosis group. The pleural tuberculosis group exhibited a significantly lower C/C genotype frequency of IL-10-819 or -592 than the control group. Statistically significant difference was still retained after Bonferroni correction of the P values (Pc) (Table 2).

Table 1.   The frequencies of IL-10 alleles at positions -1082, -819 and -592 in patients with and without pleural tuberculosis
AllelesControl (n=78)Pulmonary tuberculosis (n=112)Pleural tuberculosis (n=123)
n (%)n (%)OR (95% CI)P value (Pc)n (%)OR (95% CI)P value (Pc)
IL-10-1082
 A73 (93.8)106 (94.6)0.83 (0.24–2.8)0.75 (1.50)114 (92.7)0.86 (0.28–2.69)0.81 (1.62)
 G5 (6.2)6 (5.4)  9 (7.3)  
IL-10-819
 T50 (64.1)75 (70.0)0.97 (0.53–1.76)0.92 (1.84)97 (78.7)2.09 (1.11–3.9)0.021 (0.042)
 C28 (35.7)37 (30.0)  26 (21.3)  
IL-10-592
 A50 (64.1)71 (63.4)0.97 (0.53–1.76)0.92 (1.84)97 (78.7)2.09 (1.11–3.9)0.021 (0.042)
 C28 (35.7)41 (36.6)  26 (21.3)  
Table 2.   Frequencies of IL-10 genotypes at positions -1082, -819 and -592 in patients with and without pleural tuberculosis
IL-10 polymorphismsControls (n=78)Pulmonary tuberculosis (n=112)Pleural tuberculosis (n=123)
n (%)*n (%)OR (95% CI)P (Pc)n (%)OR (95% CI)P (Pc)
  • *

    The number is given with the percentages in parentheses.

  • Reference group (controls) designated with an OR of 1.00.

  • Three putative haplotypes were identified: GCC (at positions -1082 G, -819 C and -592 C, respectively), ACC and ATA. A P value of <0.05 was considered statistically significant. P values in bold therefore indicate significance.

-1082 genotype
 A/A69 (88.5)100 (89.3)Reference 107 (87.0)Reference 
 A/G9 (11.5)12 (10.7)1.09 (0.43–2.72)0.8616 (13.0)0.87 (0.37–2.08)0.76
 G/G0 (0.00)0 (0.00)0 (0.00)
-819 genotype
 T/T35 (44.9)48 (42.9)Reference 75 (61.0)Reference 
 T/C31 (39.7)46 (41.1)0.92 (0.49–1.74)0.8144 (35.8)1.50 (0.82–2.78)0.18
 C/C12 (15.4)18 (16.0)0.91 (0.39–2.14)0.844 (3.2)0.16 (0.05–0.52)0.0011 (0.0033)
-592 genotype
 A/A35 (44.9)48 (42.9)Reference 75 (61.0)Reference 
 A/C31 (39.7)46 (41.1)0.92 (0.49–1.74)0.8144 (35.8)1.50 (0.82–2.78)0.18
 C/C12 (15.4)18 (16.0)0.91 (0.39–2.14)0.824 (3.2)0.16 (0.05–0.52)0.0011 (0.0033)
Haplotype (phenotype)
 GCC (high)10 (6.2)14 (6.3)0.98 (0.30–3.18)0.9618 (7.3)1.14 (0.37–3.53)0.82
 ACC (intermediate)44 (28.4)60 (26.8)0.95 (0.51–1.77)0.8734 (14.1)0.49 (0.24–0.98)0.05
 ATA (low)102 (65.4)150 (66.9)1.02 (0.65–1.62)0.92194 (78.7)1.21 (0.78–1.88)0.41
Haplotype inheritance (phenotype)
 GCC/GCC (high)0 (0.0)0 (0.0)0.00
 GCC/ACC (intermediate)2 (2.6)5 (4.5)1.74 (0.33–9.20)0.264 (3.3)1.27 (0.23–7.09)0.32
 GCC/ATA (intermediate)6 (7.7)9 (8.0)1.04 (0.36–3.05)0.948 (6.4)0.84 (0.28–2.5300.76
 ACC/ACC (low)9 (11.5)15 (13.4)1.16 (0.48–2.79)0.744 (3.3)0.28 (0.08–0.95)0.024 (0.13)
 ACC/ATA (low)26 (33.3)34 (30.4)0.91 (0.51–1.64)0.7532 (26.0)0.78 (0.43–1.41)0.41
 ATA/ATA (low)35 (44.9)49 (43.7)0.98 (0.58–1.64)0.9275 (61.0)1.36 (0.83–2.22)0.22

The frequency of the IL-10 (-1082, -819, -592) ATA haplotype was higher in patients with pleural tuberculosis when compared with those without pleural tuberculosis, whereas lower frequencies of the IL-10 ACC haplotype were observed in the pleural tuberculosis group. As IL-10 GCC is a minor haplotype, no homozygous GCC could be observed in our sample. The ACC/ACC, ACC/ATA and ATA/ATA genotypes (low IL-10 production) had a higher frequency both in the pleural tuberculosis group (90.3%) and in the control group (89.7%), whereas the GCC/ACC, GCC/ATA genotypes (intermediate IL-10 production) had a lower frequency both in the pleural tuberculosis group (9.7%) and in the control group (10.3%). The frequencies of haplotype GCC (high), ACC (intermediate) and ATA (low) were 6.2%, 28.4% and 65.4% in the control group and 7.3%, 14.0% and 78.7% in the pleural tuberculosis group. Significantly lower frequencies of ACC/ACC genotypes were observed in the pleural tuberculosis than those in the control group. Statistically significant differences were lost after Bonferroni correction of the P values (Pc) (Table 2).

