SEARCH

SEARCH BY CITATION

Keywords:

  • Polyhydroxyalkanoate;
  • β-Oxidation pathway;
  • 3-Ketoacyl-acyl carrier protein reductase;
  • Escherichia coli FabG;
  • Pseudomonas aeruginosa RhlG;
  • Escherichia coli

Abstract

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

The Escherichia coli fabGEc gene and the Pseudomonas aeruginosa rhlGPa gene, which encode 3-ketoacyl-acyl carrier protein reductase, were expressed in E. coli W3110 and its fadA mutant strain WA101 to examine their roles in medium-chain-length (MCL) polyhydroxyalkanoate (PHA) biosynthesis from fatty acids. When one of these 3-ketoacyl-acyl carrier protein reductase genes was co-expressed with the Pseudomonas sp. 61–3 PHA synthase gene (phaC2Ps) in E. coli W3110, MCL-PHA composed mainly of 3-hydroxyoctanoate and 3-hydroxydecanoate was synthesized from sodium decanoate. When the fabGEc gene and the phaC2Ps gene were co-expressed in the fadA mutant E. coli strain WA101, MCL-PHA rich in 3-hydroxydecanoate monomer up to 93 mol% was accumulated from sodium decanoate. This was possible by efficiently redirecting 3-ketoacyl-coenzymes A from the β-oxidation pathway to the PHA biosynthesis pathway without losing two carbon units, the strategy of which can be extended for the production of MCL-PHAs rich in other specific monomers.


1Introduction

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

Numerous bacteria accumulate polyhydroxyalkanoates (PHAs) within cells as carbon and energy reserve material under nutrient-limited conditions in the presence of excess carbon source[1]. (R)-Hydroxyacyl-coenzymes A (CoAs), the substrates of PHA synthase, can be derived from the intermediates of various metabolic pathways such as fatty acid biosynthesis and β-oxidation pathways [2–5]. The major precursors of PHAs include enoyl-CoA, 3-ketoacyl-CoA, (S)-3-hydroxyacyl-CoA and 3-hydroxyacyl-acyl carrier protein (ACP). These intermediates are converted to (R)-3-hydroxyacyl-CoAs by various enzymes such as enoyl-CoA hydratase, 3-ketoacyl-CoA reductase, epimerase and 3-hydroxyacyl-ACP:CoA transferase [2–6].

Recently, the medium-chain-length (MCL) PHA biosynthesis pathway was established in Escherichia coli by transferring the Pseudomonas aeruginosa PHA synthase gene into an E. coli strain defective in β-oxidation pathway [3–5]. Following these works, the engineered MCL-PHA biosynthesis pathways have been developed mainly by manipulation of the β-oxidation pathway [2–4].

Among the intermediates of the β-oxidation pathway, 3-ketoacyl-CoA has been suggested as a possible precursor of PHA. It is converted to (R)-3-hydroxyacyl-CoA by 3-ketoacyl-CoA reductase. Screening of 3-ketoacyl-CoA reductase was based on the amino acid homology to the Ralstonia eutropha acetoacetyl-CoA reductase (PhaB), which is highly specific to short-chain-length 3-ketoacyl-CoAs[7]. The homology search allowed the identification of the fabG gene encoding 3-ketoacyl-ACP reductase (FabG) [5,6]. The co-expression of the fabG gene cloned from E. coli or P. aeruginosa along with the MCL-PHA synthase gene successfully established the MCL-PHA biosynthesis pathway in E. coli, suggesting that 3-ketoacyl-ACP reductase possesses the 3-ketoacyl-CoA reductase activity [5,6]. There has also been a recent report on the identification of a NADPH-dependent 3-ketoacyl-ACP reductase encoded by the P. aeruginosa rhlG gene, which is specifically involved in rhamnolipid synthesis[8].

In this study, we examined the roles of 3-ketoacyl-ACP reductase in MCL-PHA biosynthesis. Two different 3-ketoacyl-ACP reductases, the E. coli FabG and the P. aeruginosa RhlG, were examined for their abilities to supply MCL-PHA precursors from the β-oxidation pathway. A metabolic route for the production of MCL-PHAs rich in specific monomer was established by co-expression of the 3-ketoacyl-ACP reductase gene along with the MCL-PHA synthase gene in a fadA mutant E. coli strain.

