A novel episomal shuttle vector for transformation of Cryptococcus neoformans with the ccdB gene as a positive selection marker in bacteria

Authors

  • Philippe Mondon,

    1. Molecular Microbiology Section, LCI, National Institute of Allergy and Infectious Diseases, N.I.H., Bldg. 10, 11C304, Bethesda, MD 20892, USA
    Search for more papers by this author
  • Yun C Chang,

    1. Molecular Microbiology Section, LCI, National Institute of Allergy and Infectious Diseases, N.I.H., Bldg. 10, 11C304, Bethesda, MD 20892, USA
    Search for more papers by this author
  • Ashok Varma,

    1. Molecular Microbiology Section, LCI, National Institute of Allergy and Infectious Diseases, N.I.H., Bldg. 10, 11C304, Bethesda, MD 20892, USA
    Search for more papers by this author
  • Kyung J Kwon-Chung

    Corresponding author
    1. Molecular Microbiology Section, LCI, National Institute of Allergy and Infectious Diseases, N.I.H., Bldg. 10, 11C304, Bethesda, MD 20892, USA
    Search for more papers by this author

*Corresponding author. Tel.: +1 (301) 496-1602; Fax: +1 (301) 402-1003, E-mail address: june_kwon-chung@nih.gov

Abstract

We report the engineering of a new shuttle vector featuring its episomal maintenance in Cryptococcus neoformans and the lethal Escherichia coli ccdB gene for positive selection in bacteria. Telomere-like sequences from C. neoformans and the STAB fragment confer episomal maintenance to the vector (pPM8) upon transformation in C. neoformans. The vector generated high transformation frequencies and each transformant was estimated to harbor thirty copies of the plasmid. The plasmids recovered in E. coli from the C. neoformans transformants showed no evidence of rearrangement. This construct will be very useful for cloning and studying the regulation of genes in C. neoformans.

1Introduction

Cryptococcus neoformans, a basidiomycetous yeast, causes serious mycoses affecting primarily immunocompromized patients, in particular those with AIDS [1]. Considerable progress has been made in the molecular study of the species since the transformation systems have been established [2,3]. A major step in the cloning of C. neoformans specific genes has been the use of complementation analysis of mutant phenotypes by genomic libraries [4–6]. Although several vectors are available to construct genomic libraries, we are not aware of a transformation vector which autonomously replicates in C. neoformans, and allows detection of recombinant clones in bacteria by a direct positive selection other than the lacZ (blue/white) assay.

Previous studies with serotype D isolates of C. neoformans have shown that the majority of DNAs introduced into cells by standard protocols of electroporative transformation are maintained extrachromosomally in linear form with modified termini by the addition of telomeric sequence repeats [7,8]. The efficacy of transformation increases more than 100-fold when telomeric repeats are added to transforming plasmid [7]. However, a majority of the extrachromosomal linear plasmids are unstable and stable transformants usually arise via ectopic integration into the genome. Recently, Varma and Kwon-Chung [9] described a DNA sequence (STAB) with strong homology to part of the Escherichia coli let operon (unpublished) and obtained during analysis of the minichromosome [10], which enhanced the stable maintenance of episomal plasmids in the transformants [9].

A positive bacterial selection vector using an active cytotoxic ccdB gene under the control of the Lac promoter was developed by Bernard et al. [11]. This bacterial gene is found in the ccd (control of cell death) locus on the F plasmid and kills the hosts by interfering with the DNA–gyrase cleavable complex. When the ccdB gene is disrupted by insertion of DNA fragments, only recombinant clones are viable.

We have engineered a new vector which combines the positive selection in bacteria with enhanced episomal maintenance in C. neoformans. We have included the ccdB killer gene, the cryptococcal URA5 gene, telomere sequences, and the STAB fragment in our construct. This vector was used to construct two genomic libraries with DNAs of serotype A and D strains of C. neoformans. The libraries have proven efficient for complementation of a mutant phenotype in C. neoformans.

