SEARCH

SEARCH BY CITATION

Keywords:

  • protein phosphorylation;
  • phosphoenolpyruvate-dependent phosphotransferase system (PTS);
  • nitrogen-PTS;
  • EIIANtr;
  • ptsN;
  • yhbJ

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

The nitrogen-related phosphotransferase system (Ntr-PTS) is a paralogous system working in parallel to the well-known carbohydrate:PTS. In a chain of phosphotransfer reactions, EINtr and NPr (PtsO) deliver phosphoryl groups to the EIIANtr (PtsN) protein. EIIANtr is implicated in important regulatory processes such as the σE-dependent cell envelope stress response and regulation of K+ uptake. Phosphorylation is believed to trigger the output of EIIANtr in these regulations. EIIANtr is encoded within the gene cluster ptsN–yhbJ–ptsO, which is highly conserved in Proteobacteria. In this study, we investigated the phosphorylation of the Escherichia coli EIIANtr protein in vivo by 32P-labeling. We show that EIIANtr is readily phosphorylated in wild-type cells. This phosphorylation occurs at a single site, the histidine 73 in EIIANtr. YhbJ and NPr are dispensable for this phosphorylation. A detailed analysis revealed that both the energy coupling phosphotransferases of the Ntr-PTS as well as the ‘sugar’-PTS contribute to the phosphorylation of EIIANtr, suggesting cross talk between both systems.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

The bacterial phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS) is a multiprotein phosphorelay system that couples transport of carbohydrates across the cytoplasmic membrane with their simultaneous phosphorylation. In this system, enzyme I (EI, encoded by ptsI) autophosphorylates with phosphoenolpyruvate and subsequently delivers the phosphoryl group to the histidine protein (HPr, encoded by ptsH), which finally phosphorylates the A subunits/domains of the various substrate-specific transporters called enzymes II (EIIs). EI and HPr are encoded together with the EIIAGlc subunit of the glucose transporter in the ptsHIcrr operon. The PTS also represents a global regulatory system triggering numerous signal transduction pathways (Deutscher et al., 2006).

In addition to the canonical phosphotransferases, the Escherichia coli genome encodes four EI- and five HPr-paralogs [(Tchieu et al., 2001); see supplementary Fig. S1 for an overview]. The fruBKA operon codes for the diphosphoryl transfer protein (DTP), a phosphofructokinase and the fructose transporter EIIFru, respectively. The DTP protein contains an HPr-like domain that is devoted to deliver phosphoryl groups to EIIFru. Cross talk between the canonical PTS and DTP has been observed in several cases (Lux et al., 1995; Görke & Rak, 1999; Sutrina et al., 2002). The DhaM, FryA and FrwA proteins each consist of fused HPr-, EI- and EIIA-like domains. DhaM serves as the phosphoryl-group-delivering subunit of the dihydroxyacetone kinase (Deutscher et al., 2006). Nothing is known about the functions of FryA and FrwA.

Finally, E. coli possesses the remaining paralogous PTS proteins EINtr and NPr, which are encoded by genes ptsP and ptsO (Fig. 1). In vitro, these proteins constitute a phosphorylation transfer chain resulting in the phosphorylation of EIIANtr, which is encoded by ptsN (Rabus et al., 1999). No final acceptor for the phosphoryl groups delivered to EIIANtr has been identified so far. Genes ptsN and ptsO are part of the rpoN operon (Fig. 1), which also codes for the sigma 54 factor that is required for the expression of nitrogen- and stress-related genes (Reitzer & Schneider, 2001). Hence, this paralogous PTS has been named nitrogen-related PTS (Ntr-PTS) (Powell et al., 1995). A further protein, YhbJ, is encoded between ptsN and ptsO (Fig. 1). YhbJ was recently shown to control the amounts of two small RNAs, which regulate the expression of the glmS gene in E. coli (Kalamorz et al., 2007; Reichenbach et al., 2008; Urban & Vogel, 2008). The gene cluster ptsNyhbJptsO is highly conserved in Proteobacteria, suggesting that it has an important role (Deutscher et al., 2006).

image

Figure 1.  Organization of the Ntr-PTS in Escherichia coli. The Ntr-PTS catalyzes a cascade of phosphoryl-transfer reactions that works in parallel to the phosphorylation chain catalyzed by the ‘sugar’ PTS (top). First, EINtr autophosphorylates with phosphoenolpyruvate and subsequently transfers the phosphoryl group to NPr, which finally phosphorylates EIIANtr. So far, no final acceptor for the phosphoryl groups of EIIANtr is known. NPr and EIIANtr are encoded in the rpoN operon, which also contains the genes coding for Sigma 54, the ribosome-associated protein YhbH and YhbJ (bottom). YhbJ is a regulator of small RNAs GlmZ and GlmY. EINtr is encoded elsewhere on the chromosome in the nudH–ptsP operon.