2Materials and methods

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

2.1Bacterial strains

The strains used in this study are listed in Table 1. E. coli XL1-Blue was used as a host for vector construction. E. coli W3110 and WA101 were used for PHA production. E. coli WA101 (W3110 fadA::Km), a derivative of E. coli W3110, was constructed by the insertion of kanamycin-resistant gene obtained from pACYC177 (New England Biolabs, Beverly, MA, USA) into the middle of the fadA gene in the E. coli chromosome using pKO3[9], which is designed for the precise deletion or insertion of specific genes in the genome of E. coli. The insertional mutation of the fadA gene was confirmed by polymerase chain reaction (PCR) as suggested by Link et al.[9].

Table 1.  Bacterial strains and plasmids used in this study
  1. aStratagene Cloning System, La Jolla, CA, USA.

  2. bKorean Collection for Type Cultures, Daejeon, South Korea.

  3. cPharmacia Biotech, Uppsala, Sweden.

Strain or plasmidRelevant characteristicsRef. or source
Strains
E. coli
XL1-BluerecA1, endA1, gyrA96, thi, hsdR17, suppE44, relA1, l, lac, F′[proAB laclq lacZΔM15, Tn10 (tet)r]Stratagenea
W3110FmcrA mcrB IN(rrnDrrnE)Lab stock
WA101W3110 (fadA::Km)This study
P. aeruginosa PAO1Wild-type strainKCTCb
Plasmids
pTrc99AApr; trc promoter; protein expression vectorPharmaciac
pBluescript SK(−)Apr; lacZ; cloning vehicleStratagene
pBBR1MCSCmr; cloning vehicle[14]
pBSEB50pBluescript II KS(+) derivative; Pseudomonas sp. 61–3 PHA biosynthesis genes (phaC1Ps, phaZPs, phaC2Ps)[12]
p10499ApTrc99A derivative; gntT104 promoterThis study
p10499613C2p10499A derivative; phaC2PsThis study
pBlue104FabGpBluescript SK(−) derivative; gntT104 promoter, E. coli fabGEc geneThis study
pBlue104RhlGpBluescript SK(−) derivative; gntT104 promoter, P. aeruginosa rhlGPa geneThis study
pMCS104FabGpBBR1MCS derivative; gntT104 promoter, E. coli fabGEc geneThis study
pMCS104RhlGpBBR1MCS derivative; gntT104 promoter, P. aeruginosa rhlGPa geneThis study

2.2Plasmid construction

Plasmids used in this study are also listed in Table 1. All DNA manipulations including restriction digestion, ligation, and agarose gel electrophoresis were carried out by standard procedures. All the gene fragments used in the study were obtained by PCR using the primers listed in Table 2. All the primers were designed based on previously reported sequence data [10–12]. PCR was performed by the PCR Thermal Cycler MP (Takara Shuzo Co., Ltd., Shiga, Japan) using the Expand™ High Fidelity PCR System (Roche Molecular Biochemicals, Mannheim, Germany). DNA sequencing was carried out with the Bigdye terminator cycle sequencing kit (Perkin-Elmer Co., Boston, MA, USA) and Taq polymerase using an ABI Prism™ 377 DNA sequencer (Perkin-Elmer Co.). The gntT104 promoter, which can transcribe specific genes constitutively due to the substitutional mutation in the internal operator of gntT promoter, was used for gene expression[13]. The PCR product of gntT104 promoter and an E. coli ribosomal binding site, digested with Eco RV and Eco RI, was cloned into pTrc99A (Pharmacia Biotech, Uppsala, Sweden) at the same sites to construct p10499A. Plasmid p10499613C2 was constructed by the insertion of the Pseudomonas sp. 61–3 phaC2Ps gene into the p10499A at Eco RI and Hin dIII sites. The phaC2Ps gene was amplified from pBSEB50 containing the Pseudomonas sp. 61–3 PHA biosynthesis genes[12]. The expression vectors of the E. coli fabGEc gene and the P. aeruginosa rhlGPa gene were constructed by the insertion of gntT104 promoter at the Spe I and Bam HI sites of pBluescript SK(−) (Stratagene, La Jolla, CA, USA) followed by the insertion of the fabGEc gene and the rhlGPa gene, respectively, into the Bam HI and Hin dIII sites. The gene fragment containing the gntT104 promoter and the fabGEc gene or the rhlGPa gene were obtained by Xba I and Hin dIII digestion, and then were inserted into Xba I and Hin dIII digested pBBR1MCS[14] to make pMCS104FabG and pMCS104RhlG, respectively.

