ITS1 region of the rDNA of Pythium megacarpum sp. nov., its taxonomy, and its comparison with related species

Authors

  • Bernard Paul

    Corresponding author
    1. Laboratoire des sciences de la Vigne, Institut Jules Guyot, Université de Bourgogne, P.O. Box 138, 21004 Dijon, France
    Search for more papers by this author

*Corresponding author. Tel.: +33 (3) 80639341; Fax: +33 (3) 80396326, E-mail address: bernard.paul@u-bourgogne.fr

Abstract

Pythium megacarpum sp. nov., was isolated from a soil sample taken from a wheat field in Lille in northern France. It was mistakenly described as Pythium ostracodes Drechsler [Paul, B (1994) Cryptogam.-Mycol. 15,263–271]. Despite morphological resemblance, the comparison between the internal transcribed spacer (ITS)1 regions of the rDNA of the two fungi, leaves no doubt of their different identities. This species is unique because of its large oogonia and plerotic, thick walled oospores, its monoclinous antheridia with large antheridial cells and its lack of zoospores. The character combination of P. megacarpum and the ITS1 sequence of its rDNA, justifies the creation of a new species within the genus Pythium. The fungus is closely related to P. ostracodes. The taxonomic description of this fungus and its comparison with related species, together with the PCR of the ITS1 of its ribosomal nuclear DNA as well as the nucleotide sequences of ITS1 encoding 5.8S rRNA are discussed here.

1Introduction

The members of the genus Pythium belonging to the family of Pythiaceae, order Perenosporales, and class Oomycetes are represented world-wide. More than 200 species of this genus have been described out of which 130 have been recognized recently [2]. Most of these live as saprophytes in various types of soil and in aquatic environments, some however cause serious plant diseases. The most common disease caused by the members of this genus is the ‘damping-off of seedlings’. Some of these can also behave as parasites of mosquito larvae [3] and at least one is known to be a mammalian parasite [4].

The most widely used taxonomic descriptions of the members of the genus Pythium are those given by Middleton [14], Waterhouse [15] and Plaats-Niterink [16]. These taxonomic references are based on the comparison of morphological characteristics and temperature–growth relationships of different members of the genus. In recent days the morphological descriptions are increasingly supplemented by molecular characteristics of a given species [5]. The polymerase chain reaction coupled to restricted fragment length polymorphism analysis (PCR–RFLP) has become a useful tool in fungal taxonomy [6,7] and is currently used to identify different species of Pythium[8–11]. Amplification of the ribosomal gene is used for the genetic identification of many organisms because they comprise both highly conserved sequences during evolution and highly variable sequences among species and even within species. The ribosomal nuclear DNA consists of transcribed and non-transcribed regions [10]. The internal transcribed spacer (ITS1) is a non-conserved region and has been amplified with the PCR method using universal primers ITS1 and ITS2. The comparison of mitochondrial DNA (mt DNA) has also been used for taxonomic purposes [12].

During the course of investigation on pythiaceous fungi, the author described an isolate (F-66) as Pythium ostracodes Drechsler [1]. The study on the fungus was then purely morphological and despite of some differences like the absence of zoospores, it was incorporated within P. ostracodes. Recently, P. ostracodes (F-333) having zoospores, was isolated from a soil sample taken in the Burgundy region of France. The ITS1 regions of the rDNA of both the fungi were amplified and the sequences revealed that the isolate F-66 was wrongly described as P. ostracodes. Further studies have made it possible to re-describe the isolate F-66 as a new species. The name Pythium megacarpum has been adopted due to the presence of large oogonia and thick-walled oospores. In the present paper, the morphological details of the new species together with the sequences of the ITS1 region of the ribosomal nuclear DNA are given. Comparison of morphological as well as molecular characteristics with related species are also dealt here.

2Materials and methods

2.1Fungi

All fungal materials were taken from the author's personal collection of pythiaceous fungi, maintained at ‘Institut Jules Guyot’, Dijon, France: P. megacarpum (F-66), P. ostracodes (F-333), Pythium middletonii (F-382), Pythium oedochilum (F-376) and Pythium rostratum (F-345). These were maintained on potato dextrose agar (PDA), and potato carrot agar (PCA) media and also on boiled hemp-seed halves in sterile distilled water as described earlier [13]. The identification was done with the help of keys provided by Middleton [14], Waterhouse [15] and Plaats-Niterink [16].

