Can the grey mould disease of the grape-vine be controlled by yeast?

Authors


*Corresponding author. Tel.: +33 (3) 80396341; Fax: +33 (3) 80396326, E-mail address: bernard.paul@u-bougogne.fr

Abstract

Botrytis cinerea has been found to be highly pathogenic to ‘Chardonnay’ and ‘Pinot noir’ cultivars of the grape-vine producing the characteristic grey mould symptoms within 7 days of inoculation to the vitro-plants. The yeast Pichia anomala (strain FY-102), isolated from apple skin, was found to be antagonistic to B. cinerea as it completely inhibited the appearance of the grey mould symptoms when grown together. The yeast was responsible for morphological changes such as coagulation and leakage of the cytoplasm of B. cinerea. The pathogen, when applied together with P. anomala, failed to bring about the grey mould symptoms on the grape-vine, suggesting that the yeast could control the expression of this disease. An account of the interaction between B. cinerea and P. anomala, as well as the sequences of the complete ITS region of the ribosomal DNA of the yeast are described here.

1Introduction

Grey mould, caused by Botrytis cinerea, is a well known disease and causes heavy losses of yield in table and wine grapes in many places around the world. Although the fungicides have decreased drastically the incidence of grey mould, they have a negative impact on the environment. Appearance of fungicide resistant strains is frequent [1,2]. In the context of consumer reluctance to chemical residues in food and public concern for environmental safety, there is an increasing demand to develop alternative methods to control diseases [3]. This demand has turned out to be a critical need with respect to chemical fungicides proving hazardous to the environment and the development of fungicide resistant strains of the pathogens. The concern, added with fascinating progress in biotechnological developments, has led researchers to develop safer and environment-friendly disease control alternatives. One of the strategies adopted and developed throughout the world is the ‘biological control’ of plant diseases.

Biological control, the use of biological processes to lower inoculum density of the pathogen in order to reduce the disease thereby reducing crop loss, is a potentially non-hazardous alternative [4]. Quite a number of micro-organisms have been reported to be antagonistic to B. cinerea[5]. The natural bacterial flora found on the surfaces of the leaves of grape-vine has an inhibitory effect on the grey mould fungus [6]. Bacillus circulans was found to suppress B. cinerea and its pectinolytic activities [7], and an unidentified species of Bacillus was found to bring about morphological changes in the mycelium and conidia of this parasite as well as trigger the host resistance to the disease by inducing the formation of stilbene-type phytoalexins [8]. Serratia and Pseudomonas were effective on cabbage infected by B. cinerea[9].

Mycoparasites have also been used to control B. cinerea. Several strains of the genus Trichoderma have been described to attack a wide range of pathogenic fungi and this mycoparasite is the most extensively studied fungus as far as the mechanisms of mycoparasitism are concerned: cell wall degrading enzymes such as chitinases [10]; β-1,3-glucanases, β-1,6-glucanases [11,12] and proteases [13] have been assigned to be responsible for the mycoparasitism of Trichoderma. Some mycoparasites belonging to the genus Pythium have also been reported as antagonists of B. cinerea[14].

Some yeasts have also been reported to combat phytopathogens. Candida oleophila is being used to protect apples from B. cinerea after harvest [15]. Many other yeasts are reported to be antagonists to phytopathogens: Debaryomyces hansenii against Penicillium digitatum on grapefruit [16], Pichia guillermondii against Botrytis, Rhizopus and Alternaria rots of tomato fruits [17], Cryptococcus laurentii, Cryptococcus flavus and Cryptococcus albidus against Mucor rot of pear [18], Candida sake against major post-harvest pathogens of apple including B. cinerea and Rhizopus nigricans[19].

The yeasts are taxonomically diverse and include ascomycetes and basidiomycetes. A third group, the imperfect yeasts, have both ascomycetous and basidiomycetous affinities. The ascomycetous species are a heterogenous group with the perfect states belonging to the various genera. The morphological taxonomy of these organisms is usually difficult and time consuming. Increasingly the taxonomic description of fungi combines morphological descriptions and molecular data. Molecular taxonomy through DNA probes, restriction fragment length polymorphism (RFLP) of polymerase chain reaction (PCR)-amplified rDNA, RFLP of mitochondrial DNA, RFLP of total DNA, species-specific primers, karyotype analysis using field gel electrophoresis, and RAPD are more and more used to give an identity to a wide range of micro-organisms [20]. The PCR coupled to RFLP analysis has become a useful tool in fungal taxonomy and is currently used to identify different fungi [20]. Amplification of the ribosomal gene is used for the genetic identification of many organisms since this comprises both highly conserved sequences during evolution and highly variable sequences which resolve at various taxonomic scales. The ribosomal nuclear DNA consists of transcribed and non-transcribed regions. The ITS1 and ITS2 (internal transcribed spacers) are non-conserved regions and have been amplified by PCR using universal primers ITS1 and ITS4. Complete sequences of the ITS region of many yeasts are currently available on the GenBank.

