SEARCH

SEARCH BY CITATION

Keywords:

  • Cyanobacterium;
  • Nostoc;
  • Uptake hydrogenase;
  • Hydrogenase accessory hyp gene;
  • Transcription;
  • Reverse transcription polymerase chain reaction

Abstract

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

Maturation of [NiFe]-hydrogenases requires the action of several groups of accessory genes. Homologues of one group of these genes, the so-called hyp genes, putatively encoding proteins participating in the formation of an active uptake hydrogenase in the filamentous, heterocyst-forming cyanobacterium Nostoc PCC 73102, were cloned. The cluster, consisting of hypF, hypC, hypD, hypE, hypA, and hypB, is located 3.8 kb upstream from the uptake hydrogenase-encoding hupSL. Gene expression analyses show that these hyp genes are, like hupL, transcribed under N2-fixing but not under non-N2-fixing growth conditions. Furthermore, the six hyp genes are transcribed together with an open reading frame upstream of hypF, as a single mRNA. Analysis of the DNA region upstream of the experimentally determined transcriptional start site revealed putative −10 and −35 sequence elements and putative binding sites for the global nitrogen regulator NtcA.


1Introduction

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

During the fixation of atmospheric nitrogen (N2) by nitrogenases molecular hydrogen is evolved. For this reduction of protons to H2 at least 25% of the ATP and electrons required for N2 fixation are used [1]. This potential loss of energy is compensated in many N2-fixing bacteria by uptake hydrogenases, membrane-bound dimeric [NiFe]-metalloenzymes consisting of a large and a small subunit, which recapture the H2 produced by nitrogenase (for reviews, see [1–3]). The structural genes encoding both subunits, hupL and hupS, are located within a cluster of up to 20 genes required for expression and maturation of the fully active enzyme in e.g. Rhodobacter capsulatus[4], Bradyrhizobium japonicum[5,6], and Rhizobium leguminosarum[7]. Non-N2-fixing bacteria like Ralstonia eutropha[8,9] and Escherichia coli[10,11] express different types of [NiFe]-hydrogenase catalysing either the production or consumption of H2 under certain physiological conditions.

Expression/maturation of both hydrogenase types requires the function of several accessory genes. The products of one group of accessory genes necessary for [NiFe]-hydrogenase maturation, the hyp (hydrogenase pleiotrophy) genes, are responsible for e.g. the insertion of Ni into the active centre. Deletion of any of the genes hypA, hypB, hypC, hypD, hypE or hypF leads to the expression of metal-free, inactive hydrogenases in R. eutropha[8,9] and R. capsulatus[4] and to the accumulation of Ni-free precursor forms of the large subunit HycE of the E. coli hydrogenase 3 [11].

In cyanobacteria, both types of hydrogenases are present. Uptake hydrogenases, encoded by hupS and hupL, were found in the N2-fixing filamentous strains Anabaena PCC 7120 [12], Anabaena variabilis[13], and Nostoc PCC 73102 [14]. Bidirectional hydrogenases (encoded by hoxYH, hydrogenase part, and hoxFU, diaphorase part) were shown to be present in non-N2-fixing unicellular [15,16] as well as in several filamentous, N2-fixing strains [17,18]. Being [NiFe]-enzymes, both hydrogenase types require the function of hyp gene products. Open reading frames (ORFs) putatively encoding Hyp proteins are spread throughout the genome of Synechocystis PCC 6803 [19], whereas in Synechococcus PCC 6301 hypA, hypB and hypF are located directly downstream of hoxW flanking the hoxUYH gene cluster [16]. A gene cluster encoding homologues of hypA, hypB, hypD, hypE and hypF was detected upstream of hupSL in Anabaena PCC 7120 [20].