2.2DNA isolation and PCR

DNA was extracted by growing the fungi in PDB (potato dextrose broth: PDA devoid of agar) medium, incubated at 25°C on a rotary shaker for 5 days. The mycelium was then washed in TE buffer (10 mM Tris–HCl pH 8, 1 mM EDTA) and was kept at −20°C for 24 h. DNA isolation and the PCR amplification of the ITS1 of the ribosomal nuclear DNA were done using the procedures described earlier [6,17,18]. Universal primers ITS1 (TCC GTA GGT GAA CCT GCG G) and ITS2 (GCT GCG TTC TTC ATC GAT GC) were synthesized and the DNA sequences were realized by Oligo Express (Paris, France). The primer ITS1 is at the 3′ end of the 18S rDNA gene and ITS2 is at the 5′ end of the 5.8S rDNA gene. The sequences obtained were compared with the ITS1 sequences of related species of Pythium: P. ostracodes (F-333), P. middletoni (F-382), P. oedochilum (F-376), while the sequence of the ITS1 region of P. rostratum was obtained from GenBank (AJ233456.1). The ITS1 sequences of P. ostracodes (F-333), P. middletonii (F-382.1), P. oedochilum (F-376.1), Pythium helicoides (F-385.1) and P. megacarpum (F-66) have been deposited in GenBank.

3Results

3.1Morphology

P. megacarpum PAUL sp. nov. (Figs. 1–4).

Figure 1.

P. megacarpum: a,b: germinating sporangia (hyphal bodies); c–h: sporangia of different shapes with or without apical papilla; i,j: oogonia supplied with corolloid antheridia; k–n: large oogonia with granulated cytoplasm receiving with fertilization tubes supplied by antheridia; o–q: plerotic oospores; r,s: oogonia containing oospores and having campanulate remnants of an antheridial cell; t,u: free thick walled oospores. Bar=25 μm.

Figure 2.

P. megacarpum: a,b: germinating sporangia; c,d sporangia having apical papillae; e–g: oogonia supplied with corolloid antheridia; h: oogonia and a long antheridial cell. Bar (b–d, g and h)=25 μm, (a, e, and f) bar=50 μm.

Figure 3.

a–d: Oogonia supplied with large conspicuous antheridial cell; e–h: plerotic oospores; f,g: oogonia bearing campanulate remnants of antheridia. Bar=25 μm.

Figure 4.

Clustal W (1.8) multiple sequence alignment of ITS1 regions of nuclear ribosomal DNA of P. helicoides, P. rostratum, P. middletonii, P. megacarpum, P. oedochilum, and P. ostracodes.

Hyphae hyalinae, ramificatea, sine loculis, 3–7 μm diametro; Sporangia (tumores hyphales) globosa, subglobosa,interdum ovoidia, terminalia, subterminalia, 13–36 μm diam., zoosporae non observata. Oogonia laevia, globosa, interdum ovoidia, terminalia et intercalaria, 20–45 μm diam, Antheridia monoclinata, ramificata, cellulae antheridiales inflatae. Oosporae singulae, pleroticae, globosae 19–36 μm diam, paries 4–7 μm crassus. Incrementum radiale quotiadianum 8–10 mm 25°C in agaro Solani tuberosi et Dauci carotae (PCA).

Mycelium hyaline, well branched. Main hyphae up to 7 μm wide. Colonies on PDA and PCA are without any particular pattern. The fungus produces cottony mass of aerial mycelium on the former and scanty aerial mycelium on the latter. Radial growth of the fungus at 25°C on PCA is 8–10 mm day−1. The fungus grows well in water on hemp-seed halves and produces asexual and sexual structures at room temperatures (18–25°C).

Sporangia or hyphal bodies are spherical to ovoid (Figs. 1a–h and 2a–d), at times provided with an apical papilla (Figs. 1d–f and 2c,d), terminal to sub-terminal, germinating directly with 1–7 germ tubes (Figs. 1 a,b and 2a,b). Sporangial vesicle and zoospores have not been observed.