Download figure to PowerPoint

In Pseudomonas putida, it was shown that EIIANtr mediates carbon catabolite repression of the m-xylene and toluene degradation genes and controls the biosynthesis of polyhydroxyalkanoates (Cases et al., 1999; Aranda-Olmedo et al., 2006; Velazquez et al., 2007). The underlying molecular mechanism is unknown. In E. coli, disruption of ptsN suppresses the lethality of a mutation of era coding for an essential GTPase of unknown function (Powell et al., 1995). Overexpression of ptsN suppresses the lethality of a σE mutation, suggesting that EIIANtr reduces stress in the cell envelope by a so far unknown mechanism (Hayden & Ades, 2008). Another study demonstrated that EIIANtr interacts with TrkA, a subunit of the Trk K+ transporter, and thereby inhibits K+ uptake (Lee et al., 2007). It was suggested that this interaction is carried out by the unphosphorylated form of EIIANtr. With respect to all these findings, there is an urgent need to understand the factors that determine the phosphorylation state of EIIANtrin vivo.

In this work, we investigated the phosphorylation of EIIANtr using a 32orthophosphate in vivo-labeling approach. We show that both the canonical phosphotransferases EI/HPr and EINtr/NPr contribute to the phosphorylation of EIIANtr at its histidine 73 residue, suggesting that there is substantial cross talk between these systems in vivo. YhbJ, the protein encoded downstream of ptsN, has no role in the phosphorylation of EIIANtr.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Growth conditions and strains

Cells were routinely grown in Luria–Bertani (LB) medium at 37 °C under agitation (200 r.p.m.), and antibiotics were added where necessary (ampicillin: 100 μg mL−1, chloramphenicol: 15 μg mL−1 and kanamycin: 30 μg mL−1). The strains, plasmids and oligonucleotides used and their characteristics are listed in Table 1. Gene deletions were constructed according to standard procedures (Datsenko & Wanner, 2000), using the oligonucleotides listed in Table 1. First, the exact orf of the target gene was replaced by a chloramphenicol resistance cassette. Subsequently, the cassette gene was removed with the help of plasmid pCP20 as described. T4GT7 transduction (Wilson et al., 1979) was used to move the ΔdhaM∷cat mutation from strain Z124 to strain Z101, resulting in strain Z126. Strain constructions were checked by PCR using appropriate primers.

Table 1.   Strains, plasmids and oligonucleotides used in this study
NameGenotype, relevant structures* or sequenceReferences, construction or properties
  • *

    ori, origin of replication; MCS, multiple cloning site; RBS, ribosomal binding site.

  • Restriction sites are underlined; 5′-phosphorylated oligonucleotides are marked with a P.

  • Positions are relative to the first nucleotide.

