SEARCH

SEARCH BY CITATION

Keywords:

  • Surface protease;
  • Stress;
  • Degradation;
  • Processing;
  • Puromycin

Abstract

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgement
  7. References

Staphylococcus aureus encodes two HtrA-like serine surface proteases, called HtrA1 and HtrA2. The roles of these HtrA homologs were distinguished by expression studies in a heterologous host, Lactococcus lactis, whose single extracellular protease, HtrALl, was absent. HtrALl is involved in stress resistance, and processing and/or degradation of extracellular proteins. Controlled expression of staphylococcal htrA1 and htrA2 was achieved in L. lactis strain NZ9000 ΔhtrA, as confirmed with anti-HtrA1 and anti-HtrA2 specific antibodies. HtrA1 fully restored thermo-resistance to the htrA-defective L. lactis strain, despite a poor capacity to degrade abnormal or truncated proteins. We therefore propose that activities of HtrA1 other than proteolysis may be sufficient for high-temperature growth complementation. HtrA2 is 36% identical to HtrALl, and was highly expressed in L. lactis; nevertheless, it displayed nearly no detectable activities. The poor proteolytic activities of staphylococcal HtrA proteins in L. lactis may reflect a requirement for S. aureus-specific co-factors.


1Introduction

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgement
  7. References

The Gram-positive pathogen Staphylococcus aureus causes a wide variety and intensity of human infections, ranging from superficial skin and wound infections, to deep abscesses (endocarditis, meningitis), septicemia or toxin-associated syndromes (e.g., food poisoning and toxic shock syndrome) [1,2]. S. aureus is also a leading cause of hospital and community acquired infections. A multiplicity of factors, many of which are extracellular, contribute to S. aureus virulence. Surface proteins mediate adherence of bacteria to host tissues [2], the first step in bacterial colonization; secreted proteins such as exotoxins (α toxin, enterotoxins, [3]) and exoenzymes (coagulase, proteases, [1]) are implicated in bacterial dissemination.

Extracellular staphylococcal proteases participate in virulence by activating bacterial enzymes [1,4,5], modulating activities of other exported bacterial proteins [1,6–8], and degrading host proteins [1,9–12]. Protease activities contribute to bacterial colonization and dissemination, host tissue damage, and impairment of host defense mechanisms [1]. Where examined, extracellular staphylococcal proteases are secreted into the medium [1,13].

The surface serine protease HtrA (for High temperature requirement) belongs to a highly conserved family present in bacteria, yeasts, plants and humans. HtrA was initially characterized in Escherichia coli as a ‘housekeeping’ serine protease responsible for degradation of extracellular misfolded proteins [14,15]. In E. coli, HtrA is a stress response protein that degrades denatured or oxidatively damaged proteins produced at high temperature [15,16] and/or under oxidative stress [15,17]. E. coli HtrA also exhibits chaperone activity at low temperatures [18,19].

HtrA-like proteases are implicated in virulence of Gram-negative [15,20,21] and Gram-positive [22] pathogens, via their roles in stress resistance and survival [15,20–22]. This may explain why bacteria sometimes encode several htrA genes [23–26].

We previously characterized the unique HtrA-like surface protease present in Gram positive food bacterium Lactococcus lactis (called HtrALl) [27]. In addition to its requirement under stress conditions [27,28], HtrALl also processes different secreted proteins [27,29]. This novel HtrA function led us to propose that HtrA might be involved in processing of extracellular virulence factors in pathogens. In Streptococcus pyogenes, HtrA was recently shown to be involved in processing of at least one virulence factor [30].

Staphylococcal genomes encode two potential HtrA-like surface proteins (called HtrA1 and HtrA2). To avoid possible interference by numerous extracellular proteases in S. aureus, we conducted studies on the staphylococcal HtrA proteins in L. lactis inactivated for its unique htrA gene. Effects of HtrA-like protein expression were examined with respect to stress response and degradation or processing of extracellular proteins. The ability of an HtrA surface protease to function in a heterologous Gram-positive host has not been previously examined.

2Materials and methods

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgement
  7. References

2.1Bacterial strains, plasmids, and growth conditions

Table 1 lists bacteria and plasmids used in this study. Aerobic growth of E. coli TG1 in Luria–Bertani broth (LB; Difco), and S. aureus RN6390 in Brain Heart Infusion medium (BHI; Difco) was at 37 °C. Lactococcal strains were grown without shaking in M17 medium (Difco) supplemented with 0.5% glucose (GM17) at 30 °C. Solid medium contained a final agar concentration of 1.2% in GM17 and 1.5% in BHI or LB media. Antibiotics were added to media for plasmid maintenance as follows: chloramphenicol (Cm), 10 μg/ml (or 5 μg/ml when two antibiotics were present) for L. lactis and 20 μg/ml for E. coli; erythromycin (Ery), 2.5 μg/ml for L. lactis.

Table 1.  Strains and plasmids used in this study
 Key featuresReference
  1. For intermediate strain and plasmid constructions, see Section 2.