The fungus reproduces sexually by forming antheridia and oogonia in abundance, on solid media as well as in water on hemp seed halves. Oogonia are smooth-walled, spherical, at times ovoid, terminal or intercalary, measuring 20–45 μm in diameter (average 28 μm) and are filled with dense, coarsely granulated protoplasm (Figs. 1i–n and 2h–f).

Antheridia are usually of monoclinous origin. These are at times branched producing corolloid appearance in the vicinity of the oogonia (Figs. 1i,j and 2e–g), and there are usually one or two antheridial cells which are at times applied length-wise to a large portion of the oogonial wall (Figs. 1l–n, 2h and 3a,b). The antheridial cells can measure up to 30 μm long and 6 μm wide and produce a conspicuous fertilization tube (Figs. 1i–l and 3a). These get fused to the oogonial wall and in most of the cases remain visible for a long time after fertilization in the form of oogonial outgrowths which are at times spherical, at others campanulate (Fig. 3f,g).

Oospores are always plerotic, spherical, smooth-walled, one per oogonium (Figs. 1o–t and 3e–g), measuring 19–36 μm in diameter (average 26.8 μm). The oospore wall is very thick, up to 7 μm (average 5 μm) and is perhaps the thickest oospore wall for the genus.

3.2Ecology

With the isolation procedure used for the work, P. megacarpum seems to be very rare as it was isolated only once from wet soil cultivated with wheat.

3.3Etymology

The fungus is being named as P. megacarpum because of the presence of large oogonia and oospores.

3.4ITS1 region of the rDNA

The ITS1 region of the nuclear ribosomal DNA of the fungus comprises 173 bases. (GenBank accession number AF 203784): CCACACCTAAAAATCTTTCCACGTGAATTGTTTTGTTGTAAGTTGGGCTTCGCTGGCGTGTTCTGTTTTCGGACGGAGCGCAACGGCTTGAGGCCATCAGGGCGTTTATTGTGTCGTGCAGTATTCGCTCTTTTTGTAAACCCATTTTTGATGAAACTGATTATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAG

The comparison of the ITS1 sequences of P. megacarpum and related species is given in Fig. 4. The ITS1 sequences of the other related species have also been deposited in GenBank. The accession numbers are: P. ostracodes (F-333)=AF 242898, P. middletoni (F-382.1)=AF 242897, P. oedochilum (F-376.1)=AF 244124, and P. helicoides (F-385.1)=AF242899.

4Discussion

P. megacarpum is morphologically distinct because of the combination of the following characters: absence of zoospores; antheridial branches forming a coralloid structure in the vicinity of the oogonia; large smooth-walled oogonia supplied with inflated and voluminous antheridial cells; plerotic oospores with very thick walls, one of the thickest for the genus; and its slow growth on solid media like PCA and PDA. No other species within the genus Pythium has a character combination like those of P. megacarpum. This fungus was originally described as P. ostracodes as it comes very close to the former as far as morphological characters are concerned. The main differences are that P. megacarpum does not produce zoospores, its oogonia and oospores are smaller (average 28 and 26.8 μm instead of 35 and 32.5 μm) and the oospore walls are thicker (up to 7 μm instead of 5 μm). The ITS1 sequences of both the fungi are quite different with a 79.2% identity. Other species having thick-walled oospores and large oogonia are P. oedochilum, P. middletonii, and P. helicoides. These, however, are fast growing fungi and have aplerotic oospores, unlike P. megacarpum. A slow growing fungus having almost plerotic oospores is P. rostratum and thus comes close to P. megacarpum, but the antheridial characters and the size of the reproductive structures are entirely different. The ITS1 region of the nuclear ribosomal DNA of P. megacarpum has 75.6% identity with P. oedochilum; 57.6% identity with P. middletonii; 64.6% identity with P. helicoides; and 50.7% identity with P. rostratum. With a 79.2% identity, P. ostracodes comes closest among all the species compared to P. megacarpum thus supporting the morphological and reproductive observations. The fundamental morphological and molecular differences between these two species as outlined above, justifies the creation of a new taxon.

Ancillary