Strains
 R1279CSH50 Δ(pho-bgl)201Δ(lac-pro) ara thiGörke & Rak (1999)
 R1653as R1279, but Δ[ptsH ptsI crr]∷neoGörke & Rak (1999)
 R1967as R1279, but Δ[fruB fruK fruA]Görke & Rak (1999)
 R1969as R1279, but Δ[ptsH ptsI crr]∷neo, Δ[fruB fruK fruA]Reichenbach et al. (2007)
 R2404as R1279, but ΔptsPKalamorz et al. (2007)
 R2409as R1279, but ΔptsP, Δ[ptsH ptsI crr]∷neoKalamorz et al. (2007)
 R2413as R1279, but Δ[ptsN, ΔyhbJ, ΔptsO]Kalamorz et al. (2007)
 R2415as R1279, but Δ[ptsN, ΔyhbJ, ΔptsO], Δ[ptsH ptsI crr]∷neoKalamorz et al. (2007)
 Z77as R1279, but ΔptsNcatPCR BG240/BG241[RIGHTWARDS ARROW]R1279; this work
 Z78as R1279, but ΔptsOcatPCR BG242/BG243[RIGHTWARDS ARROW]R1279; this work
 Z79as R1279, but ΔptsNZ77 cured from cat; this work
 Z80as R1279, but ΔptsOZ78 cured from cat; this work
 Z99as R1279, but ΔptsOcat, Δ[ptsH ptsI crr]∷neoPCR BG242/BG243[RIGHTWARDS ARROW]R1653; this work
 Z100as R1279, but ΔptsOcat, Δ[ptsH ptsI crr]∷neo, Δ[fruB fruK fruA]PCR BG242/BG243[RIGHTWARDS ARROW]R1969; this work
 Z101as R1279, but ΔptsO, Δ[ptsH ptsI crr]∷neoZ99 cured from cat; this work
 Z102as R1279, but ΔptsO, Δ[ptsH ptsI crr]∷neo, Δ[fruB fruK fruA]Z100 cured from cat; this work
 Z124as R1279, but ΔdhaMcatPCR BG294/BG295[RIGHTWARDS ARROW]R1279; this work
 Z126as R1279, but ΔptsO, Δ[ptsH ptsI crr]∷neo, ΔdhaMcatT4GT7 (Z124)[RIGHTWARDS ARROW]Z101; this work
Plasmids
 pBAD18ori pMB1, Para, MCS, blaGuzman et al. (1995)
 pBGG86ptsN under PAra-control in pBAD18This work
 pBGG92as pBGG86, but ptsN with a His73Asp exchange (CAT[RIGHTWARDS ARROW]GAT)This work
 pBGG93as pBGG86, but ptsN with a His73Ala exchange (CAT[RIGHTWARDS ARROW]GCT)This work
 pFDX4294ptsN with sacB-RBS under Ptac control, pSC101-ori, catKalamorz et al. (2007)
 pFDX4324yhbJ with sacB-RBS under Ptac control, pSC101-ori, catKalamorz et al. (2007)
Oligos
 BG238TCCCCCGGGAGCTCAAAGGAGGTGAAATTATGACAAATAATGptsN−10 to+13; SacI-site
 BG239GGCTCTAGACTACGCTTCATCCGGAGTAPtsN+500 to+473; XbaI-site
 BG240CTCCGAGCCTGTTCCACTGTTTGAGTGGGCAGGTTCTTAGGTGAAATTGTGTAGGCTGGAGCTGCTTCGptsN−48 to −1
 BG241CTCCTCACAACGTCTAAAAGAGACATTACCGAATAACTACATATGAATATCCTCCTTAGTTCCTATTCCptsN+527 to +489
 BG242GTAAAAACGTCCAGTCACGCCATCGTACGCTGGAAAAACGTAAACCGTGTAGGCTGGAGCTGCTTCGptsO−48 to −1
 BG243GGAGTTTGAAGGGAGTTGTATGTCAAAGTGATGAAGATTACATATGAATATCCTCCTTAGTTCCTATTCCptsO+309 to +270
 BG272P-GTATTGCCATTCCGGATGGCAAACTGGAAGptsN+202 to +231
 BG273P-GTATTGCCATTCCGGCTGGCAAACTGGAAGptsN+202 to +231
 BG294TTATGATGCAAATGTTGGCGTTAGCCGCAAAAGAGTAAGGAATTGGTGGTGTAGGCTGGAGCTGCTTCGdhaM−48 to −1
 BG295TGCCGGATGACATCAGAACGATGCCATCCGAACAGTGGCCATATGAATATCCTCCTTAGTTCCTATTCCdhaM+1457 to +1419

Site-directed mutagenesis and plasmid construction

For the construction of plasmid pBGG86, ptsN was amplified by PCR using primers BG238 and BG239. The DNA fragment obtained was digested with SacI and XbaI and inserted between these sites on plasmid pBAD18. Mutation of the His73 codon in ptsN was performed using the combined chain reaction protocol as described (Bi & Stambrook, 1998). Briefly, PCR reactions were set up that contained, in addition to the external primers BG238 and BG239, the 5-phosphorylated mutagenesis primer BG272 (H79D exchange) or BG273 (H79A exchange) and the thermostable DNA ligase Ampligase (Epicentre), which incorporates the mutagenesis primers into the amplification product. The DNA fragments obtained were cloned between the SacI/XbaI sites on plasmid pBAD18, resulting in plasmids pBGG92 and pBGG93, respectively. Mutations were verified by DNA sequencing.

