SEARCH

SEARCH BY CITATION

Keywords:

  • Cold stress;
  • Osmotic stress;
  • Transcriptional regulator;
  • Rubisco;
  • Nitrogen fixation;
  • Anabaena 7120;
  • ntcA;
  • rbcR;
  • rbcL/S

Abstract

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

Using differential display, we identified the Anabaena sp. PCC 7120 ribulose 1,5-bisphosphate carboxylase transcriptional regulator (rbcR1) gene, a member of the LysR family of positive transcription factors. The rbcR1 transcript and its putative target gene ribulose 1,5-bisphosphate carboxylase/oxygenase (rbcL/S) were repressed by cold (20°C) and osmotic (sucrose and salt) stress. Cold stress also induced a transient downregulation of the Anabaena 7120 ntcA transcriptional regulator. Expression of the ntcA gene, however, returned to normal levels 2 h after initiation of cold stress and increased significantly above normal levels 24 h after growth at 20°C. The early decline in the expression of the ntcA, rbcR1, and rbcL/S transcripts appears to be part of the Anabaena 7120 global adaptation response to stress. The substantial increase in the ntcA gene expression 24 h following cold stress suggests that Anabaena 7120 experiences substantial nitrogen limitation under these conditions. These data suggest that in response to stress, Anabaena 7120 decreases its metabolic activity through regulation of the CO2 fixation machinery while enhancing its nitrogen assimilation by inducing the expression of the nitrogen global transcriptional regulator, NtcA.


1Introduction

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

Water stress due to desiccation, sucrose, and salt shock is an abiotic stress encountered by all organisms. The agricultural and economical desire to expand the yield of crops has been a major driving force for understanding the effects of environmental stresses experienced by plants. Studies in plants and microbes have shown that adaptation responses to cold and osmotic stress involve similar biochemical changes. Adaptation to cold and osmotic stress adaptation in both plants and bacteria involves such changes as the modification of cell membrane constituents, alterations in metabolic pathways, and induction of homologous stress-inducible proteins [1–3]. Overall, microbial responses to water stress are characterized by quantitative and qualitative changes in transcription and translation of genes within a cell[4]. These regulatory processes enable organisms to adjust their cellular metabolism to cope with the new growth conditions.

Anabaena sp. strain PCC 7120 (Anabaena 7120) is a photosynthetic filamentous cyanobacterium that forms only vegetative cells in the presence of a source of combined nitrogen. When nitrogen is limited, approximately 10% of cells along the filaments undergo a complex set of genetic rearrangements that ultimately lead to differentiation of these cells into heterocysts [5,6]. A heterocyst is a highly specialized, terminally differentiated cell, capable of converting atmospheric N2 into ammonium ions. The reduced nitrogen is subsequently converted into glutamine and exported into neighboring cells along the filament [5,6].

Anabaena 7120 and several other cyanobacteria tolerate a variety of environmental stresses, including desiccation and osmotic stress [7,8]. Although the exact molecular mechanisms governing stress-inducible genes are not yet fully elucidated, specific physiological changes have been identified that confer osmotic tolerance in cyanobacteria[9]. These changes include, but are not limited to, (i) secretion of sodium ions[10], (ii) accumulation of potassium ions[11], and (iii) accumulation of compatible solutes such as glucosylglycerol, trehalose, sucrose[12], betaines and other osmolytes [8,9,13,14].

Our laboratory is interested in elucidating the molecular mechanisms that impart tolerance to cold stress and dehydration in Anabaena 7120. To this end, we used the differential display reverse transcriptase-polymerase chain reaction (DDRT-PCR) [15,16] to identify changes in gene expression that confer such adaptation. Using differential display, we identified the first Anabaena 7120 ribulose 1,5-bisphosphate carboxylase transcriptional regulator (rubisco, rbcR1). We show here that rbcR1 gene expression is downmodulated by cold, sucrose and salt stress. Furthermore, both cold and osmotic stresses downregulate the expression of the rbcR1 putative target gene, ribulose 1,5-bisphosphate carboxylase/oxygenase (rbcL/S). Additionally, we show for the first time that cold stress also resulted in a transient decrease in the expression of the global nitrogen transcriptional regulator, ntcA, but that after long periods of exposure to cold, its levels rose significantly. This suggests that prolonged exposures to cold temperatures limit nitrogen levels of Anabaena 7120.

