SEARCH

SEARCH BY CITATION

Keywords:

  • Flagella;
  • Invasion;
  • Chicken;
  • Egg;
  • Salmonella

Abstract

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. References

To explore the relative contribution that flagella and Salmonella invasion proteins make to the virulence of Salmonella enteritidis in poultry, 20-day-old chicks were challenged orally and by subcutaneous injection with wild-type strain SE-HCD, two non-flagellated mutants (fliC::Tn10 mutant and flhD::Tn10 mutant) and two Salmonella invasion protein insertion mutants (sipD and iacP). When injected subcutaneously, wild-type SE-HCD was the only strain to cause substantial mortality and morbidity and to grow well in organs. The flhD mutant of SE-HCD was invasive when given orally, whereas wild-type SE-HCD and the fliC mutant were significantly attenuated. Salmonella invasion protein mutants were not invasive by either route. These results suggest that temporary suppression of Class I regulators of flagellin biosynthesis may aid oral infection in poultry.


1Introduction

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. References

Salmonella enterica serovar enteritidis (Salmonella enteritidis) is a major cause of human food-borne illness, due in part to its ability to infect poultry and to contaminate eggs [1,2]. Virulence characterization of invasive S. enteritidis has highlighted that flagellation is one of several distinguishing virulence markers in poultry [3,4]. However, there is evidence against flagellation as an important virulence factor for S. enterica[5]. Significantly, the egg-contaminating serotype Salmonella pullorum/gallinarum is highly pathogenic for birds, but lacks flagella and is non-motile [6]. Some investigations report that loss of flagellation might be associated with increased production of virulence factors [7], but surface migration by hyperflagellated swarm cells has also been associated with virulence in other Gram-negative bacteria including Salmonella[8,9]. Although it is not clear from these studies the degree to which flagella contributes to virulence in poultry, the literature provides ample evidence for the importance of large arrays of virulence genes encoding Salmonella invasion proteins (SIPs) located in the Salmonella pathogenicity islands (SPI) [10,11]. To further understand how virulence factors contribute to egg contamination, and especially to further address the role of flagella in birds, we compared the relative ability of flagella and SIP mutants of S. enteritidis to infect 20-day-old chicks following oral and subcutaneous challenge.

2Materials and methods

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. References

2.1Description of wild-type S. enteritidis

S. enteritidis SE-HCD (phage type 13a) is a wild-type strain that has been characterized for virulence attributes in chicks [12,13]. It has a propensity to hyperflagellate [14], to be parenterally adapted [15], to produce unusual lipopolysaccharide O-chain structures [16], and to grow to high cell density in culture [14]. It is moderately invasive when given orally as compared to some strains of S. enteritidis, but it grows to high numbers in spleens [15]. In addition to the large 37-kb Salmonella virulence plasmid, SE-HCD also has a bioluminescence reporter plasmid lacking luxI, which will produce luciferase in correlation with growth to high cell density in broth culture [13].

2.2Description of flagellar transposon mutants

A Salmonella typhimurium flhD::Tn10 mutant [17] was obtained from V. Koronakis, Cambridge University, UK, and a S. typhimurium fliC::Tn10 mutant [14] from A. O'Brien, F.E. Herbert School of Medicine. The flhD::Tn10 and fliC::Tn10 mutations were introduced into S. enteritidis from S. typhimurium by P22HT-int transductions using standard techniques [18]. All tetracycline resistant transductants were non-motile in soft agar and did not swarm under growth conditions that aid flagellation [14] (data not shown). The location of transposons within targeted fliC and flhD genes was confirmed by polymerase chain reaction (PCR) amplification of wild-type and mutant chromosomal DNA using upper and lower wild-type primer pairs and a Tn10 identifying primer as listed below (Medline accession numbers and GenBank identification follows sequence) (Fig. 1): flhDU, GTTGGTTATTCTGGATGGGAA; flhDL, CGCTGCTGGAGTGTTTGT (Medicine accession number: AFO29300, GenBank identification: 2772916); fliCU, GGCAATCTGGAGGCAAAGTTTA; fliCL, ACCACGTGTCGGTGAATCAATC (Medicine accession number: D13689, GenBank identification: 217062); Tn10Rout, ACCACGTGTCGGTGAATCAATC (Medicine accession number: AF223162, GenBank identification: 7739612).