In this study we cloned and sequenced six hyp genes, hypF, hypC, hypD, hypE, hypA and hypB, upstream of hupSL in the genome of Nostoc PCC 73102. This strain, originating from a symbiosis in corraloid roots of the cycad Macrozamia, contains neither bidirectional hydrogenase activity nor DNA sequences homologous to hox genes [18,21]. We show by RT-PCR that all six hyp genes are, like hupSL in this strain [22], transcribed as a single mRNA, and locate the start site of this transcript. Like the hupSL transcript, it is detectable under N2-fixing but not under non-N2-fixing conditions.

2Materials and methods

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

2.1Nucleic acid isolation and analysis

Nostoc PCC 73102 was grown as previously described [18]. E. coli strains were grown in LB medium, or on LB agar plates, at 37°C. Total RNA and genomic DNA were isolated from Nostoc PCC 73102 cells as described elsewhere [14,23]. Cosmid and plasmid DNA was isolated from E. coli using the Wizard Minipreps Plus kit (Promega). Restriction analyses with enzymes purchased from Amersham-Pharmacia Biotech were carried out as recommended, and digested DNA was analysed by electrophoresis on 1% agarose/TBE gels [24]. Fragments of interest were cut out from the gels after separation and purified from the gel slices using the Qiaex kit (Qiagen).

2.2Cloning and sequencing

A library containing Nostoc PCC 73102 genomic DNA in the cosmid vector SuperCos1 (Stratagene) was screened for the presence of hupSL using a radioactively labelled 1.5-kb EcoRI/XbaI fragment encoding the 3′ half of hupS and the 5′ half of hupL by standard techniques [24]. Fragments of interest were subcloned into pBluescript II SK+ (Stratagene) and sequenced using the ABI Prism Dye Terminator Sequencing Ready Reaction kit (PE Biosystems) according to the instructions of the manufacturer. The resulting DNA fragments were analysed with an automated DNA sequencer (ABI Prism model 373 DNA sequencer, PE Biosystems). Sequence comparisons were performed using the program BLAST 2.0.3 [25] available on the internet (http://spider.jgi-psf.org/JGI_microbial/html/nostoc_homepage.html).

2.3Transcription analysis

Transcription analysis was carried out as previously described [23]. Total RNA was used for reverse transcription with AMV reverse transcriptase (Promega) using the antisense primers B1 (hypBhypF detection), C1 (hypC–ORF detection), and L1 (hupL detection). cDNA produced in the B1 reaction was used for PCR reactions with the following sense/antisense primer pairs, respectively: E1/B1 (hypE–hypB), and F4/D1 (hypF–hypD). The primer pair O2/F1 (ORF–hypF) was used with cDNA generated with C1. For hupL detection L2 was used as a sense primer. Products of the PCR reactions were analysed using 1% agarose gels. Negative controls included no reverse transcriptase in the RT reaction prior to PCR and dH2O in the PCR, both resulting in no amplificates. For positive controls genomic DNA was used in PCR. The primers used during the transcription analyses are listed in Table 1. 5′-RACE (rapid amplification of cDNA ends) experiments were carried out using a commercially available kit (Life Technologies). For the identification of the transcriptional start site the oligonucleotide primer O1 was used in the RT reaction. All PCR experiments were carried out using a thermal cycler (Master Cycler Gradient, Eppendorf). For verification of their identity the obtained fragments were cloned into the pCR2.1-TOPO vector (Invitrogen) and their sequences determined as described above. Images were captured on film, scanned and edited into Photoshop 4.0.