In vivo protein phosphorylation

Cells were inoculated from precultures into LB medium to an OD600 nm of 0.15 and grown to an OD600 nm of c. 0.5. After addition of 0.2% (w/v) arabinose for the induction of ptsN expression, growth was continued for 20 min. Cells were collected by centrifugation and resuspended in 15 mL Tris-medium (Echols et al., 1961) containing succinate and glycerol as carbon sources and arabinose for ptsN induction where necessary. After a 1-h incubation, cells were collected by centrifugation and resuspended to an OD600 nm of 0.5 in the same medium. To 50 μL of these suspensions, 40 μL Tris-medium containing arabinose when necessary was added and preincubated for 5 min at 37 °C. Thereafter, 10 μL Tris-medium containing 100 μCi H3[32P]O4 was added and incubation was continued for 30 min. Cells were harvested by centrifugation and resuspended in 50 μL sodium dodecyl sulfate (SDS)-gel loading buffer. After incubation for 5 min at 40 °C, 8 μL of these extracts were loaded on a 12.5% SDS-polyacrylamide (PAA) gel, respectively. After electrophoresis, the gels were subjected to five 15-min washes in 40 mM Tris-phosphate buffer (pH 7.2) containing 20 μg mL−1 RNAse to remove the background of radiolabeled RNA. Washing was repeated three times omitting the RNAse. The gels were dried and analyzed by phospho-imaging (Storm 860). All experiments were carried out at least twice, yielding reproducible results.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

The proteins YhbJ and NPr, encoded downstream of ptsN, are not required for the phosphorylation of EIIANtr

The high degree of conservation of the ptsN–yhbJ–ptsO cluster in the genomes of Proteobacteria suggests a functional coupling of the respective proteins. Therefore, we wanted to test the extent to which phosphorylation of EIIANtr might depend on the two proteins encoded downstream of its gene. In order to study phosphorylation of EIIANtrin vivo, we carried out 32P-labeling of cells. First, we examined the protein phosphorylation patterns of mutants, which lacked the canonical phosphotransferases EI and HPr and/or components of the Ntr-PTS. No differences in the protein phosphorylation patterns of these mutants in comparison with the wild type were visible, i.e. phosphorylated EIIANtr protein was not detectable (Fig. 2, lanes 1–6). This is presumably due to its low abundance in the cell. This is in agreement with our previous observations that chromosomally encoded phosphoproteins are difficult to detect using this method (Görke & Rak, 1999). In order to make phosphorylated EIIANtr visible, we placed ptsN on a plasmid under the control of a constitutively active Ptac promoter. An isogenic plasmid carrying yhbJ rather than ptsN served as the control. A strongly phosphorylated protein became visible in the wild-type strain carrying the ptsN construct (Fig. 2, lane 7). In contrast, no signal appeared in the cells carrying the yhbJ expression construct (Fig. 2, lane 8). The phosphorylated protein migrated in the gel at the position expected for EIIANtr (molecular weight=17.96 kDa). In order to determine whether YhbJ and/or NPr are required for the phosphorylation of EIIANtr, we repeated the experiment in a Δ[ptsN-O] mutant, which lacked the complete ptsN–yhbJ–ptsO gene cluster. To our surprise, EIIANtr became readily phosphorylated in this strain also (Fig. 2, lane 9). Overexpression of EIIANtr and YhbJ could also be detected on Coomassie-stained gels, confirming that EIIANtr and YhbJ were synthesized at comparable levels in both strains (data not shown). In conclusion, the data show that both YhbJ and NPr are dispensable for the phosphorylation of EIIANtr under the conditions used. Moreover, YhbJ appears not to be phosphorylated in vivo.

image

Figure 2.  NPr and YhbJ are not required for the phosphorylation of EIIANtr in Escherichia coli. Strains R1279 (lanes 1 and 7–8), R1653 (lane 2), R2404 (lane 3), R2409 (lane 4), R2413 (lanes 5 and 9–10) and R2415 (lane 6) were labeled with H3[32P]O4 and proteins were separated by SDS-PAGE and analyzed by phospho-imaging. The strains had the genotypes as indicated at the top. In lanes 7–10, the strains carried the plasmids pFDX4294 (lanes 7, 9) or pFDX4324 (lanes 8, 10).