2Materials and methods

2.1Fungal strains and manipulations

The ura5 (B-4500 FOA) and ade2, ura5 (LP1) mutant strains were derived from C. neoformans strain B-4500. The serotype A strain H99 and serotype D strain B-4544 [12] were used to construct genomic DNA libraries. C. neoformans strains growing in logarithmic phase were transformed with linearized plasmids under the conditions described previously [8]. To test for episomal stability, transformants obtained from YNB (6.7 g l−1 yeast nitrogen base without amino acids, 2% glucose) plates were cultured in 5 ml of YEPD (1% yeast extract, 2% Bactopeptone, 2% glucose) broth at 30°C for 18 h. About 800 cells of each transformant were spread onto three plates each of YNB and YEPD agar medium. The number of colonies grown on YNB plates, at 30°C after 72 h, were compared with the number grown on YEPD plates.

2.2DNA analysis

Genomic DNA, isolated as described previously [12], from selected transformants was electrophoresed on 0.8% agarose gel and transferred onto a nylon membrane. The filter was hybridized at 65°C with a radiolabeled (32P-dCTP, Amersham) probe. To determine the copy number, undigested total DNAs of five independent transformants containing pPM8 were fractionated on 0.8% agarose gel. After hybridization with a probe of the URA5 gene, the filter was exposed to a phospho-imager screen and signals of the free plasmid and genomic DNAs were each quantified with ImageQuant (Molecular Dynamics). Since both of the free plasmid and genomic DNAs contained the URA5 gene, the copy number of the free plasmid was expressed as a ratio of signal intensity between the free plasmid and genomic DNA. To rescue the free plasmids in E. coli, total DNA of the transformant was digested with NotI and ligated overnight at 15°C with T4 DNA ligase (Boehringer Mannheim). This DNA was then used to transform E. coli cells and the transformants were selected on LB agar with 100 μg ml−1 ampicillin.

2.3Construction of plasmids and libraries

The sequential procedures for plasmid construction are illustrated in Fig. 1. All the BamHI sites in the plasmid pAV541, which contained the STAB fragment [9], were first eliminated by digestion with BamHI and religation. The STAB fragment was then excised with XbaI and EcoRI, blunt-ended, and cloned into the blunt-ended XbaI site of pCnTEL plasmid [7] to yield pPM3. The STAB fragment and the kanamycin-telomere cassette were excised from pPM3 with SacI (blunt-ended) and XbaI. The URA5 gene was isolated by digesting pCIP-3 [2] with XhoI (blunt-ended) and PstI. These two fragments were cloned into the PstI, XbaI sites of pUC19, respectively to yield pPM4. The ccdB gene under the control of the Lac promoter was obtained from the commercial plasmid pZero™-1 (Invitrogen). The multicloning site of pZero™-1 was replaced by a unique BamHI site and AscI sites were added to both ends of the ccdB gene by two separate PCR amplifications (primers GGCGCGCCAGCTGGCACGACAGGTTTC and GGATCCATAGCTTGAGTATTCTATAG for the 5′ end and primers GGATCCAATTCGCCCTATAGTGAG and GGCGCGCCGTCCCATTCGCCATTCAGGCC for the 3′ end). The two PCR products were cloned into the PCRR TOPO vector (Invitrogen) and confirmed by sequencing. This newly constructed plasmid (pPM6) was propagated in B462 [13], a gyrA462 mutant which confers total resistance to ccdB (kindly provided by Dr. Martine Couturier, Brussels, Belgium). The LacP-ccdB fragment was excised from pPM6 with EcoRI, blunt-ended and cloned into the blunt-ended BamHI site of pPM4 to get pPM7. Finally, pPM8 was obtained by cloning the 5.1 kb EcoRI blunt-ended fragment containing the URA5 gene, the kanamycin-telomere cassette, the STAB fragment and the ccdB gene into the blunt-ended PvuII-SspI site of pBluescript. The BamHI-EcoRI fragment of pYCC76 containing the ADE2 gene [6] was isolated, blunt-ended and cloned into pPM8 (pPM9), pCIP3 (pADE/URA) and pCnTEL (pPM12). To construct libraries of C. neoformans, total genomic DNA was isolated [12] and partially digested with Sau3A. Products greater than 6 kb in size were ligated into the BamHI site of pPM8 and were used to transform the electro-competent E. coli HB101 cells (Bio-Rad). The transformants were amplified and selected on LB agar with 20 μg ml−1 of kanamycin and 100 μg ml−1 of ampicillin.