2Materials and methods

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

2.1Organisms and growth conditions

Anabaena sp. PCC 7120 was grown autotrophically in BG-11 (pH 8.0)[17] either in the presence or absence of 2.5 mM ammonium (+N or −N) to an optical density (OD700) of approximately 0.8[18]. Agar stock plates were exclusively grown on Chu #10[19] medium under nitrogen-deficient conditions. Both the liquid and solid cultures were grown with 1% CO2-bubbled air under continuous illumination (5.16 W m−2) at 30°C. For rapid temperature shifts, cells grown at 30°C were transferred to 20°C by swirling in an ice-water bath equilibrated and allowed to grow at 20°C for 0–24 h as specified.

To induce osmotic stress, solid sucrose or sodium chloride was added to the cultures, mixed rapidly, and incubated for 2 h. Escherichia coli DH5α MCR (Promega, Madison, WI, USA) cells were grown under aerobic conditions in the presence of 25 mM kanamycin and 50 mM ampicillin.

2.2Primers and plasmids

Table 1 shows the sequence of the 12 primers synthesized for DDRT-PCR (Life Technologies, Grand Island, NY, USA). The first set of primers labeled as ‘ap’ were designed with 40% GC content to match the frequency of occurrence of these residues within the Anabaena 7120 genome[20]. The plasmid pGEM-T (Promega, Madison, WI, USA) was used for cloning PCR products as outlined by the manufacturer. For the isolation of the ntcA-specific probes, 5′-AGTGAACTGTCTGCTGAGAG and 3′-TAGCAAATGTTTTTCGTCA primers were synthesized. For synthesis of the rbcL/S-specific probes the 5′ and the 3′ primers were AGATACAGATATTCTGGCGG, and TTACCTACTACGGTACCGGT, respectively (Life Technologies).

Table 1.  List of 10-mer primers used for DDRT-PCR
PCR primerSequence% GC content
ap1GAACATTTTT20
ap2AGCTATTTTT20
ap3GCGAATTTTT30
ap4AATATGGAGA30
ap5GCATTATATG30
ap6GCATTGGAGA50
ap7GATTTACGAG40
ap8CCTATCAAGA40
op1GGTACTAAGG50
op10GATCAAGTCC50
op14TACAACGAGG50
op22AATCGCATTG50

2.3RNA isolation

Aliquots of 250 ml from cold-, sucrose- and salt-stressed cultures were pelleted and ground with mortar and pestle under liquid nitrogen. The powdered pellets were resuspended in 10 ml of RNA lysis buffer (100 mM Tris–HCl, pH 8.0; 100 mM LiCl; 5 mM EDTA, pH 7.6; 100 mM NaCl; 100 mM sodium acetate, pH 5.2; 1% (w/v) SDS and 250 μl β-mercaptoethanol) and vortexed for 3 min. After several phenol:chloroform extractions, the RNA was precipitated by LiCl and quantified using Genequant (Amersham Biosciences, Piscataway, NJ, USA).

2.4cDNA synthesis

Immediately after isolation, 5 μg of total RNA from control and experimental samples were subjected to reverse transcription in a GeneAmp 2400 thermocycler (PE Applied Biosystems, Boston, MA, USA). The cDNA reactions were carried out for 2 h at 37°C in 100-μl volumes containing 5 mM MgCl2, 1×PCR buffer, 1 mM of each dNTP, 2.5 units of RNase inhibitor, 5.0 μM random hexamers, and 2.5 units of MuLV reverse transcriptase (PE Applied Biosystems). The reactions were terminated by heating the tubes to 95°C for 5 min followed by treatment with DNase-free RNase (Life Technologies) to remove the RNA template. The newly synthesized cDNA was routinely run on a 1.5% agarose gel to ensure the quality of the reaction. All reactions were carried out in duplicate.