image

Figure 1. Confirmation of placement of the Tn10 transposon and the kanamycin resistance cassette into respective flagella and SIP genes of S. enteritidis. Shown are electrophoresed PCR products following hybridization of chromosomal DNA from appropriate strains to the following pairs of primers: Lanes 1 and 12, MW markers; lane 2, HCD-fliCU/fliCL; lane 3, HCDfliC::Tn10-fliCU/fliCL; lane 4, HCDfliC::Tn10-fliCU/Tn10Rout; lane 5, HCD-flhDU/flhDL; lane 6, HCDflhD::Tn10-flhDU/flhDL; lane 7, HCDflhD::Tn10-flhDU/Tn10Rout; lane 8, HCD-iacPU/L; lane 9, HCDiacP::kan-iacPU/L; lane 10, HCD-sipDU/L; lane 11, HCDsipD::kan-sipDU/L.

Download figure to PowerPoint

Fine map analysis of chromosomal DNA obtained from wild-type and its fliC and flhD mutants showed that laboratory manipulations did not introduce unexpected genomic rearrangements, because these three strains had indistinguishable patterns and remained genetically similar to other clinical and veterinary isolates from disparate sources that were phage type 13a [19]. Growth curves were conducted to assess growth rates of wild-type SE-HCD and its fliC and flhD mutants. The flhD mutant of SE-HCD grew to approximately twice the cell density as either wild-type or the fliC mutant in tryptone broth, which is an expected consequence of mutation because cells from flhD mutants are shorter than wild-type [20,21].

2.3Construction of sipD and iacP mutants

To create the sipD mutant, a 1.1-kb fragment harboring the sipD gene was amplified via PCR from S. typhimurium utilizing primer sipD25 (5′-ATCTAT ACGCCATCATGGGTG T-3′) and primer sipD1173 (5′-TGATCTCGGTCTGCATACCTG-3′) (GenBank accession number: U40013). Next, we TA cloned the PCR-generated fragment into pGEM-T (Promega). To create an insertional mutation, this recombinant plasmid was opened at a unique BglII site within sipD and a BamHI fragment containing a kan cassette from pUC-4K was ligated into this site. The sipD::kan fragment was then excised from pGEM-T using SphI and SacI and subcloned into pCVD442 [22], a positive selection suicide vector. For the iacP mutant, a three-step PCR procedure was performed. In the first two steps of PCR, a 419-bp fragment containing the 5′-end of the iacP gene was amplified with primers iacP1866 (5′-TAAAGAGTGCAGCGTTGA-3′) and iacP2285L (5′-AGCGTAAAGATCTT CAACCAGATG-3′), and a 527-bp fragment containing the 3′-end of the iacP gene was amplified with primers iacP2285U (5′-CATCTGGTTGAAGATCTTTACGCT-3′) and iacP2812L (5′-TAAACCC AATTTCTCACC A-3′). The resulting products were gel purified using QIAquick gel extraction (Qiagen, Valencia, CA, USA) and then used together in a third step of overlapping extension PCR using primers iacP1866 and iacP2816 to produce a 946-bp fragment that was TA cloned into pGEM-T. To create an insertional mutation, this recombinant plasmid was opened at a unique BglII site within iacP created by primers iacP2285 (site underlined) and a BamHI fragment containing a kan cassette from pUC-4K was ligated into this site. The iacP::kan fragment was then excised from pGEM-T using SphI and SacI and subcloned into pCVD442.

These suicide plasmids were subsequently transformed into Escherichia coli SM10λpir and mated to SE6-E21. To enrich for bacteria that had resolved the integrated plasmid, conjugants were grown in LB without antibiotics followed by plating on LB containing 5% sucrose and no salt, and incubation overnight at 30°C to select for the loss of the sacB-containing plasmid. Isolated colonies were then screened for the loss of the plasmid-encoded ampicillin resistance and the acquisition of kanamycin resistance. The chromosomal mutation was verified by PCR. Finally, the mutation was transduced by P22HT-int into SE-HCD as described [23]. Insertion of the kanamycin cassette into the targeted gene in SE-HCD was confirmed by detection of a PCR product that was larger than wild-type (Fig. 1). Growth characteristics of SIP mutants were similar to those of wild-type.