Table 1.  Primers used in the present study
PrimerSequence 5′[RIGHTWARDS ARROW]3′Reference
B1 (hyp3-R5)GGGAATGAGTGATGATAGTTCCATThis study
C1 (hypC2R)GCCGAATACAAGCTTCGCThis study
D1 (hypDQ-R)TAATTTCGCTTTGTGGTAGGThis study
E1 (hypE-3L-SEQ1)TTCTTCACCTCCAGGTATAGTTTTGThis study
F1 (HFB2)TCTGTTAATGCTTCCTCAGTACThis study
F2 (hypF2F)GGATATCTGGTACTGAGGThis study
F3 (hypF1R)GCATCAACATCATCCAGCThis study
F4 (hypF4F)GTTCCAGCGAATGACGGCThis study
L1 (HNos4B)CCACTTTTCATAATCAT[3,31]
L2 (HNos3A)CTGTTGGGCGGACAATGGCCTCA[3,31]
O1 (hypUP3)GTGGCATTGGGTACTACAGGTATAAThis study
O2 (hypORFF)ATTGCAAGGTGTAATGGCThis study

3Results and discussion

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

3.1Cloning of hypF, hypC, hypD, hypE, hypA and hypB– analysis of the deduced protein sequences

The hyp genes were cloned while searching for genes upstream and downstream of hupSL in Nostoc PCC 73102 [14]. The 5′-end of hypF was located at one end of an EcoRI 4.7-kb subfragment of a hupSL-containing cosmid, the other end of which encoded the 5′-end of hupS on the opposite strand. The distance between hupS and hypF was determined to be 3.8 kb by PCR using primers in hupS and hypF, respectively (not shown). The five hyp genes (hypF, hypB, hypA, hypE, hypD; originally published as hup genes) previously identified in Anabaena PCC 7120 were also located upstream of hupS and the deduced proteins are 84–90% similar to the corresponding Nostoc PCC 73102 gene products [20]. Lower similarities (43–63%) of the Nostoc PCC 73102 hyp gene products are observed to the putative Synechocystis PCC 6803 Hyp proteins [19]. The highest similarity of the deduced Nostoc PCC 73102 proteins with identified Hyp proteins can be found with R. capsulatus[28], being 60, 58, 57, 69, 66, and 55% for HypABCDEF, respectively.

The Nostoc PCC 73102 hypF product (782 amino acids) is characterised by an N-terminal acylphosphatase domain and a double zinc finger motif [C-x2-C-x18-C-x2-C]-x24-[C-x2-C-x18-C-x2-C]. These two signatures are found in all HypF sequences reported so far, except HypF1 of R. eutropha[8]. The zinc fingers in the N-terminal part of HypF are believed to be involved in sensing Ni. Mutants of R. eutropha with a deletion in the recently cloned HypF2, however, exhibit hydrogenase activity, due to the still present HypF1, a truncated HypF lacking the N-terminal half and thus the acylphosphatase and the zinc finger domain. Since a ΔhypF1/hypF2 double mutant does not show any hydrogenase activity [9], the two N-terminal motifs do not seem to be essential for the Ni sensing and insertion function. Instead, this function of HypF should be located in the C-terminal half. His residues are notorious for their ability to bind Ni, and many of the conserved His residues are located in the C-terminal half. It also contains a short pentapeptide consisting of the residues 492–496 with the sequence HHHAH. This motif is also found in the Klebsiella aerogenes UreE protein, an accessory protein known to be essential for the insertion of Ni into the urease (UreE) of this bacterium. Mutants with a deleted ureE gene contain an inactive, Ni-free urease [29]. The conserved His residues might therefore be more important for the postulated function of HypF, the incorporation of Ni into the hydrogenase active centre, than the zinc finger motifs.

Nostoc PCC 73102 HypC (89 amino acids) shows a PROSITE signature motif typical for the family of the small hydrophobic HupF/HypC proteins (75–110 residues). It contains all amino acid residues of the motif M-C-[LIV]-[GA]-[LIV]-P-x-[QKR]-[LIV]. This signature motif is not found in any other protein sequence in the databases and thus identifies HypC. In E. coli it could be demonstrated that HypC forms a complex with the hydrogenase 3 large subunit precursor pre-HycE. This complex formation is essential for the maturation of hydrogenase 3 [11].

hypD encodes a 392-amino acid protein, which carries the potential metal binding motif CPVC. No precise function of HypD has been identified yet.