2.5DDRT-PCR, cloning and sequencing

Following cDNA synthesis, 20-μl aliquots were transferred to PCR tubes with 2 mM MgCl2, 1×PCR buffer, 50 pmol of each of the two 10-mers, and 2.5 units of Amplitaq DNA polymerase (PE Applied Biosystems). The cDNA was amplified using an initial denaturation step of 95°C for 2 min followed by 45 cycles denaturation at 95°C for 30 s, 38°C for 2 min, and 72°C for 30 s. A final extension of 72°C for 7 min was implemented to ensure the full extension of partially amplified PCR fragments. The resulting products were run on a 2% TAE-agarose gel, and the differentially expressed fragments were excised from the gel and purified using the Qiagen gel extraction kit (Qiagen, Valencia, CA, USA). The excised fragments were then cloned by TA-cloning strategy into the pGEM-T (Promega) vector as outlined by the manufacturer. The amplified products were sequenced using the T7 and Sp6 promoters by a LICOR (LICOR, Lincoln, NE, USA) automated DNA sequencing machine. The sequence information was analyzed by DNAlysis software for identification of open reading frames.

2.6Preparation of ntcA and rbcL/S gene probes

The ntcA- and rbcL/S-specific probes were synthesized using genomic PCR by gene-specific primers. PCR amplification of ntcA and rbcL/S fragments was carried out in a 100-μl volume containing 2 mM MgCl2, 1×PCR buffer, 25 pmol of each primer and 2.5 units of Taq DNA polymerase Gold™ (PE Applied Biosystems). The amplification conditions consisted of an initial denaturation step of 95°C for 2 min followed by 25 cycles of 95°C (denaturation) for 30 s, 45°C (annealing) for 60 s and 72°C (extension) for 30 s.

The PCR fragments were cloned into the pGEM-T vector (Promega) using the TA cloning strategy as outlined by Promega and the sequences were confirmed by a LICOR automated DNA sequencer.

2.7Nonradioactive labeling of rbcR1, ntcA, and rbcL/S fragments

The rbcR1 probe was generated by restriction digestion of the pGEM-T-rbcR1 plasmid with Eco RI and subsequent labeling with digoxigenin (DIG; Roche, Indianapolis, IN, USA) as described by the manufacturer. The ntcA- and rbcL/S-specific probes were generated by in vitro transcription of the plasmids using the RNA synthesis STRIP-EZ kit (Ambion, Austin, TX, USA) and labeling with psoralen/biotin (Ambion) as described by the manufacturer.

2.8Anabaena genomic DNA isolation and low stringency Southern blot analysis

Genomic DNA was isolated from optimally grown (OD700= 0.8) Anabaena cultures by lysozyme, proteinase K, phenol extraction, and CsCl density gradient centrifugation[20]. Plasmid DNA containing rbcR1 genes was isolated by the CsCl density gradient technique. In Southern blot analysis, 3 μg of Anabaena 7120 genomic DNA was digested with Hin cII and Hin dIII, electrophoresed on a 1.2% agarose gel, and transferred to nylon membrane (Roche) followed by low stringency hybridization reactions in 50% formamide at 42°C for 16 h. The probes used for detection were DIG-labeled (Roche) according to the manufacturer's protocol and exposed on autoradiographic film (Kodak, Rochester, NY, USA).

2.9Northern blot hybridizations

In Northern blot analysis, 5 μg of total RNA was loaded onto 1.2% denaturing 2%-formaldehyde agarose gels and transferred onto positively charged nylon membranes. Prehybridization and hybridization reactions were performed overnight in 50% formamide hybridization buffer (Roche) at 42°C for rbcR1 and 65°C for ntcA and rbcL/S.