Details of the antagonism between B. cinerea by Pichia anomala strain FY-102 as well as the PCR amplification of the ITS region of ribosomal nuclear DNA of the antagonist and its sequence are given here.

2Materials and methods

2.1Fungal material

B. cinerea strain BCO3 and P. anomala (strain FY-102) used in this study were taken from the corresponding author's personal collection of the fungi and were grown on solid media like potato dextrose agar (PDA). The B. cinerea isolate was originally taken from the grape-vine plant while that of P. anomala from apple skin. These were also grown in potato dextrose broth (PDB). Vitro-plants (plantlets growing on sterile agar) of Vitis vinifera cultivar ‘Chardonnay’ and ‘Pinot noir’ were taken from the stocks maintained in our laboratory and were inoculated as described earlier [8].

2.1Assay of anti-fungal activity

Antagonism between the Botrytis and the yeast was observed by placing both of these organisms on the same PDA plate and incubating at 25°C for 7 days. All assays were performed under sterile conditions as previously described [14].

A loop full of P. anomala was taken and introduced in 30 ml PDB in sterile flasks. These were placed on a rotary shaker at 25°C. After 48 h of culture. a loop full of mycelium and spores of B. cinerea was taken from a PDA plate and introduced into half of these recipient flasks, the other half was left with pure cultures of P. anomala. The mixture of P. anomala and B. cinerea was again placed on the rotary shaker at 25°C. The mycelium of B. cinerea from this mixture was taken out periodically (24, 48, 72 h) by a sterile needle and observed under the microscope. The spores and the mycelium of B. cinerea having 72 h contact with P. anomala were used for infection experiments.

Infection on the two cultivars (Chardonnay and Pinot noir) of V. vinifera was done on 2-months-old vitro-plants grown on MS medium (Murashig and Skoog). Three sets of six vitro-plants were used in inoculation experiments. Fifty μl of spore suspension (3×105 spores per ml) of B. cinerea was placed on the under surface of the three leaves on each of the first set of vitro-plants to act as control, the second set of vitro-plants were inoculated with 50 μl of the mixture of P. anomala and B. cinerea, and the third set was inoculated with 50 μl of the broth containing only P. anomala.

2.2DNA isolation and PCR amplification

Pure cultures of P. anomala were taken from 24-h PDB broth and centrifuged at 5000×g. The pellet was taken out and re-suspended in TE buffer (10 ml Tris–HCl pH 8, 1 mM EDTA). DNA extraction PCR amplification of the ITS region of the nuclear ribosomal DNA was done according to procedures described earlier [21]. Universal primers ITS1 (TCC GTA GGT GAA CCT GCG G) and ITS4 (TCC TCC GCT TAT TGA TAT GC) were synthesised and the DNA sequence was realised by Oligo Express (Paris, France). ITS1 is at the 3′-end of the 18S rDNA gene and ITS4 is at the 5′-end of the 5.8S rDNA. The ITS sequences of P. anomala were compared with those of related species and were submitted to the GenBank.

3Results

The cells of P. anomala on PDA are mostly cylindrical, up to 4 μm in breadth and up to 25 μm in length, ovoid, rarely spherical with a diameter of up to 4 μm, the cells which are oval to elongate, occur singly, in pairs, in chains or clusters (Fig. 1a,b). Growth on PDA is yellowish tan, dull and smooth or wrinkled. Budding is found on PDA and PDB (Fig. 1c) leading to the formation of moderately branched pseudo-hyphae (Fig. 1d). True hyphae were not observed.

Figure 1.

P. anomala. a: Oval to cylindrical cells; b: elongated cells; c: budding; d: pseudo-hyphae. All figures bar=25 μm.

When B. cinerea (BCO3) was grown with the antagonist yeast P. anomala on the same agar plate, a zone of inhibition appeared around the yeast inoculum. A small block of agar was aseptically cut out from the zone of contact on the PDA plate, placed on a slide in a drop of sterile distilled water sealed under a cover-slip, and viewed under the microscope. There was extensive coagulation of the Botrytis protoplasm and many of the hyphal cells were observed to be completely empty (Fig. 2a–d).