The median (range) levels of IL-10 protein in PF were 5.46 pg mL−1 (0–46.32) in the control group and 16.17 pg mL−1 (0–854.05) in the pleural tuberculosis group. There was statistically significant differences in the protein levels of IL-10 in PF between the two groups (Z=-4.424, P=0.000; Fig. 1).

image

Figure 1.  Protein levels of IL-10 in PF in patients with and without pleural tuberculosis. Levels were described as median with ranges 25% and 75% percentiles.

Download figure to PowerPoint

The G/G, A/G and A/A genotypes of IL-10-1082 were associated with high, intermediate and low protein levels in PF, respectively, and -1082 G and C alleles with high and low levels in all groups (Tables 3 and 4). In turn, the -819 C/C, T/C and T/T (or -592 C/C, A/C and A/A) genotypes were correlated with high, intermediate and low protein levels of IL-10 in PF, respectively, and -819 C (or -592 C) and T (or -592 A) alleles with high and low protein levels of IL-10 in PF in patient group, except for the control group. Moreover, the GCC, ACC and ATA haplotypes were associated with high, intermediate and low protein levels of IL-10 in PF, respectively, and the GCC/ACC, GCC/ATA genotypes and the ACC/ACC, ACC/ATA, ATA/ATA genotypes with high and low levels in all groups.

Table 3.   Genotypes and alleles at positions -1082, -819 and -592 of IL-10 gene polymorphisms associated with their protein levels in PF in patients with and without pleural tuberculosis
Three of IL-10 SNPsProtein levels of IL-10 in PF (pg mL−1)*
ControlsPleural tuberculosis
  • *

    Levels are described as median (range).

  • High (high IL-10 production), GCC/GCC genotype; Low (low IL-10 production), ACC/ACC, ACC/ATA, ATA/ATA genotypes; and Intermediate (intermediate IL-10 production), GCC/ACC, GCC/ATA genotypes.

-1082 A/A4.36 (0–11.79)5.89 (0–18.87)
 A/G23.34 (12.44–46.32)73.45 (12.94–829.35)
 G/G
 A5.23 (0–34.48)7.66 (0–854.05)
 G23.34 (12.44–46.32)387.59 (12.94–854.05)
-819 T/T4.38 (0–11.79)5.37 (0.28–12.04)
 T/C13.09 (0–46.32)20.44 (0–829.35)
 C/C15.23 (0.02–46.32)30.78 (2.35–854.05)
 T5.46 (0–46.32)6.43 (0–854.05)
 C12.85 (0–46.32)21.98 (0–854.05)
-592 A/A4.38 (0–11.79)5.37 (0.28–12.04)
 A/C13.09 (0–46.32)20.44 (0–829.35)
 C/C15.23 (0.02–46.32)30.78 (2.35–854.05)
 A5.46 (0–46.32)6.43 (0–854.05)
 C12.85 (0–46.32)21.98 (0–854.05)
 GCC23.34 (12.44–46.32)387.59 (12.94–854.05)
 ACC13.09 (0–46.32)16.17 (0–854.05)
 ATA3.05 (0–16.32)9.15 (0–854.05)
High
Intermediate23.34 (12.44–46.32)73.45 (12.94–829.35)
Low4.36 (0–11.79)5.89 (0–18.87)
Table 4.   The result of the Mann–Whitney U-test analysis on PF protein levels associated with frequency distributions of IL-10-1082, -819 and -592 genotypes and alleles in patients with and without pleural tuberculosis
IL-10 polymorphismsControlsPleural tuberculosis
Z or χ2PZ or χ2P
  • *

    Three putative haplotypes were identified: GCC (at positions -1082G, -819C and -592C, respectively), ACC and ATA; haplotype inheritance includes high IL-10 production (GCC/GCC genotype), intermediate IL-10 production (GCC/ACC, GCC/ATA genotypes) and low IL-10 production (ACC/ACC, ACC/ATA, ATA/ATA genotypes).