2.4Preparation of cultures for challenge of 20-day-old chicks

Challenge inocula were prepared by incubating SE-HCD and mutants for 16 h at 37°C without shaking, followed by shaking for 3 h at rpm setting of 8 on a New Brunswick Model G76, which resulted in an 1/10 OD600 of 0.4 and lux reading of 52×103 lux units (Turner luminometer). These conditions indicated that cells were in the early stage of high cell density growth [13]. Dosage was determined by serial 10-fold dilutions of cells on BG agar and then incubating plates at 37°C for 16 h before counting colony-forming units (CFU). Final average dose per chick was 5.1±0.4×106 CFU for all strains. Chicks from a specific pathogen free flock were challenged orally and subcutaneously by injection in separate experiments. Relative virulence of strains was determined by measuring mortality and morbidity, by determining if spleens were culture positive, and by counting CFU of salmonellae in the spleens of surviving chicks 3 days post-inoculation as previously described [12].

2.5Statistical analyses

A 10-fold difference in recovery of the average CFU per spleen from groups of 8–10 chicks has been noted before to be significant as analyzed by t-test and cluster analysis, even when standard deviations were large [12]. Cluster analysis of chick spleen counts, which is shown in Table 1 as a ranking of data, is an effective method for dealing with wide standard deviations [24]. Cluster analysis is considered a more stringent method for analyzing the significance of data sets that are composed of mixed subpopulations and non-random data distribution patterns, whereas t-test analysis is best suited for analysis of variation occurring within a single population where selection of data at random followed by ranking will produce a single bell curve [24–26]. At P values of 0.1 or less, results from t-test analysis of data for significance agree with results obtained by using cluster analysis, and thus values equal to or less than 0.1 are considered to indicate significance. S. enteritidis is known to exist in culture as mixed subpopulations that when separated have different virulence potentials in birds [12,15,27–30]. For these reasons, both t-test and cluster analyses of spleen counts are provided in Table 1 to substantiate the significance of the differences seen between strains (Table 1).

Table 1.  Challenge of 20-day-old chicks with SIP and flagellar mutants of S. enteritidis
Virulence parameterOralSubcutaneous
 SE-HCDfliCflhDsipDiacPSE-HCDfliCflhDsipDiacP
  1. aNa, not analyzed because fewer than three positive spleens were recovered.

Number of chicks challenged101010101010881010
% Morbidity/mortality00100040001010
% Positive spleens (number positive/number survivors)60 (6/10)60 (6/10)89 (8/9)0 (0/10)10 (1/10)100 (8/8)100 (8/8)100 (8/8)100 (9/9)100 (9/9)
Average CFU per positive spleen (×103)13252295naana66508152239040
t-Test P value0.200.07nana0.090.080.070.07
Cluster analysis of spleen counts (CFU)          
%<104100.0100.025.0nana37.50.050.066.788.9
% 1050.00.025.0nana25.062.550.033.311.1
% 1060.00.037.5nana12.537.50.00.00.0
% 1070.00.012.5nana0.00.00.00.00.0
%>1080.00.00.0nana25.00.00.00.00.0