Download figure to PowerPoint

The phosphotransferases of the Ntr-PTS and of the canonical PTS contribute equally to phosphorylation of EIIANtrin vivo

Our finding that NPr is dispensable for phosphorylation of EIIANtr suggested that it is additionally phosphorylated by another protein, presumably a paralog of NPr. Therefore, we wanted to analyze in more detail as to which proteins account for the phosphorylation of EIIANtr under in vivo conditions. In the first step, we were interested to identify all those EI paralogs that contribute to phosphorylation of EIIANtr. To this end, we placed ptsN on a plasmid under the control of the arabinose-inducible PBAD promoter, which allowed a controlled synthesis of EIIANtr, resulting in comparable amounts of this protein in various strains upon induction with arabinose. Strains affected in various pts-related genes were transformed with this plasmid and subjected to in vivo32P-labeling. In the absence of arabinose, EIIANtr∼P was undetectable in all the strains tested (Fig. 3, odd-numbered lanes). In contrast, in the presence of arabinose, phosphorylated EIIANtr became readily detectable in the wild-type strain at the expected position in the gel (Fig. 3, lane 2). The intensity of this signal was somewhat reduced, respectively, when mutants lacking EINtr or HPr and EI were tested (Fig. 3, lanes 2, 4 and 6). Quantification revealed that the signal intensities in the ptsP and the ptsHIcrr mutants corresponded to 73±3% and 64±3% of the signal obtained in the wild-type strain, respectively. In a double mutant lacking both EINtr and the EI/HPr pair, phosphorylation of EIIANtr was drastically diminished. However, a weak phosphorylation signal was still detectable (12.5±1% of the signal present in the wild type; Fig. 3, lane 8). These observations suggest that both EINtr and EI of the canonical PTS contribute to the phosphorylation of EIIANtr. In addition, a further yet unidentified EI-like activity might serve as a weak donor of phosphoryl groups to EIIANtr. It appears unlikely that this phosphorylation is caused by DhaM, because its absence has no effect.

image

Figure 3.  Identification of the PTS phosphotransferases contributing to the phosphorylation of EIIANtrin vivo. Strains with the genotypes as indicated at the top were transformed with plasmid pBGG86 carrying ptsN under the control of the PBAD promoter. The transformants were labeled with H3[32P]O4 in the absence (odd-numbered lanes) or presence of arabinose (even-numbered lanes) as the inducer for ptsN expression. The phosphorylated proteins were separated by SDS-PAGE and analyzed by phospho-imaging. The following strains were used: R1279 (lanes 1, 2, 9, 10), R2404 (lanes 3, 4), R1653 (lanes 5, 6, 13, 14), R2409 (lanes 7, 8), Z80 (lanes 11, 12), R1967 (lanes 15, 16), R1969 (lanes 17, 18), Z101 (lanes 19, 20), Z102 (lanes 21, 22) and Z126 (lanes 23, 24).

Download figure to PowerPoint

Next, we wanted to identify the proteins that act as direct phosphoryl-group donors for EIIANtr. The absence of NPr, the cognate phosphoryl-group donor for EIIANtr, resulted in an about twofold reduction of the phosphorylation signal (i.e. 54±2% of the signal obtained in the wild type), similar to a mutant lacking the general canonical PTS components EI and HPr and the glucose-specific EIIAGlc (Fig. 3, compare lanes 10, 12 and 14). When the ptsO and ptsHIcrr mutations were combined, phosphorylation of EIIANtr was almost abolished (Fig. 3, lane 20). However, a very weak signal also remained detectable in this case. We therefore tested whether the EI/HPr-paralogs DTP and DhaM account for this residual phosphorylation. However, deletion of the corresponding genes had no impact on the phosphorylation of EIIANtr (Fig. 3, lanes 16, 18, 20, 22, and 24). Analysis of the various protein extracts on Coomassie-stained SDS gels confirmed that ptsN was expressed in all strains upon addition of arabinose (data not shown). Taken together, the data show that NPr as well as HPr phosphorylate EIIANtr. A so far unknown factor may weakly contribute to the phosphorylation of EIIANtr. The FryA and FrwA proteins might be good candidates for this residual phosphorylation.