The Nostoc PCC 73102 hypE encoded a 367-amino acid protein and has a conserved AIR synthetase (phosphoribosyl-aminoimidazole synthetase; EC 6.3.3.1) motif. No information about the function of HypE in the bacterial hydrogenase maturation process is available yet, although an interaction between HypF and HypE could be demonstrated in Helicobacter pylori[30].

The 113-amino acid gene product of hypA has an [FeS] cluster or zinc finger motif. The function of HypA is not known yet.

HypB has been proposed to be a major contributor to insertion of the Ni atom into the large hydrogenase subunit. As in the case of hypC and hypF, ΔhypB mutants produce Ni-free hydrogenase precursors [8,31]. Like all HypB proteins, the deduced Nostoc PCC 73102 275-amino acid protein has a conserved GTP binding motif at the C-terminus, which was shown to be essential for Ni insertion [6,32,33]. The N-terminal part of the protein is rich in His residues, which are probably involved in Ni storage and/or transport [33].

The cloned ORF upstream of hypF shows no homology to any known gene/protein in the databases.

3.2Expression analysis of the cloned genes

RT-PCR experiments using RNA isolated from Nostoc PCC 73102 grown under non-N2-fixing and N2-fixing conditions with hypF- and hupL-specific primers (Table 1) showed that hypF and hupL transcripts were not present in non-N2-fixing cultures, but can be detected under N2-fixing conditions (Fig. 1). Previously, hypB of Anabaena PCC 7120 was also shown to be expressed exclusively during N2 fixation [20]. This may be considered unexpected, since this strain contains both a bidirectional and an uptake hydrogenase [18].

image

Figure 1. Expression of hypF in comparison to hupL in Nostoc PCC 73102. Total RNA isolated from Nostoc PCC 73102 cells was used in RT reactions using primers specific for hypF (F4, position see Fig. 2) and hupL. cDNA generated with F4 was used in a PCR with primer F5 for hypF (A), cDNA generated with L1 in a PCR with L2 for hupL (B). For sequences of the primers, see Table 1. Lane 1: 100 bp ladder; lane 2: RT-PCR with RNA from cells grown under non-N2-fixing conditions; lane 3: RT-PCR with RNA from cells grown under N2-fixing conditions; lane 4: control without reverse transcriptase in the control without reverse transcriptase in the RT-PCr with RNA from cells grown under N2-fixing conditions; lane 6: control with dH2O in the PCR; lane 7: positive controls with genomic DNA in the RT-PCR.

Download figure to PowerPoint

In 5′-RACE experiments, using primers of the 5′ region of both the hypF and hypC transcripts, no transcription start site could be identified upstream of either hypF or hypC. However, using a primer binding to the 5′ region of the ORF resulted in a 300-bp product (result not shown, but see Table 1 and Fig. 2). By cloning and sequencing the PCR product the transcriptional start site could be identified 17 bp upstream of the potential ORF (Fig. 2). Because of the short distance from the putative translation start of the ORF we analysed the identified ORF sequence in more detail. In addition to the ATG representing the start of the complete ORF, several additional start codons could be identified. Three putative start codons are indicated as a, b and c in Fig. 2. Being a unique ORF with no similarities to any known sequences in the databases, it is premature to exactly determine the size of this putative ORF.

image

Figure 2. Physical map of hypFCDEAB (grey shaded) in Nostoc PCCC 73102 including the upstream ORF and the downstream putative hlyA. Conserved regions in the deduced Hyp proteins are marked at the corresponding positions in the respective genes. The positions of the primers used in 5′-RACE experiments (grey box), RT reactions and PCR are shown (for primer sequences see Table 1). The primer O1 was used in the RT reaction for 5′-RACE experiments (grey box). The transcriptional start site (+1), as well as putative −10 and −35 sequence elements (italic bold) and putative NtcA binding sites (underlined) are indicated. Furthermore, three possible start codons (a, b, c) of the ORF are presented (see text). The primers B1 and C1 were used for cDNA generation in transcript analyses. Primer pairs used in the subsequent PCR, the resulting PCR products and the corresponding agarose gels are shown. M=100-bp ladder, (+)=PCR fragment, (−)=negative control without RT, H2O=negative control with water, DNA=positive control with DNA.