3Results

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

3.1Rationale for primer design

The ap primers were designed based on the rho-independent (intrinsic) termination characteristic of prokaryotic transcriptional regulation[20]. This mode of termination involves destabilization of the RNA:DNA hetero-duplex by the presence of a distal 3′-hairpin followed by a run of 6–8 U-rich sequences in the nascent RNA[20]. With this in mind, primers ap1, ap2, and ap3 were designed with four thymidine residues at the 3′ end (Table 1). Additionally, ap4, ap6, ap7, and ap8 were synthesized to include G- and A-rich residues to take advantage of the ribosome-binding sequences (GAGGA) commonly found at the 5′ region of the prokaryotic mRNA species[21]. The different combinations of A and G sequences were designed due to the heterogeneity in sequences at this location. The op primers were identical to the original differential display described by Liang and Pardee[15].

3.2Identification of Anabaena 7120 rbcR1 by DDRT-PCR

To identify novel genes involved in adaptation to cold stress, RNA was isolated from ammonium-supplemented (+N) control and 2-h cold-shocked (20°C) Anabaena 7120 cultures and subjected to DDRT-PCR. As shown in Fig. 1, the primer sets op10/op14 and ap6/ap7 identified two differentially expressed gene fragments of approximately 360 and 600 bp respectively. The 360-bp fragment disappeared upon cold treatment, whereas the 600-bp fragment appeared to be upregulated following transfer to cold stress. The initial attempts to clone the 600-bp fragment failed, but the 360-bp fragment was successfully cloned and sequenced (GenBank accession No. AF199483). Blast-n[22] and Clustal-W multiple sequence alignment analysis (http://pbil.ibcp.fr/NPSA/npsa_clustalw.html) of the 360-bp sequence revealed 66% identity (77% homology) to rbcR1 and rbcR2 of Synechocystis 6803 and 64% identity (79% homology) to rbcR1 of Synechococcus 7002, all belonging to the LysR family of transcriptional regulators.

image

Figure 1. Identification and sequence of the Anabaena 7120 cold-regulated rubisco transcriptional regulator-1 (rbcR1). A: Lanes 1 and 2 and 5 and 6 are cDNA amplified from duplicate samples of control cultures grown under normal conditions (30°C). Lanes 3 and 4 and 7 and 8 are amplified cDNA samples from 2-h cold-shocked cultures (20°C). Lanes 1–4 were amplified by 10-mer primers ap6 and ap7. Lanes 5–8 were amplified by 10-mer primers op10 and op14. White arrows indicate the differentially expressed bands. Lane M is a λHin dIII DNA ladder. B: Nucleotide and the deduced amino acid sequence of the 360-bp differentially expressed gene identified by primers op10/14 (accession No. AF199483).

Download figure to PowerPoint

3.3Anabaena 7120 encodes two homologous rubisco transcriptional regulators

Genomic Southern blot analyses were performed to determine whether other rbcR homologs exist in Anabaena 7120. Genomic DNA was digested with either Hin cII or Hin dIII restriction enzymes, and the products were hybridized under low stringency conditions with the DIG-labeled 360-bp fragment. The Hin cII lane identified a strongly hybridizing band migrating around 6.0 kb and a lower intensity band of approximately 4.8 kb (Fig. 2). The Hin dIII lane identified a strongly hybridizing band of 4.0 kb and a larger band of lower intensity migrating at 5.0 kb. These data suggest that similar to Synechocystis 6803, Anabaena possesses two homologous transcriptional regulators that were thus termed rbcR1 and rbcR2.

image

Figure 2. Low stringency rbcR Southern blot analysis of Anabaena genome. The Anabaena 7120 genomic DNA was digested with Hin cII and Hin dIII and screened with DIG-labeled rbcR1 fragment at 42°C. The arrows on the right show the sizes of rbcR1-hybridized genomic DNA fragments.