Histidine 73 is the single site phosphorylated in EIIANtr

In principle, it appears possible that EIIANtr is phosphorylated at different sites by its three different phosphoryl donors that we detected above. This possibility must be taken into account because a recent phosphoproteome study revealed that HPr from Bacillus subtilis can be phosphorylated at three different sites in vivo (Macek et al., 2007). Structural and genetic analyses suggested EIIANtr to be phosphorylated by NPr at its histidine 73 residue (Bordo et al., 1998; Wang et al., 2005; Lee et al., 2007). However, direct evidence for the phosphorylation of this residue is lacking so far. We therefore mutated the His73 codon in ptsN to aspartate and alanine codons, respectively, and placed these mutant alleles on plasmids under PBAD promoter control. Subsequently, we introduced these plasmids as well as the plasmid carrying the wild-type ptsN into strain Z79, respectively. This strain lacks the chromosomally encoded copy of ptsN. The transformants were radiolabeled with H3[32P]O4 and the phosphorylated proteins were separated on an SDS gel and detected by phospho-imaging. The His73Asp and His73Ala mutations completely abolished phosphorylation of EIIANtr, whereas the wild-type EIIANtr protein became strongly phosphorylated in this strain upon addition of arabinose (Fig. 4, compare lanes 2, 4, and 6). SDS-polyacrylamide gel electrophoresis (PAGE) and Coomassie staining of the total protein of these transformants confirmed that the mutant EIIANtr proteins were indeed expressed (Fig. 4, bottom panel). Hence, His73 is the single site phosphorylated in EIIANtrin vivo.

image

Figure 4.  EIIANtr is phosphorylated at histidine 73. Cultures of strain Z79 (ΔptsN) carrying plasmids encoding either wild-type EIIANtr (plasmid pBGG86, lanes 1, 2) or its mutants with exchanges of His 73 to Asp (pBGG92, lanes 3, 4) or Ala (pBGG93, lanes 5, 6) were labeled with H3[32P]O4. Arabinose as an inducer for ptsN expression was added as indicated. Protein extracts were separated by SDS-PAGE and analyzed by phospho-imaging (top) or Coomassie staining (bottom).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

In this work, we analyzed the phosphorylation of the E. coli EIIANtrin vivo. We show that EIIANtr is strongly phosphorylated in wild-type cells grown in a minimal medium containing succinate and glycerol as carbon sources. This phosphorylation occurs at the histidine 73 residue of EIIANtr (Fig. 4). Mutation of this residue completely abolishes phosphorylation of EIIANtr, ruling out that histidine 120 is also a phosphorylation site as suspected in previous studies (Hayden & Ades, 2008). The E. coli EIIANtr protein plays a role in a number of important regulatory processes. Initially, it was proposed that the Ntr-PTS provides a regulatory link between nitrogen and carbon utilization (Powell et al., 1995). In contrast, recent studies suggest a role of EIIANtr in maintaining cell envelope integrity and in the regulation of K+ uptake. In both processes, the phosphorylation state of EIIANtr was suggested to play a crucial role: it was shown that an EIIANtr-H73A mutant inhibits K+ uptake, suggesting that dephosphorylated EIIANtr binds and inhibits TrkA (Lee et al., 2007). In contrast, EIIANtr-H73A is unable to suppress the lethality of an rpoE mutation, indicating that phosphorylation is required for this function (Hayden & Ades, 2008). In this respect, it is most important to understand the factors and conditions that control EIIANtr phosphorylation. Our analyses showed that EINtr and NPr of the Ntr-PTS are not absolutely required for phosphorylation of EIIANtr. In addition, YhbJ, which is also encoded in the ptsN–ptsO gene cluster, appears to have no role in the phosphorylation of EIIANtr (Fig. 2). In the absence of the Ntr-PTS proteins, EI and HPr of the ‘sugar-PTS’ take over and supply EIIANtr with phosphoryl groups. Absence of the phosphotransferases either of the Ntr-PTS or of the sugar-PTS caused an about twofold reduction of the phosphorylation of EIIANtr (Fig. 3). In a mutant lacking both systems, phosphorylation of EIIANtr was extremely reduced. Hence, both systems contribute to the phosphorylation of EIIANtr under the conditions used here, i.e. in the absence of a PTS substrate. Accordingly, there is substantial cross talk between both systems in vivo. Similar observations have been made recently in P. putida (Pflüger & de Lorenzo, 2008). Our in vivo observations are also in good agreement with previous in vitro experiments, demonstrating that purified EIIANtr protein becomes readily phosphorylated by NPr∼P as well as HPr∼P (Powell et al., 1995; Rabus et al., 1999). Cross talk between both systems also explains the leakiness of ptsO and ptsP mutations in previous studies; e.g. it was shown that TrkA-mediated K+-uptake is inhibited to a lower degree by a ptsO mutation in comparison with a ptsN–H73A mutation (Lee et al., 2007). According to our data, this can be ascribed to HPr, which can compensate at least in part for the loss of NPr and serve as the phosphoryl-group donor for EIIANtr.