Download figure to PowerPoint

Using the primer B1, binding within hypB, in an RT reaction led to the synthesis of a cDNA, which generated PCR products with primer pairs covering hypFCD (F4/D1) and hypEAB (E1/B1) (Fig. 2). However, no PCR products with primer pairs covering the ORF and hypF were obtained. This is explainable by the limited capacity of the reverse transcriptase in the generation of long cDNAs. A primer pair covering the ORF and hypF (O2/F1) in a PCR following an RT reaction with a hypC-specific primer (C1) led to the amplification of a DNA fragment with the expected size (Fig. 2) and sequence. These results demonstrate that hypFCDEAB are transcribed, together with the ORF upstream from hypF, as a single mRNA (Fig. 2). Downstream of hypB an ORF in the opposite direction encoding a putative haemolysin-type calcium binding protein (hlyA) was identified. The transcription of hyp gene clusters as operons was previously reported for several bacteria such as B. japonicum[5] or R. eutropha[34]. However, in Synechococcus PCC 6301 a transcript consisting of hoxUYHWhypAB was recently demonstrated by RT-PCR, while hypF, which is located directly downstream of hypAB, seems to be part of another transcript [16].

Upstream of the transcriptional start site, putative −10 and −35 elements and putative NtcA binding sites [35], one of them overlapping the −35 element, can be identified (Fig. 2). NtcA is a global nitrogen regulator in cyanobacteria [36]. In Anabaena PCC 7120 an NtcA binding site upstream of hetC, an ATP binding cassette transporter, has been identified, which appears to substitute for the −35 element [37]. A putative NtcA binding site has also been identified upstream of the hupSL transcriptional start site [22], and might be responsible for the regulation of both ORFhypFCDEAB and hupSL.

Acknowledgements

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

The authors thank Per Paulsrud for providing the Nostoc PCC 73102 cosmid library. This study was financially supported by grants from the Swedish National Energy Administration (Statens Energimyndighet), Ångpanneföreningens Forskningsstiftelse (Sweden), and the Swedish Natural Science Research Council (NFR).