Download figure to PowerPoint

3.4Cold, osmotic and salt stress causes a decline in rbcR1 transcript levels

The DDRT-PCR technique is notorious for the frequency of false positive results, and confirmatory Northern blot analysis is required to ensure differential gene expression. The rbcR1-specific probe identified an approximately 950-bp long transcript whose expression was downregulated in nitrogen-supplemented (control +N) Anabaena cultures after cold stress (Fig. 3A). Remarkably, the expression of rbcR1 was significantly lower in the control cultures grown under nitrogen-fixing conditions (control −N) than in those with ammonium (control +N), suggesting a regulatory mechanism depended on the nitrogen status of the cell (Fig. 3A).

image

Figure 3. Transcriptional analysis of the rbcR1 and ntcA genes of Anabaena 7120. A: The rbcR1 Northern blot analysis of Anabaena 7120 cells grown under either ammonium (NH4+) supplemented or ammonium-free (NH4+-free) conditions. The cells were treated for 2 h in either cold stress (20°C), sucrose stress (250 mM) or salt stress (60 mM). B: Time point analysis of ntcA transcripts following transfer to cold (20°) conditions. The sizes of the transcripts are shown on the right in both A and B. The lower panel in both depicts the ethidium bromide-stained RNA gels in both blots for load control.

Download figure to PowerPoint

To determine whether repression of the rbcR1 gene is specific to cold shock or whether other abiotic stresses, such as osmotic shock, can downregulate rbcR1 expression, RNA was isolated from sucrose and salt stressed cultures and examined for rbcR1 transcript levels. Both sucrose (250 mM), and salt stress (60 mM) have been previously shown in our laboratory to induce dehydration in Anabaena 7120[7]. Indeed, as with cold stress, there was no detectable expression of rbcR1 under either sucrose or salt stress, suggesting similar mechanisms.

3.5Cold stress affects ntcA transcript levels

To determine whether the temperature-dependent downregulation of rbcR1 is a specific response in cold adaptation, we examined the expression of ntcA under similar conditions. The transcriptional regulator ntcA is required for multiple metabolic functions within the cell [23–25]. The NtcA protein is an Anabaena transcriptional regulator belonging to the cAMP class of receptor proteins, required for nitrate utilization, nitrogen assimilation, and heterocyst differentiation [25,27]. Genetic evidence has shown that the NtcA protein is capable of interacting with xisA, glnA, rbcL, and nifH promoter regions in vitro[29].

An Anabaena ntcA-specific probe identified low levels of constitutively expressed ntcA transcripts, which commonly appear as smear between 0.8 and 1.1 kb in steady-state cultures[27]. When cells were transferred to 20°C, the levels of both differentially spliced ntcA transcripts decreased rapidly (Fig. 3B). Within 45 min of transfer to 20°C, little or no ntcA transcripts could be detected. This decline was transient, with expression levels returning to normal at 2 h post cold stress. After 24 h of growth at 20°C, however, the ntcA transcript levels increased dramatically, suggesting increased expression of the message in periods of prolonged exposure to cold shock (Fig. 3B).

3.6rbcL/S transcript declines in response to cold and osmotic stress

Because the levels of rbcR1 gene expression declined in response to stress, we hypothesized that a similar concomitant decline in the transcript level of its target gene, rbcL/S, would also be observed. Furthermore, since the NtcA protein can regulate the expression of rbcL/S gene[28], we rationalized that the over-expression of the ntcA message and the inhibition of rbcL/S gene coincide. The rbcL/S gene expression is detected as three transcripts of 3.1 kb, 2.7 kb, and 2.2 kb, which arise from in vivo post-transcriptional processing[28]. Despite the downregulation of rbcR1 transcript levels in the first 2 h of cold stress, we did not observe any decline in the transcript levels of its putative target, rbcL/S, until 24 h after the transfer to 20°C (Fig. 4). The absence of any detectable rbcL/S message, and the significant expression of the ntcA gene at 24 h following cold stress, suggest that ntcA may negatively regulate the expression of the rbcL/S as described by others[29]. In addition to cold stress, osmotic (sucrose and salt) stress downregulated the rbcL/S gene expression, suggesting that cold and osmotic stress may slow down the metabolic activity of Anabaena by slowing down CO2 fixation (Fig. 4).

image

Figure 4. Transcriptional analysis of the rubisco 1,5-bisphosphate carboxylase gene (rbcL/S). The rbcL/S Northern blot analysis of Anabaena 7120 cells grown under nitrogen-free conditions at 2 h or 24 h following cold or osmotic stress. The sizes of the transcripts are shown on the right. The lower panel depicts the ethidium bromide-stained RNA for load control.