Figure 2.

B. cinerea. a–d: Emptied hyphe in contact with yeast cells. a,b, bar=50 μm; c,d, bar=25 μm.

Experiments with the grape-vine vitro-plants showed that, when inoculated by B. cinerea (first set), the plants develop the characteristic grey mould symptoms and ultimately die (Fig. 3b), those inoculated with a mixture of fungal conidia and P. anomala (second set) were unharmed, developed fully, were vigorous and viable (Fig. 3a), while the vitro-plants inoculated only with the yeast (third set) developed normally without any symptoms on either of the grape-vine cultivars.

Figure 3.

V. vinifera. a: Vigorous grape-vine plant inoculated with B. cinerea and P. anomala. b: Dead grape-vine plant inoculated with B. cinerea only.

The ITS region of the nuclear ribosomal DNA of P. anomala is comprised of 528 bases: CTGTGATTATACCAACACCACACTGTGTGGGCGCACAAAACACCTAAACCTGGAGTATACACACGTCAACAAAAGATCTAAAAGAATAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCGTCGGTATTCCGGCGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTGTGCACCGCGGGGTCTTTGCAGATCCTCTCTGCGCAGAGCTGGCCGTGCCACTGGCCCGGCCGAAAAGAAACGTTGCGGACGAAGCGAACTACATCGGGACGCTTTGGCCGCCGAGCGAAAAAAAAACACCA.

The sequence has been deposited in GenBank (accession number=AF 270936). This was compared with the available sequences of closely related species (BLAST search) such as, Pichia membranifaciens (unpublished, AF 270935); P. guillermondii (AF 032176), Torulospora delbrueckii (D 89599), Candida palmioleophila (AB 016582) and D. hansenii (AF 209874). The CLUSTAL (1.8) multiple alignment sequence is given in Fig. 4.

Figure 4.

CLUSTAL W (1.8) multiple alignment of ITS sequences of P. guillermondii, P. anomala, P. membranifaciens, D. hansenii, C. palmioleophila and T. delbrueckii.

4Discussion

P. anomala (strain FY-102) is a saprophyte isolated from apple skin. The ITS region of its nuclear ribosomal DNA is comprised of 528 bases (1–173=ITS1; 174–296=5.8S gene; 297–528=ITS2). Closely related species according to ALIGN results are: P. guillermondii AF 032176 (75.6% similarity), T. delbrueckii D 89599 (75%), C. palmioleophila AB 016582 (75.2%), D. hansenii AF 209874 (76%) and P. membranifaciens AF 270935 (51.9%).

A number of yeast strains exhibiting antagonism against B. cinerea have been reported in the literature. However, most of these are active against post-harvest pathogens [15–19]. The high frequency of yeasts among the antagonistic agents reported could be related to the fact that yeasts are tolerant to extreme environmental conditions of storage (temperature close to 0°C, high relative humidity etc.) and also because they are adapted to high sugar concentrations, high osmotic pressure and also are tolerant of low pH [22].

In this study, P. anomala has been found to antagonise B. cinerea on the grape-vine vitro-plants. On Petri plates when grown together, the yeast brings about morphological and physiological changes in the hyphae leading to coagulation and destruction of the fungal protoplasm. Thus the parasite is unable to produce the characteristic grey mould symptoms on either of the two cultivars of V. vinifera (Chardonnay and Pinot noir). It has been reported that P. anomala produces an exo-β-1,3-glucanase enzyme that may have an effect on the cell wall degradation of B. cinerea[15]. Hydrolytic enzymes from other antagonists such as Stachybotrys elegans and Schizophyllum commune caused similar effects on the hyphal growth of Rhizoctonia solani and Fusarium monoliform[23]. These enzymes may be involved in the disintegration of the hyphae of B. cinerea. The mycelium of B. cinerea infected with the yeast failed to bring about the characteristic grey mould symptoms. Since P. anomala is not at all pathogenic to V. vinifera, it can be used as a bio-control agent against B. cinerea.

Acknowledgements

The authors would like to thank the following wine producers of the burgundy region of France who have manifested their interest in the ‘biological control’ of grape-vine diseases and have contributed financially in this project: maison Drouhin, maison Boisset, maison Bouchard père and fils, maison Moillard, maison Reine Pédauque and maison Dufouleur frères.

Ancillary