In mutants lacking EINtr or NPr in addition to the sugar phosphotransferases EI and HPr, a very weak phosphorylation of EIIANtr was still detectable. Hence, there is a third phosphoryl-groupdonor with EI/HPr-like activity contributing weakly to phosphorylation of EIIANtr. Our data ruled out that the DTP and DhaM paralogous PTS proteins account for this phosphorylation. Therefore, the remaining two EI/HPr paralogs FrwA and FryA might be good candidates for this weak phosphorylation activity. Their roles herein remain to be clarified.

Our observation that there is cross talk between the ‘sugar-PTS’ and the Ntr-PTS suggests that the phosphorylation state of EIIANtr is, at least in part, also determined by the phosphorylation state of the EI/HPr phosphotransferases of the sugar-PTS. Hence, it is tempting to speculate that the regulatory processes exerted by EIIANtr are modulated by the nature of the available carbon source.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

We are grateful to Jörg Stülke for laboratory space and support. We thank Karin Schnetz for comments on the manuscript. This research was supported by a grant from the Deutsche Forschungsgemeinschaft (GO 1355/2-2) to B.G.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Aranda-Olmedo I, Marin P, Ramos JL & Marques S (2006) Role of the ptsN gene product in catabolite repression of the Pseudomonas putida TOL toluene degradation pathway in chemostat cultures. Appl Environ Microbiol 72: 74187421.
  • Bi W & Stambrook PJ (1998) Site-directed mutagenesis by combined chain reaction. Anal Biochem 256: 137140.
  • Bordo D, Van Monfort RL, Pijning T, Kalk KH, Reizer J, Saier MH Jr & Dijkstra BW (1998) The three-dimensional structure of the nitrogen regulatory protein IIANtr from Escherichia coli. J Mol Biol 279: 245255.
  • Cases I, Perez-Martin J & De Lorenzo V (1999) The IIANtr (PtsN) protein of Pseudomonas putida mediates the C source inhibition of the sigma54-dependent Pu promoter of the TOL plasmid. J Biol Chem 274: 1556215568.
  • Datsenko KA & Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97: 66406645.
  • Deutscher J, Francke C & Postma PW (2006) How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev 70: 9391031.
  • Echols H, Garen A, Garen S & Torriani A (1961) Genetic control of repression of alkaline phosphatase in E. coli. J Mol Biol 3: 425438.
  • Görke B & Rak B (1999) Catabolite control of Escherichia coli regulatory protein BglG activity by antagonistically acting phosphorylations. EMBO J 18: 33703379.
  • Guzman LM, Belin D, Carson MJ & Beckwith J (1995) Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol 177: 41214130.
  • Hayden JD & Ades SE (2008) The extracytoplasmic stress factor, sigma E, is required to maintain cell envelope integrity in Escherichia coli. PLoS ONE 3: e1573.
  • Kalamorz F, Reichenbach B, März W, Rak B & Görke B (2007) Feedback control of glucosamine-6-phosphate synthase GlmS expression depends on the small RNA GlmZ and involves the novel protein YhbJ in Escherichia coli. Mol Microbiol 65: 15181533.
  • Lee CR, Cho SH, Yoon MJ, Peterkofsky A & Seok YJ (2007) Escherichia coli enzyme IIANtr regulates the K+ transporter TrkA. Proc Natl Acad Sci USA 104: 41244129.
  • Lux R, Jahreis K, Bettenbrock K, Parkinson JS & Lengeler JW (1995) Coupling the phosphotransferase system and the methyl-accepting chemotaxis protein-dependent chemotaxis signaling pathways of Escherichia coli. Proc Natl Acad Sci USA 92: 1158311587.