Strains  
E. coli TG1supE hsdΔ5 thiΔ(lac-proAB) F' (traD36 proABlacZΔM15)[31]
S. aureus RN6390wild type, derivative of NCTC 8325[32]
L. lactis MG1363wild type, prophage-cured L. lactis subsp. cremoris, plasmid free[33]
L. lactis NZ9000MG1363 with a chromosomal copy of nisRK genes, plasmid-free[34]
L. lactis SMBI198 (referred to as NZ9000 ΔhtrA)NZ9000, htrA disruption by double cross-over recombinationThis work
Plasmids  
pVE3655pWV01, CmR, containing PnisA, used as negative control, referred as pCYT*[35]
pCYT::nucpWV01, CmR, expression vector containing the nuc gene under control of PnisA[36]
pCYT::htrA1pWV01, CmR, derivative of pCYT::nuc in which nuc is replaced by the htrA1 gene of S. aureusThis work
pCYT::htrA2pWV01, CmR, derivative of pCYT::nuc in which nuc is replaced by the htrA2 gene of S. aureusThis work
pJIM2429EryR, contains the lip gene under control of P23[37]

Lactococcal strains used for stress studies all contained a pCYT derivative plasmid [36], which carried (or not) the S. aureus htrA gene (htrA1 or htrA2) and a Cm resistance marker. Overnight cultures in GM17 containing 10 μg/mL of Cm were diluted 150-fold in the same medium. After 1 h growth, cultures were separated in two equal parts: nisin (0.01 ng/ml final concentration) was added to one part; and that without nisin served as control. At optical density of 600 nm (OD600) = 0.07 (± 0.01), half of each culture was shifted to 39 °C. Growth of strains at 30 and 39 °C was followed by OD600 measurements. For puromycin stress studies, cultures were grown as above and treated with nisin 0.01 ng/ml. Exponential cultures were diluted in peptone water and dilutions were spotted on GM17 plates containing or not puromycin (15 μg/ml). Plates were incubated 48 h at 30 °C. The number of colonies appearing at the different dilutions was determined.

2.2DNA manipulations

Plasmid DNA preparations, PCR amplifications, and DNA modifications were carried out according to commonly used techniques or suppliers' instructions. DNA transformation was performed by the CaCl2 method for E. coli[38] and by electroporation for L. lactis[39]. DNA sequencing was performed by Genome Express (France).

2.3Construction of a double crossover htrA deletion mutant in L. lactis NZ9000

A fragment of the L. lactis MG1363 htrA gene harboring a 322 bp internal deletion was synthesized by cloning two PCR fragments on a single vector. The 5′ end htrA fragment was PCR-amplified using P1-XhoI: 5′-CGCGCTCGAGGTGGGCGGAGCCATCGCACTT-3′ (XhoI site underlined) and P2: 5′-ACCTTCCACAGAGGTAGAACCGTGTATTCATCATAACCAACA-3′. The 3′ end htrA fragment was amplified using P3: 5′-TGTTGGTTATGATGAATACACGGTTCTACCTCTGTGGAAGGT-3′ and P4-BamHI: 5′-GGCCGGATCCGTTGATTTAGAAAGTTTAACA-3′ (BamHI site underlined). P2 and P3 are complementary; consequently the two PCR fragments contain overlapping regions. The two fragments were annealed, and PCR amplification was performed using the two outer primers P1-XhoI and P4-BamHI. The resultant DNA fragment was digested with XhoI and BamHI, purified, and inserted into suicide vector pSMA500 [40], resulting in pAMJ411. Introduction of pAMJ411 into L. lactis NZ9000 [34] selecting for Ery resistance led to plasmid pAMJ411 genomic integration through homologous recombination, resulting in strain AMJ988. To obtain the second crossover event (we were otherwise unable to obtain the deletion), we introduced an ectopic, non-identical htrA gene copy into AMJ988. The htrA orf from L. lactis strain IL1403 was PCR-amplified using primers N coI-HtrA-IL1403: 5′-GGATATTCCCCATGGCAAAAGCTAATATAGGAAAATTG-3′ (coding sequence in italics, NcoI site underlined) and SalI-HtrA-IL1403: 5′-ACGCGTCGACTTAATTAGAAGAAGATGGACTGCTTG-3′ (coding sequence in italics, SalI site underlined) and inserted into pCRII-TOPO (Invitrogen) resulting in pSMBI164. pSMBI164 was digested by NcoI and XbaI and the htrA gene was inserted downstream of the nisin-inducible promoter in CmR expression vector pNZ8048 [34], which was pre-digested with NcoI and XbaI. The resulting plasmid, pSMBI167, contains the complete htrA gene from L. lactis IL1403 controlled by the nisin-inducible promoter.

Plasmid pSMBI167 was introduced into strain AMJ988, selecting with Ery, Cm and nisin. The resultant strain, SMBI174, was grown with Cm and nisin, to obtain the second crossover event. An Ery-sensitive clone, SMBI178, containing the expected htrA genomic deletion was isolated. SMBI178 was grown in non-selective GM17 medium to facilitate loss of the complementing htrA+ plasmid. Cm-sensitive clone, SMBI198 (NZ9000 ΔhtrA) was isolated, and the htrA allele was confirmed by PCR and sequencing. The resultant HtrA product is truncated at position 155.

2.4Plasmid constructions

Plasmids pCYT::htrA1 and pCYT::htrA2 permit controlled expression of S. aureus htrA1 and htrA2 genes, respectively (Table 1). The ∼1.3 kb htrA1 gene was amplified from S. aureus strain RN6390 using forward primer A1-5′: 5′-GCTCTAGAGGATCCTAATGGAGGTTAAGTATGTCAG-3′ (BamHI site underlined), and reverse primer A1-3′: 5′CCGCTCGAGGATATCCTCTTAATGTACTTTTCTGTCTG-3′ (EcoRV site underlined). The PCR fragment was cloned into the pCRII-TOPO vector following the instruction manual, resulting in plasmid pTopo::htrA1. After htrA1 fragment sequence confirmation, the pTopo::htrA1 plasmid was digested by BamHI and EcoRV, and the htrA1 fragment was purified and cloned into BamHI- and EcoRV-treated pCYT::nuc vector [36]. In this cloning, the nuc gene present in pCYT::nuc is replaced by the htrA1 gene. Transformation of the above ligation was performed directly in L. lactis MG1363, resulting in pCYT::htrA1.