Download figure to PowerPoint

4Discussion

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

This study reports the identification of the Anabaena 7120 rubisco transcriptional regulator-1 (rbcR1) and is involved in the adaptation of these microorganisms to cold and osmotic stress. In addition, our work provides the first evidence linking the gene expression of the essential global nitrogen regulator ntcA, in adaptation to cold stress. Sequence comparisons with other cyanobacterial transcriptional regulators show that the Anabaena 7120 rbcR1 displays the greatest homology to rbcR1 of Synechococcus 7002 and rbcR1 of Synechocystis 6803. All three belong to the LysR family of positive transcriptional regulators characterized by a DNA binding helix-turn-helix motif in its amino-terminus. LysR proteins are required for transcription of a number of genes and are capable of functioning as negative autoregulators [30,31]. The degree of homology to other rubisco transcriptional regulators suggests that Anabaena rbcR1 has a regulatory role in the expression of CO2 fixation genes[32]. The cloned 360-bp fragment rbcR1 encodes a 120 amino acid long open reading frame with homology to the coinducer region and C-terminal end of this class of proteins[33].

Our results demonstrate that rbcR1 transcript levels are downregulated in response to cold and osmotic stress. It is not clear, however, whether this is due to transcriptional repression or decreased stability of rbcR1 mRNA (Fig. 2A). Additionally, Northern analysis revealed that the rbcR1 message is significantly less abundant when the cells are grown under nitrogen-fixing conditions (Fig. 2A). Our data suggest that the negative regulation of rbcR1 results in a slowdown of the metabolic activity of Anabaena by decreasing the transcription of enzymes necessary for carbon fixation.

Cold stress appeared also to initially negatively regulate the expression of the Anabaena 7120 transcriptional regulator ntcA. Unlike rbcR1, however, the ntcA gene expression increased significantly during prolonged exposure to cold (24 h). It is unlikely that the increased expression of ntcA gene is due to the increased half-life of the transcript since earlier time points showed transcript levels similar to those in control cultures (Fig. 3B). These results suggest that the ntcA gene product may drive the expression of the global nitrogen control machinery by transcribing genes involved in nitrogen assimilation. Although the benefits of the accumulation of nitrogenous compounds during osmotic and salt stress are well documented [8–14], the significance of accumulation of similar compounds in response to cold stress is unknown.

We had hypothesized that a decline in rbcR1 would result in the concomitant decline in the transcript levels of its putative target gene rbcL/S. Our studies showed no correlation between the rbcR1 levels and rbcL/S transcription under cold stress (Fig. 4). It must be noted, however, that since there appear to be two rbcR-related genes present in Anabaena 7120 (Fig. 2), the rbcL/S expression may better correlate with rbcR2 levels. Furthermore, the NtcA protein has also been shown to positively regulate the expression of several nitrogen fixation genes [25–27]. Work in other laboratories has shown that the NtcA protein is capable of positively and negatively regulating rbcL/S gene[29]. Our results show that at peak expression level of ntcA gene (i.e. 24 h after transfer to 20°C), the rbcL/S gene expression was minimal, providing support to its role as the negative regulator of the rbcL/S gene. Additional work is needed to determine whether the induction of the nitrogen fixation machinery through the NtcA protein plays an essential for the adaptation of Anabaena 7120 to cold stress.

In conclusion, our results provide evidence that Anabaena 7120 has evolved similar mechanisms in adaptation to a variety of environmental stresses. This suggests the presence of specific genes and pathways essential for adaptation to stress. Further work is needed to identify the targets of RbcR1 and NtcA proteins during responses to cold and osmotic stress.