3Results

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. References

3.1Results from oral challenge of 20-day-old chicks

SE-HCD was moderately invasive when infection was by the oral route (60% positive spleens), but yielded only low numbers of CFU in those spleens that were positive (average 13 CFU per spleen) (Table 1). The fliC mutant was similar to wild-type (60% positive spleens, average of 25 CFU per spleen), indicating that the presence of flagellin was not necessary to achieve at least a moderate level of oral invasion. In comparison, the flhD mutant yielded a higher percentage of positive spleens (89%) and CFU counts per spleen were two logs higher than what was obtained by oral infection of chicks with wild-type or the fliC mutant (2295 CFU per spleen) (Table 1). Mutation of sipD and iacP nearly eliminated oral invasiveness in chicks, which left too few positive spleens for further statistical analysis (Table 1). Cluster analysis indicated that flhD SE-HCD had substantial population heterogeneity, which is demonstrated as placement of spleen counts for individual chicks in four of five clusters (Table 1). Thus, it appears that the absence of FlhD (and possibly other Class I regulatory components of the flhDC operon) rather than the absence of motility or flagellin enhanced the oral invasiveness of SE-HCD (Table 1). While P22 transduction might have inadvertently transferred a genetic change from one serovar to the other that could have affected results, we could find no evidence that this was probable. The parent S. typhimurium strains used to transfer mutation to SE-HCD are well-characterized and available chromosomal databases of S. typhimurium and S. enteritidis reveal no significant differences in genetic sequence where mutations were targeted [17,31]. Construction of flagellar mutants in a different phage type of S. enteritidis resulted in a similar result, which was that flhD S. enteritidis was more virulent than wild-type when given orally (data not shown). Overall these results strongly suggest that oral invasiveness is a stage in the infectious process in chicks that requires SIPs and that appears to be enhanced by the absence of the Class I regulator FlhD.

3.2Results from subcutaneous challenge of 20-day-old chicks

When challenge was by the subcutaneous route, all mutants were significantly attenuated in comparison to wild-type SE-HCD, as determined by average CFU spleen counts and by observing a narrowing in the spread of data across clusters (Table 1). SE-HCD was the only strain that produced considerable mortality and morbidity in chicks (defined as illness likely leading to death within the next 24 h). In addition, SE-HCD injected subcutaneously produced the highest spleen counts in two of eight chicks (Table 1: counts greater than 108 CFU per spleen). All mutants had a narrower range of CFU recovered from spleens than did wild-type, which suggests that mutation in general limits subpopulation variability that aids growth in spleens (Table 1). Mutation of SIP genes appeared to be more attenuating than mutation of flagellar genes, because a lack of SIPs resulted in the largest decrease in the number of CFU recovered from spleens following subcutaneous challenge (Table 1).

4Discussion

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. References

Two types of flagellar mutants were made, because flagellar biosynthesis is a complex process requiring a hierarchy of genes located in three different classes of operons [17,32] and both a Class I master operon mutant and a Class III mutant would be non-flagellated and hence non-motile. However, fluctuations in Class I regulators of flagellin biosynthesis are known to greatly affect cellular development and hence virulence of Salmonella and other Gram-negative pathogens [10,20,21,33–36]. The surprising finding that the absence of FlhD enhanced oral invasiveness in these experiments suggests that the advantages to the pathogen associated with flagellation and motility are limited in scope in birds. In contrast, SIP proteins appear to be as essential for invasiveness in birds as they are in mammals. Thus, avian-adapted non-motile salmonellae may have evolved to optimize oral colonization at the expense of narrowing host range to birds, whereas motile salmonellae retain flagellation perhaps to aid productive infection with a wider range of hosts. There is evidence that some salmonellae strains that are serotyped as S. pullorum may actually be S. enteritidis strains that have suppressed flagellation [14,37]. Thus, it is conceivable that human illness from S. enteritidis could have increased when an avian-adapted subpopulation with enhanced oral invasiveness emerged on-farm. However, this type of subpopulation has not yet been identified in a research setting. Further investigation is in progress to determine if flhD S. enteritidis aids the process of egg contamination in experimentally infected hens.