The ∼2.3 kb htrA2 gene was amplified from S. aureus RN6390 using forward primer A2-5′: 5′-GCTCTAGAGGATCCAAA*G*GAG*G*TTATTGAATGGAGTGGACATTAG-3′ (BamHI site underlined) and reverse primer A2-3′: 5′-CCGCTCGAG CCCGGGGACACGTTGTTCACCTCAAC -3′ (SmaI site underlined). Asterisks indicate mutations introduced in the ribosome binding site (RBS) of htrA2 to generate a consensus RBS sequence that can be recognized by L. lactis. The PCR fragment was cloned into pCRII-Topo vector and the htrA2 fragment sequence was verified. Resulting plasmid pTopo::htrA2 was digested by BamHI and SmaI. The htrA2 fragment was purified and cloned into BamHI- and EcoRV-treated pCYT::nuc (nuc is replaced by the htrA2 gene). The pCYT::htrA2 ligation was transformed in E. coli TG1.

Plasmids pCYT::htrA1 and pCYT::htrA2 were extracted from MG1363 and TG1 strains respectively and electroporated into L. lactis NZ9000 [34] and NZ9000 ΔhtrA. The htrA1 or htrA2 genes are expressed under control of nisin-inducible promoter, PnisA[34]. Nisin-controlled expression (NICE) is based on a combination of the PnisA promoter and the nisRK regulatory genes, which are chromosomally expressed in L. lactis NZ9000.

2.5Production of HtrA1- and HtrA2-specific antibodies

Peptides used as immunogen for anti-HtrA1 and anti-HtrA2 polyclonal antibody synthesis are described in results and Fig. 1. Synthesized peptides conjugated to keyhole limpet hemocyanin carrier protein were used for rabbit immunizations (Eurogentec).

imageimage

Figure 1. (a) Alignment of HtrA1 and HtrA2S. aureus (NCTC 8325 strain) homologs and L. lactis HtrALl (MG1363 strain). Conserved AAs are highlighted in dark grey. Conserved residues around the catalytic site and PDZ domains are highlighted in light grey. The three residues of the catalytic site are in bold and indicated by asterisks. Putative membrane spanning and PDZ domain regions are indicated. Peptides used as immunogen for anti-HtrA1 and anti-HtrA2 antibody synthesis are underlined. (b) HtrA1 and HtrA2 expression in L.lactis. Whole cell protein extracts of L. lactis WT pCYT*, ΔhtrA pCYT*, ΔhtrA pCYT::htrA1 and ΔhtrA pCYT::htrA2 strains were prepared after growth in the absence (−) or presence (+) of 12.5 ng/ml nisin. Samples corresponding to equivalent amounts of cells were loaded on a 12% SDS–PAGE gel, which was then processed for Western blotting, using anti-HtrA1- or anti-HtrA2- specific antibodies (see Section 2). Positions of molecular weight marker and predicted protein sizes of HtrA1, HtrA2, and HtrALl are indicated.

2.6Protein extracts, SDS–PAGE, Western blot and zymograms

Lactococcal strains were grown in GM17 with appropriate antibiotics. At OD600=∼0.4, nisin (final concentration of either 0.01, 1, or 12.5 ng/ml) was added to half of each culture. After 1 h of induction, cell and supernatant protein extracts were prepared as described [41]. Equivalent protein concentrations per sample, and molecular markers (Fermentas) were loaded onto 12% or 15% SDS–polyacrylamide gels. Western blotting was performed as described [38]. The anti-HtrA antisera and purified antibody dilutions used were 1:1000. Antibody directed against the Staphylococcus hyicus lipase (kindly provided by P. Renault; [37]) was used at a 1:2500 dilution. Immunodetection was carried out with Protein G-HRP conjugate (Biorad) for polyclonal antibodies, followed by revelation using Western Lightning™ Chemiluminescence Reagent (Perkin–Elmer).

Lytic activity was detected from samples, after SDS–PAGE by zymograms, using autoclaved Micrococcus lysodeikticus ATCC 4698 (Sigma) cells as substrate [42].

3Results and discussion

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgement
  7. References

3.1Two HtrA-like proteases in S. aureus and design of specific antibodies

Database searches identified two htrA homologs in the S. aureus NCTC 8325 genome (Accession No. NC002954). htrA1 and htrA2 encode HtrA1 (annotated as Do-like protease) and HtrA2 (annotated as HtrA) putative proteases (Fig. 1(a)), respectively. Both protease ORFs were present in the six other available S. aureus genome sequences.

The putative 424 amino acid (AA) HtrA1 protein shares 40% identity with L. lactis HtrA protease (Fig. 1(a)). HtrA1 is predicted to be a surface protein with an N-terminal transmembrane region followed by an extracellular domain containing the catalytic triad His144, Asp174 and Ser255, and one C-terminal PDZ domain. This structure is conserved among HtrA homologs of Gram-positive bacteria [22].