Acknowledgements

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

This work is dedicated to the memory of Mr. Moussa Hafizi (Baveh) and Amoo Hosseinkhoon Hafizi whose kindness made this study possible. We would also like to thank Dr. James Golden for his help with the manuscript. Financial support for this work was provided by the Program in Molecular Biology at New Mexico State University and the National Institutes of Health Grants GM07667 and GM08136.

References

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References
  • [1]
    Hare, P.D., Crees, W.A., van Staden, J. (1998) Dissecting the roles of osmolyte accumulation during stress. Plant Cell Environ. 21, 535553.
  • [2]
    Schwartz, S.H., Black, T.A., Karin, J., Panoff, J.-M., Wolk, P.C. (1998) Regulation of an osmoticum-responsive gene in Anabaena sp. PCC 7120. J. Bacteriol. 180, 63326337.
  • [3]
    Kiyosue, T., Abe, H., Yamaguchi-Shinozaki, K., Shinozaki, K. (1998) ERD6, a cDNA clone for an early dehydration-induced gene of Arabidopsis encodes a putative sugar transporter. Biochim. Biophys. Acta 1370, 187191.
  • [4]
    Csonka, L.N. and Epstein, W. (1996) Osmoregulation. In: Escherichia coli and Salmonella: cellular and molecular biology, 2nd edn. (Niedhardt, F.C., Curtiss, R. III, Ingraham, J.L., Lin, E.C.C., Low, K.B., Magasanik, B., Rezinkoff, W.S., Riley, M., Schaechter, M. and Umbragereds, H.E., Eds.), pp. 1210–1223. ASM Press, Washington, DC.
  • [5]
    Golden, J.W., Robinson, S.J., Haselkorn, R. (1985) Rearrangement of nitrogen fixation genes during heterocyst differentiation in cyanobacterium Anabaena. Nature 314, 419423.
  • [6]
    Haselkorn, R. (1978) The heterocyst. Annu. Rev. Plant Physiol. 29, 319344.
  • [7]
    Close, T.J., Lammers, P.L. (1993) An osmotic stress protein of cyanobacteria is immunologically related to plant dehydrins. Plant Physiol. 101, 773779.
  • [8]
    Poolman, B., Glaasker, E. (1998) Regulation of compatible solute accumulation in bacteria. Mol. Microbiol. 29, 397407.
  • [9]
    de Marsac, N.T., Houmard, J. (1993) Adaptation of cyanobacteria to environmental stimuli: new steps towards molecular mechanisms. FEMS Microbiol. Rev. 104, 119190.
  • [10]
    Apte, S.K., Reddy, B.R., Thomas, J. (1987) Relationship between sodium influx and salt tolerance of nitrogen-fixing bacteria. Appl. Environ. Microbiol. 53, 19341939.
  • [11]
    Reed, R.H., Stewart, W.P.D. (1985) Evidence for turgor sensitive K+ influx in Anabaena variabilis ATC 29413 and Synechocystis PCC 6714. Biochim. Biophys. Acta 812, 155162.
  • [12]
    Mikkat, S., Effmert, U., Hagemann, M. (1997) Uptake and use of the osmoprotective compounds trehalose, glucosylglycerol and sucrose by the cyanobacterium Synechocystis sp. PCC 6803. Arch. Microbiol. 167, 112118.
  • [13]
    Joset, F., Jeanjean, R., Hagemann, M. (1996) Dynamics of the response of cyanobacteria to salt stress: Deciphering the molecular events. Physiol. Plant. 96, 738744.
  • [14]
    Potts, M. (1994) Desiccation tolerance of prokaryotes. Microbiol. Rev. 58, 755805.
  • [15]
    Liang, P., Pardee, A.B. (1992) Differential display of eukaryotic mRNA by means of the polymerase chain reaction. Science 257, 967971.
  • [16]
    Liang, P., Averboukh, L., Pardee, A.B. (1993) Distribution and cloning of eukaryotic mRNAs by means of differential display: refinements and optimization. Nucleic Acids Res. 21, 32693275.