Figure 1.

Steps of pPM8 vector construction. See Section 2 for the details.

3Results and discussion

3.1Construction of the episomal stable vector

We have constructed a plasmid, pPM4, which contains a kanamycin-telomere cassette flanked by the URA5 gene and the STAB fragment (Fig. 1 and Section 2). The URA5 gene is a selectable marker and the STAB fragment allows stable episomal maintenance of the plasmid in C. neoformans. In addition, the kanamycin-telomere cassette provides selection pressure preventing recombination between the telomere repeats. The telomere ends of pPM4 are exposed when the plasmid is digested with the meganuclease I-SceI. The I-SceI linearized DNA was transformed into C. neoformans. The telomere-URA5 on one free end and the telomere-STAB on the other free end protect the linear vector from rearrangement. Bernard et al. [11] developed a positive selection vector using an active cytotoxic ccdB gene under the control of the lac promoter. We constructed a unique BamHI cloning site in the middle of the ccdB gene and placed this construct into pPM4 (Section 2). The final plasmid, pPM8, was maintained in a gyrA462 mutant of an E. coli strain (B462), which confers total resistance to the ccdB killing activity [13]. Comparisons of three E. coli strains, HB101, DH10B and B462 transformed with the plasmid pPM8 (with ccdB) or pPM4 (without ccdB) showed that the plasmid containing ccdB was highly efficient in inhibiting bacterial growth in HB101 and DH10B (Table 1). This bacterial cytotoxic gene, however, had no effect on C. neoformans (Table 1). In pPM8, insertion of DNA into the BamHI site or the filling cohesive ends after digesting with BamHI, the ccdB gene became inactivated (data not shown). These results were similar to the observations described by Bernard [14]. Therefore, by eliminating all of the undesired non-recombinant clones, pPM8 could be a very convenient tool in constructing high quality DNA libraries. In addition, the AscI sites flanking the ccdB gene provide for an easy recovery of the inserted DNA (Fig. 1).

Table 1.  Cytotoxicity of the ccdB gene in E. coli and C. neoformans
  1. aStrains of E. coli and C. neoformans were transformed with either pPM4 or pPM8 and the numbers of transformants grown on the selection plates were determined.

  2. bE. coli strains.

  3. cC. neoformans strain.

PlasmidsNumbers of transformants μg−1 DNAa
 B462 (control)bHB101bDH10BbB-4500 FOAc
pPM4109109109104
pPM8 (ccdB)10900104

3.2Properties of vector pPM8

The vector pPM8 generated high transformation frequencies (104–105 transformants per μg of DNA) by electroporation in both serotypes D (B-4500 FOA) and A (H99 FOA) strains. Quantitative analysis of the copy number of pPM8 in the transformants of C. neoformans (see Section 2) revealed approximately 30 copies of the plasmids per yeast cell. Such copy numbers may provide a tool for over-expression studies.

Because C. neoformans has a tendency to modify the transforming DNA, we tested the ability of pPM8 to protect DNA cloned into the BamHI site from modification. We cloned the ADE2 gene into pPM8 (pPM9), pCIP3 (pADE/URA) and pCnTEL (pPM12) (Fig. 2). pCnTEL is the parental plasmid of pPM8 without STAB, and pCIP3 is the parental plasmid of pCnTEL without telomeres. These plasmids were transformed into an ade2, ura5 (LP1) mutant strain of C. neoformans and URA5 transformants were selected on YNB supplemented with adenine. The resulting transformants were grown on YNB without adenine to test the integrity of the ADE2 gene. All the transformants of LP1 containing pPM9 and pPM12 were able to grow on YNB while only 40% of the transformants containing pADE/URA were able to grow on YNB. These results suggested that the structural integrity of ADE2 was better maintained in plasmids containing telomeres (pPM9 and pPM12). Southern blot analysis of undigested genomic DNAs isolated from transformants containing pPM9 indicated that 100% of the transformants harbored extrachromosomal plasmids (Fig. 3). Of these, 92% (23/25) appeared to have plasmid with the expected size of pPM9. This result was similar to the transformants containing pCnTEL (data not shown). Therefore, the presence of the telomeric ends allowed the vector to exist as a linear episomal plasmid, as was the case with pCnTEL [7], and enhanced the integrity of the DNA cloned into the vector.