Starting from position 363 (769 AA total length), HtrA2 is 36% identical to HtrALl, (see Fig. 1(a)). Like HtrA1, the HtrA2 region spanning positions 363 through 769 has a putative membrane anchor, an extracellular catalytic site comprising His504, Asp534, and Ser619, and one extracellular C-terminal PDZ domain. The atypical HtrA2 N-terminal intracellular extremity has no apparent homolog in other species. The HtrA2 catalytic site is less conserved compared to HtrA1 and HtrALl (see Fig. 1(a)). Moreover, a search for putative promoters or terminators around htrA genes suggests that htrA2 is in an operon with a downstream orf encoding a putative Na+ transporting ATP synthase, while htrA1 appears to be monocistronic. Differences between HtrA1 and HtrA2 (which are 34% identical) may suggest that they have distinct roles or are differently regulated in S. aureus.

We determined peptide regions on the staphylococcal HtrA ORFs, that could potentially elicit HtrA1- and HtrA2-specific antibody production (underlined in Fig. 1(a)). The selected HtrA1 motif encompasses the Ser255 of the catalytic site (Q245TDAAINPGNSGGAL). As this region of HtrA1 differs by four AAs from that of HtrA2, the anti-HtrA1 antiserum was not expected to recognize the HtrA2 protein. The HtrA2 motif chosen as the antigenic target was present in the N-terminal atypical region (G260DSEQNDKSNHENDL), and as such is specific to the HtrA2 protein (Fig. 1(a)).

Interestingly, the region around the Ser255 of the HtrA1 catalytic site is identical in 32 HtrA bacterial homologs (many of which are present in bacterial pathogens), indicating strong sequence conservation (Table 2). The anti-HtrA1 antiserum should thus be valuable for HtrA studies in these other bacteria. In contrast, the AA sequence of the region surrounding the HtrA2 catalytic serine (Ser619; Q609IDASVNPGNSGGAV) is unique to S. aureus. Its specific detection with antibodies should prove useful in determining conditions of expression of this putative protease.

Table 2.  Conservation of the catalytic motif QTDAAINPGNSGGAL (around the catalytic serine) of S. aureus HtrA1 in numerous bacteria
SwissProt/Trembl designationSpecies (strains)Peptide length (in AAs)Position of motif
  1. Only bacteria whose HtrA-like protein(s) contain exact motif are shown. Note that several species appear to have two HtrA-like proteins with identical catalytic motifs.

Q81Y95Bacillus anthracis (strain Ames)413245–259
Q81JJ5 391227–241
Q81AG8Bacillus cereus (strain ATCC 14579/DSM 31)413245–259
Q814H6 391227–241
Q9K5R6Bacillus halodurans406240–254
P39668Bacillus subtilis400233–247
Q7WDX1Bordetella bronchiseptica (Alcaligenes bronchisepticus)371208–222
Q7W2X1Bordetella parapertussis371208–222
Q7W077Bordetella pertussis378208–222
Q89JB5Bradyrhizobium japonicum423160–174
Q44596Brucella abortus474210–224
Q8YHL4Brucella melitensis474210–224
Q8G096Brucella suis474210–224
Q899I5Clostridium tetani391235–249
Q9Z4H7Lactobacillus helveticus413248–262
Q9LA06Lactococcus lactis408229–243
Q92EY8Listeria innocua499331–345
Q8KR20Listeria monocytogenes542374–388
Q8YA67 500332–346
Q7U0X2Mycobacterium bovis464307–321
Q9Z5G6Mycobacterium leprae452295–309
Q9CD67 382225–239
Q8VKA4Mycobacterium tuberculosis446289–303
O53896 464307–321
Q82UH7Nitrosomonas europaea377218–232
Q8EKY5Oceanobacillus iheyensis400237–251
Q8CXM3 461296–310
Q51374, Q9HVX1Pseudomonas aeruginosa389217–231
Q88NB1Pseudomonas putida (strain KT2440)402233–247
Q87WV8Pseudomonas syringae (pv. tomato)386217–231
Q8XV99Ralstonia solanacearum (Pseudomonas solanacearum)403227–241
Q98N31Rhizobium loti (Mesorhizobium loti)428164–178
Q92Z82Rhizobium meliloti (Sinorhizobium meliloti)468220–234
CAE28662Rhodopseudomonas palustris463200–214
Q99TD6Staphylococcus aureus (strain Mu50/ATCC 700699/N315/MW2)424245–259
Q8CNW1Staphylococcus epidermidis412242–256
Q8E2I9 Q8DWP1Streptococcus agalactiae serotypes III, V409227–241
Q8DRQ6Streptococcus mutans402229–243

3.2Construction of a L. lactis ΔhtrA strain; overexpression and detection of S. aureus HtrA1 and HtrA2 proteins in L. lactis

We constructed a marker-free double crossover L. lactisΔhtrA mutant in L. lactis NZ9000 expression strain, and introduced plasmids pCYT::htrA1 and pCYT::htrA2, used for conditional expression of HtrA1 and HtrA2. Expression of htrA genes was varied by adding between 0.01 and 12.5 ng/ml nisin to cultures.

Expression of HtrA1 and HtrA2 proteins in L. lactis was examined by Western blotting using specific antibodies (Fig. 1(b)). Protein extracts were prepared from different L. lactis strains grown with several nisin concentrations: NZ9000 pVE3655 (referred to as wild type [WT pCYT*] positive control), NZ9000 ΔhtrA pVE3655 (ΔhtrA pCYT*, negative control), NZ9000 ΔhtrA pCYT::htrA1htrA pCYT::htrA1), and NZ9000 ΔhtrA pCYT::htrA2htrA pCYT::htrA2). The HtrA1–specific antibody revealed a band corresponding to the lactococcal HtrALl protein (∼42 KDa), which was absent in ΔhtrA pCYT*. HtrALl recognition is expected, as antibodies were prepared against the identical region in HtrA1. A ∼46 KDa band, the expected size of HtrA1, was detected in ΔhtrA pCYT::htrA1 extracts. No band was detected in the ΔhtrA pCYT::htrA2 extracts (not shown).