References

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. References
  • [1]
    St. Louis, M.E., Morse, D.L., Potter, M.E., DeMelfi, T.M., Guzewich, J.J., Tauxe, R.V., Blake, P.A. (1988) The emergence of grade A eggs as a major source of Salmonella enteritidis infections. New implications for the control of salmonellosis [see comments]. J. Am. Med. Assoc. 259, 21032107.
  • [2]
    Timoney, J.F., Shivaprasad, H.L., Baker, R.C., Rowe, B (1989) Egg transmission after infection of hens with Salmonella enteritidis phage type 4. Vet. Rec. 125, 600601.
  • [3]
    Allen-Vercoe, E, Woodward, M.J. (1999) The role of flagella, but not fimbriae, in the adherence of Salmonella enterica serotype Enteritidis to chick gut explant. J. Med. Microbiol. 48, 771780.
  • [4]
    Allen-Vercoe, E, Sayers, A.R., Woodward, M.J. (1999) Virulence of Salmonella enterica serotype Enteritidis aflagellate and afimbriate mutants in a day-old chick model. Epidemiol. Infect. 122, 395402.
  • [5]
    Lockman, H.A., Curtiss, R.D. (1990) Salmonella typhimurium mutants lacking flagella or motility remain virulent in BALB/c mice. Infect. Immun. 58, 137143.
  • [6]
    Shivaprasad, H.L. (2000) Fowl typhoid and pullorum disease [in process citation]. Rev. Sci. Tech. 19, 405424.
  • [7]
    Gardel, C.L., Mekalanos, J.J. (1996) Alterations in Vibrio cholerae motility phenotypes correlate with changes in virulence factor expression. Infect. Immun. 64, 22462255.
  • [8]
    Allison, C, Lai, H.C., Hughes, C (1992) Co-ordinate expression of virulence genes during swarm-cell differentiation and population migration of Proteus mirabilis. Mol. Microbiol. 6, 15831591.
  • [9]
    Flanary, P.L., Allen, R.D., Dons, L, Kathariou, S (1999) Insertional inactivation of the Listeria monocytogenes cheYA operon abolishes response to oxygen gradients and reduces the number of flagella. Can. J. Microbiol. 45, 646652.
  • [10]
    Galan, J.E. (1996) Molecular genetic bases of Salmonella entry into host cells. Mol. Microbiol. 20, 263271.
  • [11]
    Collazo, C.M., Galan, J.E. (1997) The invasion-associated type III system of Salmonella typhimurium directs the translocation of Sip proteins into the host cell. Mol. Microbiol. 24, 747756.
  • [12]
    Guard-Petter, J, Lakshmi, B, Carlson, R, Ingram, K (1995) Characterization of lipopolysaccharide heterogeneity in Salmonella enteritidis by an improved gel electrophoresis method. Appl. Environ. Microbiol. 61, 28452851.
  • [13]
    Guard-Petter, J (1998) Variants of smooth Salmonella enterica serovar Enteritidis that grow to higher cell density than the wild type are more virulent. Appl. Environ. Microbiol. 64, 21662172.
  • [14]
    Guard-Petter, J (1997) Induction of flagellation and a novel agar-penetrating flagellar structure in Salmonella enterica grown on solid media: possible consequences for serological identification. FEMS Microbiol. Lett. 149, 173180.
  • [15]
    Guard-Petter, J, Keller, L.H., Rahman, M.M., Carlson, R.W., Silvers, S (1996) A novel relationship between O-antigen variation, matrix formation, and invasiveness of Salmonella enteritidis. Epidemiol. Infect. 117, 219231.
  • [16]
    Parker, C.T., Liebana, E., Henzler, D.J. and Guard-Petter, J. (2001) Lipopolysaccharide O-antigen microheterogeneity of Salmonella serotypes Enteritidis and Typhimurium. Environ. Microbiol., to appear.
  • [17]
    Kutsukake, K (1997) Autogenous and global control of the flagellar master operon, flhD, in Salmonella typhimurium. Mol. Gen. Genet. 254, 440448.
  • [18]
    Davis, R.W., Botstein, D. and Roth, J.R. (1980) Advanced Bacterial Genetics: A Manual for Genetic Engineering. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • [19]
    Liebana, E., Garcia-Migura, L., Guard-Petter, J., McDowell, S., Rankin, S., Opitz, M. and Davies, R.H. (2001) Salmonella enterica sero-type Enteritidis phage types 4, 7, 6, 8, 13a, 29, and 34: A comparative analysis of genomic fingerprints from geographically distant isolates. J. Appl. Microbiol., in press.