Figure 2.

Maps of pPM9 and pPM12. Plasmids pPM9 and pPM12 were obtained by insertion of the ADE2 gene in the BamHI site of pPM8 and the XbaI-EcoRI sites of pCnTEL.

Figure 3.

Southern blot analysis of pPM9 transformants. Strain LP1 was transformed with I-SceI linearized pPM9. Total DNA was isolated from 25 independent transformants, fractionated and hybridized with a probe of the URA5 gene. The positions of genomic DNA (gDNA) and episomal plasmid (pPM9) are marked by arrows.

The ability to stably maintain pPM8-based plasmids episomally in C. neoformans was also determined by growing the transformants in media without selective pressures (YEPD). Close to 40% of the transformants retained the plasmid pPM9 after 18 h of growth in YEPD, compared to 20% with pPM12, a plasmid without STAB sequence (Table 2). Interestingly, about 85% of the transformants were found to maintain pAV541, which contained the original STAB plasmid (Table 2). It is possible that modification of the three BamHI sites in the STAB fragment during the construction of pPM8 might have caused the lower stability of pPM8 compared to pAV541. This possibility was not further investigated. The lowered stability of plasmid constructs derived from pPM8, however, could be of some advantage. For instance, a genomic library constructed in pPM8 could be used to transform a mutant of C. neoformans to complement its mutant phenotype. When the desired transformant is isolated, a simultaneous loss of the complemented phenotype and the episomal plasmid could be indicative of the presence of the gene of interest in the episomal plasmid. The gene of interest could, then, be subsequently analyzed by rescuing the episomal plasmids. Since in transformants containing the pPM8-based vector, episomal loss was comparatively easier than with pAV541, pPM8 is a useful candidate to construct this type of library. Furthermore, while only 60% of the transformants containing pAV541-based plasmids were able to maintain the original size of the vector in C. neoformans[9], 92% of the transformants containing pPM9 maintained the vector with original size (see above). This property provided an additional advantage of pPM8 as a cloning vehicle.

Table 2.  Stability of five randomly chosen transformants of pPM12, pPM9 and pAV541 after 18 h of growth on non-selective (YEPD) media
  1. aCFU on YNB/CFU on YEPD.

  2. bOriginal unmodified STAB.

Clone% Stable transformants
 pPM9a (+STAB)pPM12a (−STAB)pAV541a (+STABb)
14121.774.1
2302483
34623.593
444.510.275.5
533.819.899.7
Average39.06±6.919.8±5.685±11.1

The free plasmid in C. neoformans cells transformed with pPM8 was recovered by transforming E. coli with total DNAs of such transformants. None of these recovered plasmids showed any evidence of rearrangement. In contrast, the plasmid pCnTEL was unstable and frequently underwent rearrangements ([4]; unpublished observations). Thus, the presence of both telomeric and STAB sequences in the vector pPM8 increased transformation frequencies as well as the structural stability of the episomes.

Utilizing such properties of the vector pPM8, we constructed two genomic DNA libraries of serotype A (H99) and serotype D (B-4544) isolates, representing more than three times the genome size of each. When the ade2, ura5 (LP1) mutant strain was transformed with the DNAs of each library, about 1 of 4000 transformants were ADE2 prototrophs resulting from complementation. These results indicated that pPM8-based libraries have reasonably high frequencies of complementing an auxotrophic phenotype and should be useful in complementing other types of mutation in C. neoformans.

In summary, the vector pPM8 provides for positive selection in bacteria, as well as its episomal stability and integrity in C. neoformans. This plasmid was successfully used to construct two genomic libraries, which will benefit the molecular study of C. neoformans.

Acknowledgements

We are very grateful to Dr. Martine Couturier (Université Libre de Bruxelles, Belgium) for providing us with B462, a gyrA462 mutant of an E. coli strain.

Ancillary