-1082 genotypes−4.034<0.00128.231<0.001
Alleles−4.454<0.001−5.240<0.001
-819 genotypes0.9450.6127.4330.032
Alleles−1.2650.384−2.5670.006
-592 genotypes0.9450.6127.4330.032
Alleles−1.2650.384−2.5670.006
Haplotype*23.574<0.00124.628<0.001
Haplotype inheritance*−4.034<0.00128.231<0.001

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

This study showed that the distribution of genotype and allele frequencies of IL-10-1082 was not statistically different between the controls and patients with pleural and pulmonary tuberculosis. However, the frequency of the -819 T (or -592 A) allele was significantly increased in the patients with pleural tuberculosis compared with pulmonary tuberculosis and the controls; this may be explained by a higher frequency of A/A homozygous at -592, associated with low IL-10 production in patients with pleural tuberculosis. These results confirmed the fact that pleural tuberculosis is the form of infection with the highest local inflammatory response. A previous report has shown that homozygosity for the -1082 polymorphism of the IL-10 gene is associated with pleural tuberculosis susceptibility in the Colombian (Henao et al., 2006). However, the present results are in agreement with data showing that the IL-10-592 A/A genotype was over-represented in the patient with pleural tuberculosis in Peruvian population (Taype et al., 2010). A meta-analysis published recently indicates that IL10-1082 G/A is not important for tuberculosis susceptibility per se, while other SNPs in regulating IL-10 level had some specific effect on tuberculosis determining the disease form and severity (Pacheco et al., 2008). Our results are consistent with these findings. Inconsistent results in the association of IL-10 polymorphisms with pleural tuberculosis may reflect ethnic-specific genetic variations or suggest the possibility that other more distal promoter elements are involved (Gibson et al., 2001).

The promoter region of the IL-10 gene is highly polymorphic, with three single base pair substitutions at positions -1082G/A, -819 C/T and -592 C/A, which results in differential IL-10 production; however, the polymorphisms in the IL-10 gene promoter region affecting IL-10 production are dependent on the cell type and stimulation used (Tone et al., 2000). In our study, we found that the G/G, A/G and A/A genotypes of IL-10-1082 were associated with high, intermediate and low protein levels of IL-10 in PF, respectively, and -819 or 592 G and C alleles with high and low levels in the pleural tuberculosis and control groups. This result agrees with the findings that the polymorphisms within the IL-10 gene promoter region are associated with IL-10 protein production in PBMCs (Turner et al., 1997). However, we did not observe any associations between IL-10-819 or -592 polymorphisms and their protein production in PF in the controls. The correlations between the polymorphisms of IL-10-819 and -592 with IL-10 protein production in PF only found in the pleural tuberculosis group in our study may suggest a role of IL-10-819 or -592 polymorphisms in IL-10 protein production in PF in this disorder.

Immunologic resistance and susceptibility to intracellular pathogens are thought to be mediated by CD4+ T cell with specific patterns of cytokine secretion. Enhanced production of IFN-γ in the pleural space is likely to contribute to immune defenses against M. tuberculosis. In contrast, IL-10 in PF was produced predominantly by macrophages in response to high local concentrations of mycobacterial antigens. As a major homeostatic regulator of inflammation, immune responses and prevention of autoimmunity, IL-10 has been shown to downregulate the IFN-γ production of T cells, and the secretion of TNF, nitric oxide and the expression of costimulatory molecules and major histocompatibility complex class II of macrophages (Moore et al., 2001). Increased IL-10 levels appear to promote M. tuberculosis survival and correlate with a more severe clinical phenotype of the disease, because IL-10-transgenic mice are highly susceptible to progressive tuberculosis infection and IL-10-deficient mice have increased antimycobacterial immunity (Murray & Young, 1999). It has been reported that genetic factors can account for between 50% and 75% of the observed variability of IL-10 production (Opdal, 2004). Therefore, the IL-10 genotype corresponding to a higher IL-10 level may suppress IFN-γ production and hence favors tuberculosis development. Increased IL-10 protein production in PF in the patients with pleural tuberculosis may suggest an important role for IL-10 in the pathogenesis of this disease. IL-10 might be responsible for preventing exacerbated tissue damage in tuberculous pleurisy by modulating the microbicidal immune response and is associated with disease resolution (Olobo et al., 2001; Barbosa et al., 2006). Our finding that the IL-10-592 A/A genotype corresponding to the IL-10 low-producer polymorphism is more frequent in patients with pleural tuberculosis is in agreement with the fact that pleural tuberculosis is the form of infection with the highest local antimycobacterial response. Therefore, decreased downregulatory mechanisms of the host immune response, mediated by IL-10, may be help in the elimination of the pathogens and contribute to the high levels of antibacterial responses.

In conclusion, this is the first study, to our knowledge, to assess the associations of IL-10 gene promoter polymorphisms and their protein production in PF with pleural tuberculosis risk. The preliminary data suggest that IL-10-819 T or -592 A alleles or haplotypes containing these alleles may influence the Th1/Th2 balance and hence may play a role in susceptibility to pleural tuberculosis and increase the risk of developing disease. It also suggests that increased IL-10 protein production in PF associated with the polymorphisms of IL-10-819 or -592 may imply a role for IL-10 in the pathogenesis of pleural tuberculosis. However, the small sample size in our study necessitates that this finding be validated in a larger study. More data are also needed to determine whether this finding applies to the general pleural tuberculosis population.

Acknowledgement

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

This work was supported by the National Great Research Program of China (2008zx10003-009).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References