References

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References
  • [1]
    Hansel, A, Lindblad, P (1998) Towards optimization of cyanobacteria as biotechnologically relevant producers of hydrogen, a clean and renewable energy source. Appl. Microbiol. Biotechnol. 50, 153160.
  • [2]
    Friedrich, B, Schwartz, E (1993) Molecular biology of hydrogen utilization in aerobic chemolithotrophs. Annu. Rev. Microbiol. 47, 351383.
  • [3]
    Maier, R.J., Triplett, E.W. (1996) Toward more productive, efficient, and competitive nitrogen-fixing symbiotic bacteria. Crit. Rev. Plant Sci. 15, 191234.
  • [4]
    Colbeau, A, Elsen, S, Tomiyama, M, Zorin, N.A., Dimon, B, Vignais, P.M. (1998) Rhodobacter capsulatus HypF is involved in regulation of hydrogenase synthesis through the HupUV proteins. Eur. J. Biochem. 251, 6571.
  • [5]
    Olson, J.W., Maier, R.J. (1997) The sequences of hypF, hypC, and hypD complete the hyp gene cluster required for hydrogenase activity in Bradyrhizobium japonicum. Gene 199, 9399.
  • [6]
    Olson, J.W., Fu, C, Maier, R.J. (1997) The HypB protein from Bradyrhizobium japonicum can store nickel and is required for the nickel-dependent transcriptional regulation of hydrogenase. Mol. Microbiol. 24, 119128.
  • [7]
    Rey, L, Fernández, D, Brito, B, Hernando, Y, Palacios, J.-M, Imperial, J, Ruiz-Argüeso, T (1996) The hydrogenase gene cluster of Rhizobium leguminosarum bv. Viciae contains an additional gene (hypX), which encodes a protein with sequence similarity to the N10-formyltetrahydrofolate-dependent enzyme family and is required for nickel-dependent hydrogenase processing and activity. Mol. Gen. Genet. 252, 237248.
  • [8]
    Dernedde, J, Eitinger, T, Patenge, N, Friedrich, B (1996) hyp gene products in Alcaligenes eutrophus are part of a hydrogenase-maturation system. Eur. J. Biochem. 235, 351358.
  • [9]
    Wolf, I, Buhrke, T, Dernedde, J, Pohlmann, A, Friedrich, B (1998) Duplication of hyp genes involved in maturation of [NiFe] hydrogenases in Alcaligenes eutrophus H16. Arch. Microbiol. 170, 451459.
  • [10]
    Maier, T, Lottspeich, F, Böck, A (1996) GTP hydrolysis by HypB is essential for nickel insertion into hydrogenases of Escherichia coli. Eur. J. Biochem. 230, 133138.
  • [11]
    Drapal, N, Böck, A (1998) Interaction of the hydrogenase accessory protein HypC with HycE, the large subunit of Escherichia coli hydrogenase 3 during enzyme maturation. Biochemistry 37, 29412948.
  • [12]
    Carrasco, C, Buettner, J, Golden, J.W. (1995) Programed DNA rearrangement of a cyanobacterial hupL gene in heterocysts. Proc. Natl. Acad. Sci. USA 92, 791795.
  • [13]
    Happe, T, Schütz, K, Böhme, H (2000) Transcriptional and mutational analysis of the uptake hydrogenase of the filamentous cyanobacterium Anabaena variabilis ATCC 29413. J. Bacteriol. 182, 16241631.
  • [14]
    Oxelfelt, F, Tamagnini, P, Lindblad, P (1998) Hydrogen uptake in Nostoc sp. strain PCC 73102. Cloning and characterization of a hupSL homologue. Arch. Microbiol. 169, 267274.
  • [15]
    Appel, J, Schulz, R (1996) Sequence analysis of an operon of NAD(P)-reducing nickel hydrogenase from the cyanobacterium Synechocystis sp. PCC 6803 gives additional evidence for coupling of the enzyme to NADP(H)-dehydrogenase (complex I). Biochim. Biophys. Acta 1298, 141147.
  • [16]
    Boison, G, Bothe, H, Schmitz, O (2000) Transcriptional analysis of hydrogenase genes in the cyanobacteria Anacystis nidulans and Anabaena variabilis monitored by RT-PCR. Curr. Microbiol. 40, 315321.
  • [17]
    Schmitz, O, Boison, G, Hilscher, R, Hundeshagen, B, Zimmer, W, Lottspeich, F, Bothe, H (1995) Molecular biological analysis of a bidirectional hydrogenase from cyanobacteria. Eur. J. Biochem. 233, 266276.
  • [18]