  • Macek B, Mijakovic I, Olsen JV, Gnad F, Kumar C, Jensen PR & Mann M (2007) The serine/threonine/tyrosine phosphoproteome of the model bacterium Bacillus subtilis. Mol Cell Proteomics 6: 697707.
  • Pflüger K & De Lorenzo V (2008) Evidence of in vivo cross talk between the nitrogen-related and fructose-related branches of the carbohydrate phosphotransferase system of Pseudomonas putida. J Bacteriol 190: 33743380.
  • Powell BS, Court DL, Inada T, Nakamura Y, Michotey V, Cui X, Reizer A, Saier MH Jr & Reizer J (1995) Novel proteins of the phosphotransferase system encoded within the rpoN operon of Escherichia coli. Enzyme IIANtr affects growth on organic nitrogen and the conditional lethality of an erats mutant. J Biol Chem 270: 48224839.
  • Rabus R, Reizer J, Paulsen I & Saier MH Jr (1999) Enzyme INtr from Escherichia coli. A novel enzyme of the phosphoenolpyruvate-dependent phosphotransferase system exhibiting strict specificity for its phosphoryl acceptor, NPr. J Biol Chem 274: 2618526191.
  • Reichenbach B, Breustedt DA, Stülke J, Rak B & Görke B (2007) Genetic dissection of specificity determinants in the interaction of HPr with enzymes II of the bacterial phosphoenolpyruvate: sugar phosphotransferase system in Escherichia coli. J Bacteriol 189: 46034613.
  • Reichenbach B, Maes A, Kalamorz F, Hajnsdorf E & Görke B (2008) The small RNA GlmY acts upstream of the sRNA GlmZ in the activation of glmS expression and is subject to regulation by polyadenylation in Escherichia coli. Nucleic Acids Res 36: 25702580.
  • Reitzer L & Schneider BL (2001) Metabolic context and possible physiological themes of sigma(54)-dependent genes in Escherichia coli. Microbiol Mol Biol Rev 65: 422444.
  • Sutrina SL, Alleyne L, Hoyte K & Blenman M (2002) Effect of replacing the general energy-coupling proteins of the PEP: sugar phosphotransferase system of Salmonella typhimurium with their fructose-inducible counterparts on utilization of the PTS sugar glucitol. Microbiology 148: 38573864.
  • Tchieu JH, Norris V, Edwards JS & Saier MH Jr (2001) The complete phosphotransferase system in Escherichia coli. J Mol Microbiol Biotechnol 3: 329346.
  • Urban JH & Vogel J (2008) Two seemingly homologous noncoding RNAs act hierarchically to activate glmS mRNA translation. PLoS Biol 6: e64.
  • Velazquez F, Pflüger K, Cases I, De Eugenio LI & De Lorenzo V (2007) The phosphotransferase system formed by PtsP, PtsO, and PtsN proteins controls production of polyhydroxyalkanoates in Pseudomonas putida. J Bacteriol 189: 45294533.
  • Wang G, Peterkofsky A, Keifer PA & Li X (2005) NMR characterization of the Escherichia coli nitrogen regulatory protein IIANtr in solution and interaction with its partner protein, NPr. Protein Sci 14: 10821090.
  • Wilson GG, Young KY, Edlin GJ & Konigsberg W (1979) High-frequency generalised transduction by bacteriophage T4. Nature 280: 8082.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Fig. S1. Paralogous EI and HPr proteins in E. coli and their functions.

This material is available as part of the online article from: http://www.blackwell-synergy.com/doi/abs/10.1111/j.1574-6968.2008.01262.x (this link will take you to the article abstract.)

Please note: Blackwell Publishing are not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

FilenameFormatSizeDescription
FML_1262_sm_FigS1.doc486KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.