HtrA2-specific antibody revealed a band of ∼100 KDa only in ΔhtrA pCYT::htrA2 extracts, which is slightly greater than expected for HtrA2 (∼90 KDa), probably due to anomalous migration on SDS–PAGE.

In these studies, low levels of S. aureus HtrA proteins were detected without nisin, suggesting that the PnisA system used in combination with pCYT derivatives may be leaky. Induction with 0.01 ng/ml nisin (not shown) and 12.5 ng/ml nisin (Fig. 1(b)) led to increased amounts of HtrA1 and HtrA2. At greater nisin concentration, smaller-sized HtrA products were observed, possibly reflecting degradation by HtrA1, HtrA2 or cytoplasmic proteases, or incomplete HtrA synthesis at high expression levels.

3.3HtrA1 but not HtrA2 overexpression causes growth retardation

We compared growth of strains expressing or not the HtrA1 or HtrA2 proteins, using different nisin concentrations (0.01–5 ng/ml; Fig. 2 and not shown). When cultured at 30 °C with 0.1 ng/ml nisin (Fig. 2), growth of WT pCYT*, ΔhtrA pCYT*, and ΔhtrA pCYT::htrA2 strains was identical to that without nisin (not shown). However, ΔhtrA pCYT::htrA1 growth was slowed, indicating that HtrA1 overexpression is toxic to L. lactis. Possible causes of growth retardation are cellular damage due to HtrA1-mediated protein degradation, or interactions between HtrA1 (or its degradation products) and cell components. In contrast, HtrA2 overexpression did not retard growth, despite accumulation of HtrA2 degradation products.

image

Figure 2. HtrA1 but not HtrA2 overexpression is toxic for L. lactisΔhtrA growth. Overnight cultures of L. lactis WT pCYT*, ΔhtrA pCYT*, ΔhtrA pCYT::htrA1 and ΔhtrA pCYT::htrA2 strains in GM17 supplemented with Cm were diluted 150-fold in the same medium. Nisin (0.1 ng/ml) was added in early exponential phase (indicated by arrow). Growth at 30 °C was followed by OD600 measurements.

Download figure to PowerPoint

3.4Effects of staphylococcal HtrA proteins on stress response in L. lactis ΔhtrA strain

HtrA protease is implicated in bacterial survival under stress conditions [15], although different roles are reported. The L. lactis htrA mutant is thermo- and puromycin-sensitive [27,28]. To determine whether HtrA1 or HtrA2 intervenes in L.lactisΔhtrA stress response, we tested whether these proteins restore growth upon stress challenge, using 0.01 ng/ml nisin to avoid any toxicity due to HtrA1 overproduction.

L. lactis htrA strains are thermosensitive at 39 °C [27–29]. We compared growth of L. lactis WT pCYT*, ΔhtrA pCYT*, ΔhtrA pCYT::htrA1, and ΔhtrA pCYT::htrA2 strains at 30 °C (the optimal L. lactis growth temperature) and after a shift to 39 °C, in GM17 containing Cm and nisin (0.01 ng/ml) (Fig. 3(a) and (b)). At 30 °C, the four strains grew identically, indicating that the complementing HtrA expression levels were not toxic. At 39 °C, the WT pCYT* strain grew essentially the same as at 30 °C, while ΔhtrA mutant (ΔhtrA pCYT) growth was arrested. Growth at 39 °C was fully complemented by htrA1, even in the absence of nisin (not shown), showing that low levels of HtrA1 can complement the ΔhtrA deficiency. No complementation by htrA2 was observed (Fig. 3), even at high nisin levels (up to 1 ng/ml, which was not toxic to the htrA2-expressing strain; not shown).

image

Figure 3. Thermosensitivity of the ΔhtrA strain is suppressed by low expression of HtrA1, but not HtrA2. Cultures of L. lactis WT pCYT*, ΔhtrA pCYT*, ΔhtrA pCYT::htrA1 and ΔhtrA pCYT::htrA2 strains at 30 °C were prepared as in Fig. 2. Early exponential cultures were treated with 0.01 ng/ml nisin, followed by a temperature shift to 39 °C of an aliquot of each culture. Growth at 30 °C (a) and 39 °C (b) was followed by OD600 measurements.

Download figure to PowerPoint

These results indicate that the S. aureus HtrA1 protein, but not HtrA2, efficiently restores high temperature growth of an htrA-defective L. lactis strain, and is therefore implicated in stress-response.

Puromycin interferes with protein translation, and causes the formation of truncated polypeptides [43]; exported proteins could be truncated by puromycin, and then secreted, requiring removal by HtrA, as seen in L. lactis[28]. L. lactis WT pCYT*, htrA pCYT*, ΔhtrA pCYT::htrA1, and ΔhtrA pCYT::htrA2 strains were grown to exponential phase with 0.01 ng/ml nisin, and dilutions were deposited in spots on GM17 plates containing 0 or 15 μg/ml of puromycin (not shown). Growth of WT pCYT* was unaffected by puromycin, while the ΔhtrA mutant showed ∼104-fold lower viability; growth of strains containing htrA1 or htrA2 was similar to that of the mutant, indicating that their presence did not confer puromycin resistance to ΔhtrA.