  • [20]
    Pruss, B.M., Matsumura, P (1996) A regulator of the flagellar regulon of Escherichia coli, flhD, also affects cell division. J. Bacteriol. 178, 668674.
  • [21]
    Pruss, B.M., Markovic, D, Matsumura, P (1997) The Escherichia coli flagellar transcriptional activator flhD regulates cell division through induction of the acid response gene cadA. J. Bacteriol. 179, 38183821.
  • [22]
    Donnenberg, M.S., Kaper, J.B. (1991) Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect. Immun. 59, 43104317.
  • [23]
    Maloy, S., Stewart, V. and Taylor, R. (1996) Genetic Analysis of Pathogenic Bacteria. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • [24]
    Guard-Petter, J, Henzler, D.J., Rahman, M.M., Carlson, R.W. (1997) On-farm monitoring of mouse-invasive Salmonella enterica serovar enteritidis and a model for its association with the production of contaminated eggs. Appl. Environ. Microbiol. 63, 15881593.
  • [25]
    Kamimura, R.T., Bicciato, S, Shimizu, H, Alford, J, Stephanopoulos, G (2000) Mining of biological data I: Identifying discriminating features via mean hypothesis testing. Metab. Eng. 2, 218227.
  • [26]
    Taraviras, S.L., Ivanciuc, O, Cabrol-Bass, D (2000) Identification of groupings of graph theoretical molecular descriptors using a hybrid cluster analysis approach. J. Chem. Inf. Comput. Sci. 40, 11281146.
  • [27]
    Petter, J.G. (1993) Detection of two smooth colony phenotypes in a Salmonella enteritidis isolate which vary in their ability to contaminate eggs. Appl. Environ. Microbiol. 59, 28842890.
  • [28]
    Humphrey, T.J., Williams, A, McAlpine, K, Lever, M.S., Guard-Petter, J, Cox, J.M. (1996) Isolates of Salmonella enterica Enteritidis PT4 with enhanced heat and acid tolerance are more virulent in mice and more invasive in chickens. Epidemiol. Infect. 117, 7988.
  • [29]
    Lu, S, Manges, A.R., Xu, Y, Fang, F.C., Riley, L.W. (1999) Analysis of virulence of clinical isolates of Salmonella enteritidis in vivo and in vitro. Infect. Immun. 67, 56515657.
  • [30]
    Jorgensen, F, Leach, S, Wilde, S.J., Davies, A, Stewart, G.S., Humphrey, T (2000) Invasiveness in chickens, stress resistance and RpoS status of wild-type Salmonella enterica subsp. enterica serovar typhimurium definitive type 104 and serovar enteritidis phage type 4 strains [in process citation]. Microbiology 146, 32273235.
  • [31]
    Carsiotis, M, Weinstein, D.L., Karch, H, Holder, I.A., O'Brien, A.D. (1984) Flagella of Salmonella typhimurium are a virulence factor in infected C57BL/6J mice. Infect. Immun. 46, 814818.
  • [32]
    Yanagihara, S, Iyoda, S, Ohnishi, K, Iino, T, Kutsukake, K (1999) Structure and transcriptional control of the flagellar master operon of Salmonella typhimurium. Genes Genet. Syst. 74, 105111.
  • [33]
    Lucas, R.L., Lostroh, C.P., DiRusso, C.C., Spector, M.P., Wanner, B.L., Lee, C.A. (2000) Multiple factors independently regulate hilA and invasion gene expression in Salmonella enterica serovar typhimurium. J. Bacteriol. 182, 18721882.
  • [34]
    Kutsukake, K, Iino, T (1994) Role of the FliA-FlgM regulatory system on the transcriptional control of the flagellar regulon and flagellar formation in Salmonella typhimurium. J. Bacteriol. 176, 35983605.
  • [35]
    Groisman, E.A., Ochman, H (1993) Cognate gene clusters govern invasion of host epithelial cells by Salmonella typhimurium and Shigella flexneri. EMBO J. 12, 37793787.
  • [36]
    Claret, L, Hughes, C (2000) Rapid turnover of FlhD and FlhC, the flagellar regulon transcriptional activator proteins, during Proteus swarming. J. Bacteriol. 182, 833836.
  • [37]
    Holt, P.S., Chaubal, L.H. (1997) Detection of motility and putative synthesis of flagellar proteins in Salmonella pullorum cultures. J. Clin. Microbiol. 35, 10161020.