Table 2.  List of primers used in PCR reactionsa
  1. aRestriction enzyme sites are shown in bold.

  2. bThese primers were used for the amplification of gntT104 promoter for the construction of p10499A.

  3. cThese primers were used for the amplification of gntT104 promoter for the construction of pBlue104FabG and pBlue104RhlG.

  4. dA transcription termination signal was designed from that of the R. eutropha PHA biosynthesis operon[9].

PrimerPrimer sequenceTarget geneTemplate used
Primer 15-GGAATTCATGAGAGAGAAACCAACGCCGphaC2PspBSEB50
Primer 25-CCCAAGCTTTCAGCGCACGCGCACGTAGGT  
Primer 35-GCTCTAGATTACGCGGCTTCAACTTTCCG  
Primer 45-CCGTTGATATCTGAAAGGTGTGCGCGATCTCACgntT104 promoterbE. coli W3110 chromosome
Primer 55-GGAATTCTATCTCCTTATTCATTTGTTATGGGCGACGTCAATTT  
Primer 65-GACTAGTTGAAAGGTGTGCGCGATCTCACgntT104 promotercE. coli W3110 chromosome
Primer 75-CGGGATCCTATCTCCTTATTCATTTGTTATGGGCGACGTCAATTT  
Primer 85-CGGGATCCAATAAGGAGATATTTAGATGAATTTTGAAGGAAA AATCfabGEcdE. coli W3110 chromosome
Primer 95-CCCAAGCTTGCCGGCTGCCGACTGGTTGAACCAGGCCGGCAGGTCAGACCATGTACATCCCGCC  
Primer 105-CGGGATCCAATAAGGAGATATTTAGATGCATCCCTATTTCAGTATCrhlGPadP. aeruginosa chromosome
Primer 115-CCCAAGCTTGCCGGCTGCCGACTGGTTGAACCAGGCCGGCAGGTTAGAGATGAAAACCGCCGTCGAT  

2.3Culture conditions

E. coli XL1-Blue was cultured at 37°C in Luria–Bertani (LB) medium (containing per liter: 10 g tryptone, 5 g yeast extract and 5 g NaCl). P. aeruginosa was cultured at 30°C in LB medium. For MCL-PHA production, recombinant E. coli strains were cultivated for 72 h in LB medium containing 10 g l−1 of sodium decanoate (Sigma Co., St. Louis, MO, USA). Flask cultures were carried out in a rotary shaker at 250 rpm and 30°C. Ampicillin (Ap, 50 mg l−1) and/or chloramphenicol (Cm, 34 mg l−1) were added to the medium depending on the plasmids used.

2.4Analysis of PHA concentration and PHA content

Cell growth was monitored by measuring the absorbance at 600 nm (OD600; DU Series 600 Spectrophotometer, Beckman, Fullerton, CA, USA). PHA concentration and monomer composition were determined by gas chromatography (Donam Co., Seoul, South Korea) equipped with a fused silica capillary column (Supelco SPB™-5, 30 m×0.32 mm ID 0.25 μm film, Bellefonte, PA, USA) using benzoic acid as an internal standard. Cell concentration was defined as dry cell weight per liter of culture broth. The residual cell concentration was defined as the cell concentration minus PHA concentration. The PHA content (wt%) was defined as the percentage of the ratio of PHA concentration to cell concentration.

2.5Analysis of protein expression and activities

Expression of PHA synthase and 3-ketoacyl-ACP reductase genes was analyzed by electrophoresis on a 12% (w/v) sodium dodecyl sulfate–polyacrylamide gel (SDS–PAGE). The activity of 3-ketoacyl-ACP reductase was measured by determining the rate of oxidation of NADPH at the absorbance of 340 nm (DU Series 600 Spectrophotometer) following the protocol developed for the NADPH-dependent acetoacetyl-CoA reductase[7]. Acetoacetyl-CoA and NADPH were purchased from Sigma (St. Louis, MO, USA). Crude extracts of recombinant E. coli strains were prepared by three cycles of sonication (each for 20 s at 15% of maximum output; high-intensity ultrasonic liquid processors; Sonics and Material Inc., Newtown, CT, USA). The amount of soluble proteins was determined by the Bio-Rad protein assay kit (Bio-Rad, Hercules, CA, USA) with bovine serum albumin as a standard.