As the staphylococcal HtrA proteins appear unable to degrade truncated proteins in this context, we asked whether they have protease activity.

3.5Protein degradation or processing by HtrA1 or HtrA2 staphylococcal proteins in L. lactis ΔhtrA strain

We examined the stability of several extracellular proteins (which are processed or degraded by HtrALl) in WT pCYT*, ΔhtrA pCYT*, ΔhtrA pCYT::htrA1, and ΔhtrA pCYT::htrA2 strains. Degradation or maturation of a tripartite fusion protein Exp5-ΔSPNuc ([41] not shown), the Staphylococcus hyicus lipase (Lip) ([37]; Fig. 4), the native autolysin (AcmA) protein ([27]; Fig. 5), and the S. aureus nuclease (Nuc) protein ([27]; not shown) was examined. In all four cases, full size proteins were observed in ΔhtrA pCYT* (htrA -deficient) strains, whereas maturation and/or degradation products were observed in the WT pCYT* strain (see Figs. 4 and 5; [27,29]). Profiles of all four target proteins were essentially identical in ΔhtrA pCYT* and ΔhtrA pCYT::htrA2 strains, regardless of induction levels used, showing that HtrA2 was not protease-proficient in L. lactis. In contrast, the four targets were degraded or processed in ΔhtrA pCYT::htrA1 (Figs. 4 and 5, and not shown), indicating that HtrA1 is proteolytically active in L. lactis. Nevertheless, proteolytic activity was clearly weak, and partial compared to that observed for the native HtrALl; degradation required high induction levels (e.g., see Fig. 5, and not shown). These results showed that in the heterologous context, HtrA1 is less efficient and possibly less specific than HtrALl. HtrA2 did not display proteolytic activity.

image

Figure 4. Degradation of S. hyicus pro-Lipase protein by HtrA1, but not HtrA2. Supernatant protein extracts were prepared from non-induced or nisin-induced (1 ng/ml) exponential phase cultures of L. lactis WT pCYT*, ΔhtrA pCYT*, ΔhtrA pCYT::htrA1, and ΔhtrA pCYT::htrA2 strains expressing pro-Lip (from pJIM2429). Western blots, performed with anti-lipase polyclonal antibody, are shown. Reduced amounts of pro-Lip in the ΔhtrA strain result from less protein present in extracts (visualized by Coomassie blue gel staining; not shown). Migration of pro-Lip, the Lip mature form and degradation products (‘Degrad prod’) are indicated by arrows. Molecular weights are indicated at left.

Download figure to PowerPoint

image

Figure 5. Processing of L. lactis native AcmA protein by high levels of HtrA1, but not HtrA2. Total protein extracts of non-induced or nisin-induced (0.01 or 12.5 ng/ml) exponential phase cultures of L. lactis WT pCYT*, ΔhtrA pCYT*, ΔhtrA pCYT::htrA1, and ΔhtrA pCYT::htrA2 strains were analyzed for autolysin activity by zymogram as described [41]. Positions of the precursor, the major AcmA form and the matured active product (Degrad prod) are indicated by arrows. Overexpression of HtrA1 (12.5 ng/ml nisin) generates an active AcmA degradation product (arrowhead).

Download figure to PowerPoint

Interestingly, thermosensitivity of L. lactisΔhtrA is fully complemented at low HtrA1 expression levels (even in the absence of inducer), despite the quasi-absence of protein degradation functions (as seen by puromycin sensitivity and limited degradation of heterologous protein targets at 30 °C). Poor proteolytic activity of HtrA1 in L. lactisΔhtrA may reflect intrinsic metabolic differences between S. aureus and L. lactis, and the need for host-specific conditions or co-factors. We observed a very slight increase in NucB processing by HtrA1 at higher temperature (37 °C; not shown), although processing was clearly less efficient than with native HtrALl.

These results raise the question of whether thermal stress resistance can be uncoupled from protein degradation. In E. coli, HtrA was shown to have chaperone activity at non-stress temperatures [18,19,44]. We speculate that HtrA1 complementation of thermal stress sensitivity in L. lactisΔhtrA may not only depend upon proteolysis, possibly suggesting that chaperone activity is important in assuring growth at high temperatures.

Another question concerns why HtrA2, which is similar to both HtrA1 and HtrALl, and was expressed and induced in L. lactis, was non-functional with respect to thermosensitivity and degradation activities. We detected very low levels of Nuc processing at 37 °C (the optimal growth temperature of S. aureus) at high HtrA2 expression levels, suggesting that this protease may be weakly active (not shown). Possibly, HtrA2 has a specific substrate; alternatively, its N-terminal domain interacts with a factor that activates proteolytic activity. We are also studying the effects of htrA mutants in two S. aureus backgrounds: htrA mutants show strain-specific phenotypes, even with respect to stress sensitivities (CR, unpublished data). A comparison of HtrA activities in the heterologous and native hosts will be valuable in determining the roles of HtrA in bacterial survival and virulence.

Acknowledgement

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgement
  7. References

We are grateful to C. Foucaud-Scheunemann (URLGA), P. Langella (URLGA) and P. Renault (INRA), for providing plasmids used in this study, and M.-P. Chapot-Chartier (INRA) for advice on AcmA detection by zymogram. We appreciate stimulating discussion of this work with P. Gaudu, D. Llull and P. Serror, and we thank D. Halpern for his support and encouragement during this work. We thank S. Kulakauskas (URLGA) for suggestions on improving the manuscript. We thank P. Smith and A. Brix for excellent technical assistance. CR was recipient of a doctoral training grant from the ‘Région of Ile de France’ and from INRA.