    Tamagnini, P, Troshina, O, Oxelfelt, F, Salema, R, Lindblad, P (1997) Hydrogenases in Nostoc sp. strain PCC 73102, a strain lacking a bidirectional enzyme. Appl. Environ. Microbiol. 63, 18011807.
  • [19]
    Nakamura, Y, Kaneko, T, Hirosawa, M, Myajima, N, Tabata, S (1998) Cyanobase, a www database containing the complete nucleotide sequence of Synechocystis sp. strain PCC 6803. Nucleic Acids Res. 26, 6367.
  • [20]
    Gubili, J, Borthakur, D (1998) Organization of the hupDEAB genes within the hydrogenase gene cluster of Anabaena sp. strain PCC 7120. J. Appl. Phycol. 10, 163167.
  • [21]
    Boison, G, Bothe, H, Hansel, A, Lindblad, P (1999) Evidence against a common use of the diaphorase subunits by the bidirectional hydrogenase and by the respiratory complex I in cyanobacteria. FEMS Microbiol. Lett. 174, 159165.
  • [22]
    Lindberg, P, Hansel, A, Lindblad, P (2000) hupS and hupL constitute a transcription unit in the cyanobacterium Nostoc sp. PCC 73102. Arch. Microbiol. 174, 129133.
  • [23]
    Axelsson, R, Oxelfelt, F, Lindblad, P (1999) Transcriptional regulation of Nostoc uptake hydrogenase. FEMS Microbiol. Lett. 170, 7781.
  • [24]
    Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • [25]
    Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J, Zhang, Z, Miller, W, Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 33893402.
  • [26]
    Thompson, J.D., Higgins, D.G., Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 46734680.
  • [27]
    Bairoch, A, Bucher, P, Hofmann, K (1997) The PROSITE database, its status in 1997. Nucleic Acids Res. 25, 217221.
  • [28]
    Colbeau, A, Richaud, P, Toussaint, B, Caballero, F.J., Elster, C, Delphin, C, Smith, R.L., Chabert, J, Vignais, P.M. (1993) Organization of the genes necessary for hydrogenase expression in Rhodobacter capsulatus. Sequence analysis and identification of two hyp regulatory mutants. Mol. Microbiol. 8, 1529.
  • [29]
    Lee, M.H., Pankratz, H.S., Wang, S, Scott, R.A., Finnegan, M.G., Johnson, M.K., Ippolito, J.A., Christianson, D.W., Hausinger, R.P. (1993) Purification and characterization of Klebsiella aerogenes UreE protein: a nickel-binding protein that functions in urease metallocenter assembly. Protein Sci. 2, 10421052.
  • [30]
    Rain, J.C., Selig, L, De Reuse, H, Battaglia, V, Reverdy, C, Simon, S, Lenzen, G, Petel, F, Wojcik, J, Schachter, V, Chemama, Y, Labigne, A, Legrain, P (2001) The protein-protein interaction map of Helicobacter pylori. Nature 409, 211215.
  • [31]
    Sargent, F, Ballantine, S.P., Rugman, P.A., Palmer, T, Boxer, D.H. (1998) Reassignment of the gene encoding the Escherichia coli hydrogenase 2 small subunit – identification of a soluble precursor of the small subunit in a hypB mutant. Eur. J. Biochem. 255, 746754.
  • [32]
    Maier, T, Lottspeich, F, Bock, A (1995) GTP hydrolysis by HypB is essential for nickel insertion into hydrogenases of Escherichia coli. Eur. J. Biochem. 230, 133138.
  • [33]
    Olson, J.W., Maier, R.J. (2000) Dual roles of Bradyrhizobium japonicum nickelin protein in nickel storage and GTP-dependent Ni mobilization. J. Bacteriol. 182, 17021705.
  • [34]
    Schwartz, E, Buhrke, T, Gerischer, U, Friedrich, B (1999) Positive transcriptional feedback controls hydrogenase expression in Alcaligenes eutrophus H16. J. Bacteriol. 181, 56845692.
  • [35]
    Jiang, F, Wissen, S, Widersten, M, Bergman, B, Mannervik, B (2000) Examination of the transcription factor NtcA-binding motif by in vitro selection of DNA sequences from a random library. J. Mol. Biol. 301, 783793.
  • [36]
    Herrero, A, Muro-Pastor, A.M., Flores, E (2001) Nitrogen control in cyanobacteria. J. Bacteriol. 183, 411425.
  • [37]
    Muro-Pastor, A.M., Valladares, A, Flores, E, Herrero, A (1999) The hetC gene is a direct target of the NtcA transcriptional regulator in cyanobacterial heterocyst development. J. Bacteriol. 181, 66646669.