3Results

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

3.1Production of MCL-PHA in normal E. coli strain harboring the MCL-PHA synthase gene and the 3-ketoacyl-ACP reductase gene

In order to examine whether PHA precursors can be derived from the β-oxidation pathway by the introduction of the fabGEc or the rhlGPa gene, two different recombinant E. coli W3110 strains were constructed: one strain harboring p10499613C2 and pMCS104FabG and the other harboring p10499613C2 and pMCS104RhlG. Two recombinant E. coli strains were cultured in LB medium containing 2 g l−1 of sodium decanoate at 30°C. Functional expressions of PHA synthase and 3-ketoacyl-ACP reductases were confirmed by SDS–PAGE and analyses of acetoacetyl-CoA reductase activities in recombinant E. coli strains (Fig. 1; Table 3). The results of flask cultures are summarized in Table 4. Both FabGEc and RhlGPa were able to supply (R)-3-hydroxyacyl-CoA from the β-oxidation pathway even though the efficiency seems to be low as observed by low PHA contents. The monomer compositions of MCL-PHAs were different by employing the fabGEc and the rhlGPa genes. When the fabGEc gene was employed, MCL-PHA consisting of 3-hydroxyhexanoate (3HHx), 3-hydroxyoctanoate (3HO) and 3-hydroxydecanoate (3HD) was produced. Introduction of the rhlGPa gene resulted in the production of MCL-PHA consisting only of 3HO and 3HD.

image

Figure 1. SDS–PAGE analysis of PHA synthase and 3-ketoacyl-ACP reductases in recombinant E. coli strains. Lanes: M, molecular mass standard; 1, total proteins from E. coli W3110 harboring no plasmid; 2, total proteins from E. coli W3110 (p10499613C2+pMCS104FabG); 3, total proteins from E. coli W3110 (p10499613C2+pMCS104RhlG). PHA synthase (lanes 2, 3) is indicated by the dashed arrow, while FabG (lane 2) and RhlG (lane 3) are indicated by the solid arrow.

Download figure to PowerPoint

Table 3.  Activities of NADPH-dependent 3-ketoacyl-ACP reductases in recombinant E. coli strains
  1. aCrude extracts obtained by sonication were used in the enzyme assay. One unit of 3-ketoacyl-ACP reductase is defined as the transformation of 1 μmol NADPH per minute. Specific activity of 3-ketoacyl-ACP reductase is defined as the activity of 3-ketoacyl-ACP reductase per gram of protein.

Strain (plasmid)Specific activity (U g−1)a
W3110 (no plasmid)0
W3110 (p10499613C2+pMCS104FabG)46
W3110 (p10499613C2+pMCS104RhlG)15
Table 4.  Results of flask cultures of recombinant E. coli strains for MCL-PHA biosynthesisa
  1. aCells were cultivated in LB medium supplemented with 2 g l−1 of sodium decanoate. Cultures were carried out in triplicate.

StrainPlasmidsCell concentration (g l−1)PHA conc. (g l−1)PHA content (wt%)PHA composition
     3HB3HHx3HO3HD3HDD
W3110p10499613C2+pBBR1MCS1.350000000
W3110p10499613C2+pMCS104FabG1.730.084.801139500
W3110p10499613C2+pMCS104RhlG1.200.043.20047530
WA101p10499613C2+pBBR1MCS0.950.2021.101536490
WA101p10499613C2+pMCS104FabG0.980.2222.1007930
WA101p10499613C2+pMCS104RhlG0.800.2632.701034560

3.2Production of MCL-PHA in a mutant E. coli strain defective in 3-ketoacyl-CoA thiolase (FadA) harboring the MCL-PHA synthase gene and the 3-ketoacyl-ACP reductase gene

Since 3-ketoacyl-ACP reductase competes with 3-ketoacyl-CoA thiolase for 3-ketoacyl-CoAs, it was reasoned that the inactivation of 3-ketoacyl-CoA thiolase (FadA) would result in the accumulation of more 3-ketoacyl-CoA having the same carbon number as the fatty acid supplied.

Two different recombinant fadA mutant E. coli WA101 strains were constructed by transferring the phaC2Ps gene along with the fabGEc gene or the rhlGPa gene. These recombinant E. coli strains were cultured in LB medium containing 2 g l−1 of sodium decanoate at 30°C. Recombinant E. coli WA101 harboring only the phaC2Ps gene was cultured in the same condition as a control. The results of flask cultures are summarized in Table 4. WA101 harboring only the phaC2Ps gene produced MCL-PHA consisting of 3-hydroxybutyrate (3HB), 3HHx, 3HO and 3HD, in which 3HO and 3HD are the major components. However, when the fabGEc gene was co-expressed with the phaC2Ps gene, the 3HD monomer was incorporated into MCL-PHA with very high fraction of 93 mol%. This result suggests that a metabolic route for enriching specific monomer into PHA was established in recombinant E. coli. On the other hand, the co-expression of the rhlGPa gene with the phaC2Ps gene did not much change the monomer composition of MCL-PHA, only resulting in the increase of PHA content to 33 wt% (Table 4).