References

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgement
  7. References
  • [1]
    Arvidson, S. (2000) Extracellular enzymes. In: Gram Positive Pathogens (Fischetti, V.A., et al., Eds.), pp. 379–385. Chapter 39.
  • [2]
    Höök, M. and Foster, T.J. (2000) Staphylococcal surface proteins. In: Gram Positive Pathogens, (Fischetti, V.A., et al., Eds.), pp. 386–391. Chapter 40.
  • [3]
    Bohach, G.A. and Foster, T.J. (2000) Staphylococcus aureus exotoxins. In: Gram Positive Pathogens, (Fischetti, V.A., et al., Eds.), pp. 367–378. Chapter 38.
  • [4]
    Drapeau, G.R. (1978) Role of a metalloprotease in activation of the precursor of staphylococcal protease. J. Bacteriol. 136, 607613.
  • [5]
    Rice, K., Peralta, R., Bast, D., de Azavedo, J., McGavin, M.J. (2001) Description of staphylococcus serine protease (ssp) operon in Staphylococcus aureus and non polar inactivation of sspA-encoded serine protease. Infect. Immun. 69, 37913799.
  • [6]
    Karlsson, A., Saravia-Otten, P., Tegmark, K., Morfeldt, E., Arvidson, S. (2001) Decreased amounts of cell wall-associated protein A and fibronectin-binding proteins in Staphylococcus aureus sarA mutants due to up-regulation of extracellular proteases. Infect. Immun. 69, 47424748.
  • [7]
    McAleese, F., Walsh, E., Sieprawska, M., Potempa, J., Foster, T. (2001) Loss of clumping factor B fibrinogen binding activity by Staphylococcus aureus involves cessation of transcription, shedding and cleavage by metalloprotease. J. Biol. Chem. 276, 2996929978.
  • [8]
    Mc Gavin, M., Zahradka, C., Rice, K., Scott, J. (1997) Modification of the Staphylococcus aureus fibronectin binding phenotype by V8 protease. Infect. Immun. 65, 26212628.
  • [9]
    Potempa, J., Watorek, W., Travis, J. (1986) The inactivation of human α1-proteinase inhibitor by proteinases from Staphylococcus aureus. J. Biol. Chem. 261, 1433014334.
  • [10]
    Potempa, J., Dubin, A., Korzus, G., Travis, J. (1988) Degradation of elastin by a cysteine proteinase from Staphylococcus aureus. J. Biol. Chem. 263, 26642667.
  • [11]
    Potempa, J., Fedak, D., Dubin, A., Mast, A., Travis, J. (1991) Proteolytic inactivation of α1-anti-chymotrysin. Sites of cleavage and generation of chemotactic activity. J. Biol. Chem. 266, 2148221487.
  • [12]
    Prokesova, L., Potuznikova, B., Potempa, J., Zikan, J., Radl, J., Hachova, L., Baran, K., Porwit-Bobr, Z., John, C. (1992) Cleavage of human immunoglobulins by serine proteinase from Staphylococcus aureus. Immunol. Lett. 31, 259265.
  • [13]
    Shaw, L., Golonka, E., Potempa, J., Foster, S.J. (2004) The role and regulation of the extracellular proteases of Staphylococcus aureus. Microbiology 150, 217228.
  • [14]
    Hunke, S., Betton, J.M. (2003) Temperature effect on inclusion body formation and stress response in the periplasm of Escherichia coli. Mol. Microbiol. 50, 15791589.
  • [15]
    Pallen, M.J., Wren, B.W. (1997) The HtrA family of serine proteases. Mol. Microbiol. 26, 209221.
  • [16]
    Lipinska, B., Zylick, M., Georgopoulos, M.C. (1990) The HtrA (DegP) protein, essential for Escherichia coli survival at high temperatures, is an endopeptidase. J. Bacteriol. 172, 17911797.
  • [17]
    Skorko-Glonek, J., Zurawa, D., Kuczwara, E., Wozniak, M., Wypych, Z., Lipinska, B. (1999) The Escherichia coli heat shock protease participates in defense against oxidative stress. Mol. Gen. Genet. 262, 342350.
  • [18]
    Krojer, T., Garrido-Franco, M., Huber, R., Ehrmann, M., Clausen, T. (2002) Crystal structure of DegP (HtrA) reveals a new protease-chaperone machine. Nature 416, 455459.
  • [19]
    Spiess, C., Beil, A., Ehrmann, M. (1999) A temperature dependent switch from chaperone to protease in a widely conserved heat shock protein. Cell 97, 339347.
  • [20]
    Cortes, G., de Astorza, B., Benedi, V.J., Alberti, S. (2002) Role of htrA gene in Klebsiella pneumoniae virulence. Infect. Immun. 70, 47724776.
  • [21]
    Johnson, K., Charles, I., Dougan, G., Pickard, D., O'Gaora, P., Costa, G., Ali, T., Miller, I., Hormaeche, C. (1991) The role of a stress response protein in Salmonella typhimurium virulence. Mol. Microbiol. 2, 401407.
  • [22]
    Jones, C.H., Bolken, T.C., Jones, K.F., Zeller, G.O., Hruby, D.E. (2001) Conserved DegP protease in Gram-positive bacteria is essential for thermal and oxidative tolerance and full virulence in Streptococcus pyogenes. Infect. Immun. 69, 55385545.
  • [23]