  • [17]
    Rippka, R.J., Deruelles, J., Waterbury, B., Herdman, M., Stanier, R.Y. (1979) Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J. Gen. Microbiol. 111, 161.
  • [18]
    Lammers, P.J., Sanders-Loehr, J. (1982) Active transport of ferric schizokinen in Anabaena sp.. J. Bacteriol. 151, 288294.
  • [19]
    Wilmotte, A. (1994) Molecular evolution and taxonomy of cyanobacteria. In: The Molecular Biology of Cyanobacteria (Bryant, D.A., Ed.), pp. 1–25. Kluwer Academic Publishers, Dordrecht.
  • [20]
    Wilson, K.S., von Hippel, P.H. (1995) Transcription termination at intrinsic terminators: The role of RNA hairpin. Proc. Natl. Acad. Sci. USA 92, 87938797.
  • [21]
    Bohannon, D.E., Sonenshein, A.L. (1989) Positive regulation of glutamate biosynthesis in Bacillus subtilis. J. Bacteriol. 171, 47184727.
  • [22]
    Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D. (1997) Gapped BLAST and PSI-BLAST: New generation of protein database search programs. Nucleic Acids Res. 25, 33893402.
  • [23]
    Bradley, R.L., Reddy, K.J. (1997) Cloning, sequencing and regulation of the global regulator ntcA in the unicellular diazotrophic cyanobacterium Cyanothece sp. strain BH68K. J. Bacteriol. 179, 44074410.
  • [24]
    Tai-Fen, W., Ramasubramanina, T.S., Golden, J. (1994) Anabaena sp. strain 7120 ntcA gene required for growth on nitrate and heterocyst development. J. Bacteriol. 176, 44734482.
  • [25]
    Ramasubramanian, T.S., Tai-Fen, W., Golden, J. (1994) Two Anabaena sp. strain PCC 7120 DNA-binding factors interact with vegetative and heterocyst-specific genes. J. Bacteriol. 176, 12141223.
  • [26]
    Luque, I., Flores, E., Herrero, A. (1994) Molecular mechanism for the operation of nitrogen control in cyanobacteria. EMBO J. 13, 28622869.
  • [27]
    Ramasubramanian, T.S., Tai-Fen, W., Oldham, A.K., Golden, J. (1996) Transcription of Anabaena sp. strain 7120 ntcA gene multiple transcripts and NtcA binding. J. Bacteriol. 178, 922925.
  • [28]
    [28] Tabita, F.R. (1994) The Biochemistry and molecular regulation of carbon dioxide metabolism in cyanobacteria. In: The Molecular Biology of Cyanobacteria (Bryant, D.A., Ed.), pp. 437–462. Kluwer Academic Publishers, Dordrecht.
  • [29]
    Jiang, F., Mannervik, B., Bergman, B. (1997) Evidence for redox regulation of the transcription factor NtcA, acting both as an activator and a repressor, in the cyanobacterium Anabaena PCC 7120. Biochem. J. 327, 513517.
  • [30]
    Parsek, M.R., Te, R.W., Pattle, P., Chakrabarty, A.M. (1994) Critical nucleotides of a LysR-type regulator with its target promoter region. J. Biol. Chem. 269, 1127911284.
  • [31]
    Rahav-Manor, O., Carmel, O., Karpel, R., Taglicht, G., Glaser, D., Schulinder, S., Padan, E. (1992) NhaR, a protein homologous to a family of bacterial regulatory proteins (LysR) regulates the sodium proton antiporter gene in Escherichia coli. J. Biol. Chem. 267, 1043310438.
  • [32]
    Viale, A.M., Hirokazu, K., Takahashi, A., Heinkoff, S. (1991) rbcR a gene coding for a member of the LysR family of transcriptional regulators is located upstream of the expressed set of ribulose 1,5-bisphosphate carboxylase/oxygenase genes in the photosynthetic bacterium Chromatium vinosum. J. Bacteriol. 173, 52245229.
  • [33]
    Schell, M.A. (1993) Molecular biology of the LysR family of transcriptional regulators. Annu. Rev. Microbiol. 47, 597626.