4Discussion

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

In this study, we evaluated the role of 3-ketoacyl-ACP reductase in supplying PHA precursors from the β-oxidation pathway. Because FabG is an essential enzyme in fatty acid biosynthesis, it was originally thought that PHA could be synthesized from fatty acid by transferring only the MCL-PHA synthase gene into E. coli. However, it was found that the activity of FabG in E. coli was not sufficient to supply PHA precursors[6]. This problem could be solved by amplifying the activity of FabG using a multicopy plasmid harboring the fabGEc gene[6]. RhlG from P. aeruginosa, which is involved in rhamnolipid synthesis, is another 3-ketoacyl-ACP reductase homologous to PhaB and FabG[8]. In P. aeruginosa, RhlG is known to play a major role in rhamnolipid synthesis and a minor role in PHA biosynthesis[8]. Expression of the rhlGPa gene in recombinant E. coli also allowed the supply of (R)-3-hydroxyacyl-CoA from the β-oxidation pathway (Table 4). The effect of 3-ketoacyl-ACP reductase gene expression on MCL-PHA biosynthesis was notable in a fadA mutant E. coli strain. The E. coli FadA is known to have the highest activity with 3-ketodecanoyl-CoA, and in decreasing order with 3-ketododecanoyl-CoA and 3-ketooctanoyl-CoA[15]. As shown in Table 4, MCL-PHA enriched in 3HD (up to 93 mol%) could be synthesized from sodium decanoate by the co-expression of the fabGEc gene and the phaC2Ps gene. Interestingly, the effect of co-expression of the rhlGPa gene with the phaC2Ps gene on the monomer composition of MCL-PHA produced in fadA mutant E. coli WA101 was negligible. The incorporation of the 3HO monomer in a fadA mutant E. coli suggests that there exist alternative enzyme(s) that are responsible for cutting off two-carbon units from the C10 compound of the β-oxidation pathway generated by feeding decanoate. This phenomenon was also observed by other groups [2–5]. However, the overexpression of the fabGEc gene allowed efficient channeling of much of the intact C10 precursor into the PHA biosynthetic pathway, suggesting that the E. coli 3-ketoacyl-ACP reductase is highly competitive not only with 3-ketoacyl-CoA thiolase but also with the unknown alternative enzyme(s) mentioned above.

The co-expression of the rhlGPa gene with the phaC2Ps gene in the fadA mutant resulted in a slight increase in PHA content. A similar result has been reported previously by Witholt's group who showed that the additional expression of the P. aeruginosa fabG gene in a fadA mutant E. coli strain resulted in the increase of PHA content without much change of monomer composition: MCL-PHA composed of 23 mol% 3HHx, 65 mol% 3HO and 12 mol% 3HD was produced from hexadecanoate[5]. This difference seems to be due to the fact that the E. coli and P. aeruginosa 3-ketoacyl-ACP reductases have different substrate specificities and activities in E. coli.

Until now, the monomer composition of MCL-PHA has been mainly modulated by employing different carbon sources and applying different enzymes for the generation of PHA precursors. In this study, we demonstrated that the overexpression of the 3-ketoacyl-ACP reductase gene allowed production of MCL-PHA highly enriched in specific monomers. This strategy will allow the production of other MCL-PHAs rich in specific monomers by feeding fatty acids of different carbon numbers.

Acknowledgements

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

This work was supported by the National Research Laboratory Program (2000-N-NL-01-C-237) of the Korean Ministry of Science and Technology (MOST). We thank Dr. Y. Doi and Dr. Isabelle-S. Hinner for kindly providing us with plasmid pBSEB50 and pBBR1MCS, respectively. We also thank Dr. G.M. Church for the kind gift of plasmid pKO3.