    Alba, B.M., Zhong, H.J., Pelayo, J.C., Gross, C.A. (2001) degS (hhoB) is an essential Escherichia coli gene whose indispensable function is to provide σE activity. Mol. Microbiol. 40, 43234333.
  • [24]
    Boucher, J.C., Martinez-Salazar, J., Schurr, M.J., Mudd, M., Yu, H., Deretic, V. (1996) Two distinct loci affecting conversion to mucoidy in Pseudomonas aeruginosa in cystic fibrosis encode homologs of the serine protease HtrA. J. Bacteriol. 178, 511523.
  • [25]
    Noone, D., Howell, A., Collery, R., Devine, K.M. (2001) YkdA and YvtA, HtrA-like serine protease in Bacillus subtilis, engaged in negative autoregulation and reciprocal cross-regulation of ykdA and yvtA gene expression. J. Bacteriol. 183, 654663.
  • [26]
    Waller, P.R.H., Sauer, R.T. (1996) Characterization of degQ and degS Escherichia coli genes encoding homologs of the DegP protease. J. Bacteriol. 178, 11461153.
  • [27]
    Poquet, I., Saint, V., Seznec, E., Simoes, N., Bolotin, A., Gruss, A. (2000) HtrA is the unique surface housekeeping protease in Lactococcus lactis and is required for natural protein processing. Mol. Microbiol. 35, 10421051.
  • [28]
    Foucaud-Scheunemann, C., Poquet, I. (2003) HtrA is a key factor in the response to specific stress conditions in Lactococcus lactis. FEMS Microbiol. Lett. 224, 5359.
  • [29]
    Miyoshi, A., Poquet, I., Azevedo, V., Commissaire, J., Bermudez-Humaran, L., Domakova, E., Le Loir, Y., Oliveira, S.C., Gruss, A., Langella, P. (2002) Controlled production of stable heterologous proteins in Lactococcus lactis. Appl. Environ. Microbiol. 68, 31413146.
  • [30]
    Lyon, W.R., Caparon, M.G. (2004) Role for serine protease HtrA (DegP) of Streptococcus pyogenes in the biogenesis of virulence factors SpeB and the hemolysin streptolysin S. Infect. Immun. 72 (3), 16181625.
  • [31]
    Gibson, T.J. (1984) PhD. Thesis. University of Cambridge, Cambridge, England
  • [32]
    Novick, R.P., The staphylococcus as a molecular genetic system. Molecular biology of the staphylococci. (1990) VCH Publishers, New York. 1–40.
  • [33]
    Gasson, M.J., Lyndon-Davies, F. (1980) Prophage-cured derivatives of Streptococcus lactis and Streptococcus cremoris. Appl. Environ. Microbiol. 40, 964966.
  • [34]
    Kuipers, O.P., de Ruyter, P.J., Kleerebezem, M., de Vos, W.M. (1998) Quorum sensing-controlled gene expression in lactic acid bacteria. J. Biotechnol. 64, 1521.
  • [35]
    Le Loir, Y., Nouaille, S., Commissaire, J., Brétigni, L., Gruss, A., Langella, P. (2001) Signal peptide and propeptide optimization for heterologous protein secretion in Lactococcus lactis 2001. Appl. Environ. Microbiol. 67, 41194127.
  • [36]
    Bermudez-Humaran, L.G., Langella, P., Comissaire, J., Gilbert, S., Le Loir, Y., L'Haridon, R., Corthier, G. (2003) Controlled intra- or extracellular production of staphylococcal nuclease and bovine interferon in Lactococcus lactis. FEMS Microbiol. Lett. 224, 307313.
  • [37]
    Drouault, S., Corthier, G., Ehrlich, S.D., Renault, P. (2000) Expression of the Staphylococcus hyicus lipase in Lactococcus lactis. Appl. Environ. Microbiol. 66, 588598.
  • [38]
    Sambrook, J., Fritsch, E.F., Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  • [39]
    Le Loir, Y., Gruss, A., Ehrlich, S.D., Langella, P. (1994) Direct screening of recombinants in gram-positive bacteria using the secreted staphylococcal nuclease as a reporter. J. Bacteriol. 176, 1355139.
  • [40]
    Madsen, S.M., Albrechtsen, B., Hansen, E.B., Israelsen, H. (1996) Cloning and transcriptional analysis oftwo threonine biosynthetic genes from Lactococcus lactis MG1614. J. Bacteriol. 178, 36893694.
  • [41]
    Poquet, I., Ehrlich, S.D., Gruss, A. (1998) An export-specific reporter designed for Gram positive bacteria: application to Lactococcus lactis. J. Bacteriol. 180, 19041912.
  • [42]
    Buist, G., Kok, J., Leenhouts, K.J., Dabrowska, M., Venema, G., Haandrikman, A.J. (1995) Molecular cloning and nucleotide sequence of the gene encoding the major peptidoglycan hydrolase of Lactococcus lactis, a muramidase needed for cell separation. J. Bacteriol. 177, 15541563.
  • [43]
    Goldberg, A.L. (1972) Correlation between rates of degradation of bacterial proteins in vivo and their sensibility to proteases. Proc. Natl. Acad. Sci. USA. 69, 26402644.
  • [44]
    Misra, R., Castillokeller, M., Deng, M. (2000) Overexpression of protease-deficient DegPS210A rescues the lethal phenotype of Escherichia coli OmpF assembly mutants in a degP background. J. Bacteriol. 182, 48824888.