References

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References
  • [1]
    Lee, S.Y. (1996) Bacterial polyhydroxyalkanoates. Biotechnol. Bioeng. 49, 114.
  • [2]
    Qi, Q., Rehm, B.H.A., Steinbüchel, A. (1997) Synthesis of poly(3-hydroxyalkanoates) in Escherichia coli expressing the PHA synthase gene phaC2 from Pseudomonas aeruginosa: comparison of PhaC1 and PhaC2. FEMS Microbiol. Lett. 157, 155162.
  • [3]
    Langenbach, S., Rehm, B.H.A., Steinbüchel, A. (1997) Functional expression of the PHA synthase gene phaC1 from Pseudomonas aeruginosa in Escherichia coli results in poly(3-hydroxyalkanoate) synthesis. FEMS Microbiol. Lett. 150, 303309.
  • [4]
    Qi, Q., Steinbüchel, A., Rehm, B.H.A. (1998) Metabolic routing towards polyhydroxyalkanoic acid synthesis in recombinant Escherichia coli (fadR): inhibition of fatty acid beta-oxidation by acrylic acid. FEMS Microbiol. Lett. 167, 8994.
  • [5]
    Ren, Q., Sierro, N., Witholt, B., Kessler, B. (2000) FabG, an NADPH-dependent 3-ketoacyl reductase of Pseudomonas aeruginosa, provides precursors for medium-chain-length poly-3-hydroxyalkanoate biosynthesis in Escherichia coli. J. Bacteriol. 182, 29782981.
  • [6]
    Taguchi, K., Aoyagi, Y., Matsusaki, H., Fukui, T., Doi, Y. (1999) Co-expression of 3-ketoacyl-ACP reductase and polyhydroxyalkanoate synthase genes induces PHA production in Escherichia coli HB101 strain. FEMS Microbiol. Lett. 176, 183190.
  • [7]
    Schubert, P., Steinbüchel, A., Schlegel, H.G. (1988) Cloning of the Alcaligenes eutrophus poly-β-hydroxybutyrate synthetic pathway and synthesis of PHB in Escherichia coli. J. Bacteriol. 170, 58375847.
  • [8]
    Campos-Garcia, J., Caro, A.D., Najera, R., Miller-Maier, R.M., Al-Tahhan, R.A., Soberon-Chavez, G. (1998) The Pseudomonas aeruginosa rhlG gene encodes an NADPH-dependent β-ketoacyl reductase which is specifically involved in rhamnolipid synthesis. J. Bacteriol. 180, 44424451.
  • [9]
    Link, A.J., Phillips, D., Church, G.M. (1997) Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J. Bacteriol. 179, 62286237.
  • [10]
    Stover, C.K., Pham, X.Q., Erwin, A.L., Mizoguchi, S.D., Warrener, P., Hickey, M.J., Brinkman, F.S., Hufnagle, W.O., Kowalik, D.J., Lagrou, M., Garber, R.L., Goltry, L., Tolentino, E., Westbrock-Wadman, S., Yuan, Y., Brody, L.L., Coulter, S.N., Folger, K.R., Kas, A., Larbig, K., Lim, R., Smith, K., Spencer, D., Wong, G.K., Wu, Z., Paulsen, I.T. (2000) Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406, 959964.
  • [11]
    Blattner, F.R., Plunkett, G., Bloch, C.A., Perna, N.T., Burland, V., Riley, M., Collado-Vides, J., Glasner, J.D., Rode, K., Mayhew, G.F., Gregor, J., Davis, N.W., Kirkpatrick, H.A., Goeden, M.A., Rose, D.J., Mau, B., Shao, Y. (1997) The complete genome sequence of Escherichia coli K-12. Science 277, 14531462.
  • [12]
    Matsusaki, H., Manji, S., Taguchi, K., Kato, M., Fukui, T. Doi, Y. (1998) Cloning and molecular analysis of the poly(3-hydroxybutyrate) and poly(3-hydroxybutyrate-co-3-hydroxyalkanoate) biosynthesis genes in Pseudomonas sp. strain 61-3. J. Bacteriol. 180, 64596467.
  • [13]
    Peekhaus, N., Conway, T. (1998) Positive and negative transcriptional regulation of the Escherichia coli gluconate regulon gene gntT by GntR and the cyclic AMP (cAMP)-cAMP receptor protein complex. J. Bacteriol. 180, 17771785.
  • [14]
    Kovach, M.E., Elzer, P.H., Hill, D.S., Robertson, G.T., Farris, M.A., Roop II, R.M., Peterson, K.M. (1995) Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166, 175176.
  • [15]
    Binstock, J.F., Schulz, H. (1981) Fatty acid oxidation complexes from Escherichia coli. Methods Enzymol. 71, 403411.